Isolation and Characterization of New 24 Microsatellite DNA Markers for Golden Cuttlefish (Sepia esculenta)
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
3.1. DNA Extraction
3.2. Microsatellite-Enriched Library Construction
3.3. PCR Amplification and Genotyping
3.4. Genetic Data Analysis
4. Conclusions
Acknowledgements
References
- Nesis, K.N. Cephalopods of the World; T. F. H. Publications: Neptune City, NJ, USA, 1987; pp. 109–110. [Google Scholar]
- Okutani, T. Cuttlefish and Squids of the World in Color; National Cooperative Association of Squid Processors: Tokyo, Japan, 1995; p. 43. [Google Scholar]
- Hao, Z.L.; Zhang, X.M.; Zhang, P.D. Biological characteristics and multiplication techniques of S. esculenta (in Chinese). Chin. J. Ecol 2007, 26, 601–606. [Google Scholar]
- Liu, L.L.; Wan, R.; Duan, Y.Y.; Wang, X.J. Status and effect of enhancement release of marine fisheries resource in Shandong. Trans. Oceanol. Limnol 2008, 4, 91–98. [Google Scholar]
- Zheng, X.D.; Zhao, J.M.; Shu, X.; Wang, R.C.; Wang, S.D.; Zhou, W.W. Isozymes analysis of the golden cuttlefish Sepia esculenta (Cephalopoda: Sepiidea). J. Ocean Univ. China 2004, 3, 48–52. [Google Scholar]
- Zheng, X.D.; Ikeda, M.; Barinova, A.; Taniguchi, N. Isolation and characterization of microsatellite DNA loci from the golden cuttlefish, Sepia esculenta Hoyle (Cephalopoda). Mol. Ecol. Notes 2007, 7, 40–42. [Google Scholar]
- Zheng, X.D.; Ikeda, M.; Kong, L.F.; Lin, X.Z.; Li, Q.; Taniguchi, N. Genetic diversity and population structure of the golden cuttlefish, Sepia esculenta (Cephalopoda: Sepiidea) indicated by microsatellite DNA variations. Mar. Ecol 2009, 30, 448–454. [Google Scholar]
- Wang, H.; Lin, L.; Liu, S.F. Isolation and characterization of polymorphic microsatellite loci in golden cuttlefish (Sepia esculenta). Mol. Ecol. Resour 2011, 11, 418–421. [Google Scholar]
- Liao, M.J.; Wang, Y.G.; Rong, X.J.; Zhang, Z.; Li, B. Development of new microsatellite DNA markers from apostichopus japonicus and their cross-species application in parastichopus parvimensis and pathallus mollis. Int. J. Mol. Sci 2011, 12, 5862–5870. [Google Scholar]
- Wang, H.J.; Lin, H.D.; Zhang, L.Y.; Ding, S.X. Development and characterization of 20 microsatellite markers for Chinese black sleeper, bostrychus sinensis. Int. J. Mol. Sci 2011, 12, 9570–9575. [Google Scholar]
- Lin, L.; Zhu, L.; Liu, S.F.; Su, Y.Q.; Zhuang, Z.M. Polymorphic microsatellite loci for the Japanese anchovy Engraulis japonicus (Engraulidae). Genet. Mol. Res 2011, 10, 764–768. [Google Scholar]
- Manami, K.; Li, Q.; Akihiro, K. Isolation and characterization of twenty microsatellite loci in Japanese Sea Cucumber (Stichopus japonicus). Mar. Biotechnol 2005, 7, 179–183. [Google Scholar]
- Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed; Cold Spring Harbor Laboratory Press: New York, NY, USA, 2001; pp. 467–470. [Google Scholar]
- Raymond, M.; Rousset, F. Genepop (version 1.2), population genetics software for exact test and ecumenicism. J. Hered 1995, 86, 248–249. [Google Scholar]
- Van Oosterhout, C.; Hutchinson, W.F. Micro-checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- Rice, W.R. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar]
Loci | Genbank accession No. | Repeat motif | Primer sequence(5′-3′) | Size range (bp) | Ta (°C) | NA | HO | HE | PHW |
---|---|---|---|---|---|---|---|---|---|
J1 | JQ317936 | (TG)7 | F: GGTCCAAAGTATGTGAAG R: GTGAAAATGTTGGGTTAT | 242–245 | 55 | 4 | 0.2917 | 0.3535 | 0.0263 |
J3 | JQ317937 | (TG)9 | F: TCCTCAATCCAAGTCGCTAT R: AACCCAGACACTGATGGTAATC | 343–360 | 55 | 8 | 0.3958 | 0.7627 | 0.0086 |
J5 | JQ317938 | (AC)11(AC)8(AT)8 | F: ACGTTTATAAGAGCAACAC R: CAGAATAGATTACCCACAA | 217–260 | 57 | 18 | 0.6087 | 0.9200 | 0.0000* |
