Identification of Acanthopanax trifoliatus (L.) Merr as a Novel Potential Therapeutic Agent Against COVID-19 and Pharyngitis
Abstract
1. Introduction
2. Materials and Methods
2.1. Ligand Library Preparation
2.2. Protein Model Preparation
2.3. Docking and Screening
2