J6-1 | JQ317939 | (TA)5 | F: GCATCAAAACATAAATAC R: ACTCACTACGAGAAATCA | 309–330 | 55 | 5 | 0.4894 | 0.5468 | 0.2773 |
J6-2 | JQ317939 | (GT)6 | F: GAATAATTACTCAGAGGCAC R: TCTATTTCCATTTTCGTG | 320–350 | 57 | 4 | 0.5455 | 0.5541 | 0.0474 |
J8 | JQ317940 | (CA)27 | F: ATTTCAGTTATGGTCCTTG R: ATTCTGTAGCCATCAAGC | 300–380 | 57 | 13 | 0.7083 | 0.8789 | 0.0006* |
J10 | JQ317941 | (AC)6..(AC)23(ATC)5 | F: CAGCCTCACTACGAAGAA R: RGATACGCAACCGAGACAC | 300–330 | 45 | 5 | 0.3404 | 0.5269 | 0.0161 |
J12 | JQ317942 | (TG)9 | F: CGTTTGCGTAGGATGTCA R: GTCGGTCTTGGTACTTTCAC | 250–260 | 55 | 4 | 0.6250 | 0.6656 | 0.1807 |
J13 | JQ317943 | (TC)9(TC)6(CT)7(GTAT)7(TATC)7 | F: TAAGTTTCGTAGGGTATCAC R: ATGTATTTCGGCTTTGGA | 290–380 | 55 | 17 | 0.8085 | 0.8943 | 0.0152 |
J14 | JQ317944 | (CA)12 | F: CAAGCAGGATTCAAGTTC R: TTTATCATCATTCCCAGG | 250–290 | 55 | 21 | 0.8958 | 0.9349 | 0.0913 |
J17 | JQ317945 | (TG)25 | F: ATTGGAAATCGGTGAGCT R: GATGGGAGTTGGGAAATG | 217–260 | 55 | 20 | 0.7234 | 0.8950 | 0.0000* |
J19 | JQ317946 | (TG)16 | F: ACTAGCTTAGCTGGAGACG R: GAAATTGGCTTGGTGATT | 217–250 | 50 | 9 | 0.5227 | 0.6084 | 0.0265 |
J25 | JQ317947 | (AC)9 | F: CACATGGCCTAAAGATTG R: AAGGGTGGAGAATAGTTTG | 195–205 | 55 | 6 | 0.6458 | 0.6401 | 0.6535 |
J35 | JQ317948 | (AC)21 | F: GAGAAGCGACAAGCAATA R: GACTGTAACCTGGAAGCA | 220–270 | 57 | 19 | 0.8511 | 0.9272 | 0.0026 |
J48 | JQ317949 | (GT)6 | F: GCAAACCAATAGGTCATC R: TACTTGTACCGAAAAGCA | 270–290 | 57 | 5 | 0.4894 | 0.6436 | 0.0137 |
J50 | JQ317950 | (TG)6..(GA)5 | F: TGTTCCGTGTCGCCTTTG R: TGGGTCGTTGGACAACCTG | 217–230 | 55 | 4 | 0.2558 | 0.3425 | 0.0063 |
J58 | JQ317951 | (GT)10 | F: AGACCCAGTAGTAAGCAAA R: TCCACTAACTTGGAGCAT | 264 | 55 | 3 | 0.5106 | 0.6111 | 0.0110 |
J60 | JQ317952 | (TG)5 | F: AATTTCGATCATCTTCCAT R: CATTCCAATAGACATTTTGTA | 190 | 55 | 2 | 0.0625 | 0.1366 | 0.0116 |
J61 | JQ317953 | (AG)27 | F: CACAATGTATACTACGCCTCT R: ATGCTTACCTCTTTATCCG | 240–300 | 55 | 20 | 0.8750 | 0.9419 | 0.0000* |
J63 | JQ317954 | (AC)5(AC)13 | F: GAAAACGATACAAGGAGT R: GTGCAAGAAACAAAGACA | 260–309 | 55 | 13 | 0.6042 | 0.8936 | 0.0000* |
J74 | JQ317955 | (AC)26 | F: GTTGGGAAATGCAAAGTC R: CAAGTTACAGCGGAGAAA | 242–309 | 52 | 25 | 0.8085 | 0.9533 | 0.0000* |
J77 | JQ317956 | (CT)5(CA)18 | F: TTCCTCACAAACTATTCT R: TGATTTCTCCATCTGTTA | 310–400 | 55 | 10 | 0.6809 | 0.8055 | 0.1457 |
J78 | JQ317957 | (AC)9 | F: TGTGAACCCGAAACGAAC R: ATGGCAAGGAGAATGTGG | 310–360 | 50 | 5 | 0.4894 | 0.7376 | 0.0024 |
J83 | JQ317958 | (TG)7 | F: TAAGCAAGACCAGAGTAGCC R: GTAAATTGTTGTGCAAATCC | 250–280 | 50 | 7 | 0.7391 | 0.8321 | 0.1032 |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Yuan, Y.; Liu, S.; Bai, C.; Liu, H.; Zhuang, Z. Isolation and Characterization of New 24 Microsatellite DNA Markers for Golden Cuttlefish (Sepia esculenta). Int. J. Mol. Sci. 2012, 13, 1154-1160. https://doi.org/10.3390/ijms13011154
Yuan Y, Liu S, Bai C, Liu H, Zhuang Z. Isolation and Characterization of New 24 Microsatellite DNA Markers for Golden Cuttlefish (Sepia esculenta). International Journal of Molecular Sciences. 2012; 13(1):1154-1160. https://doi.org/10.3390/ijms13011154
Chicago/Turabian StyleYuan, Yanjiao, Shufang Liu, Cuicui Bai, Hongbo Liu, and Zhimeng Zhuang. 2012. "Isolation and Characterization of New 24 Microsatellite DNA Markers for Golden Cuttlefish (Sepia esculenta)" International Journal of Molecular Sciences 13, no. 1: 1154-1160. https://doi.org/10.3390/ijms13011154
APA StyleYuan, Y., Liu, S., Bai, C., Liu, H., & Zhuang, Z. (2012). Isolation and Characterization of New 24 Microsatellite DNA Markers for Golden Cuttlefish (Sepia esculenta). International Journal of Molecular Sciences, 13(1), 1154-1160. https://doi.org/10.3390/ijms13011154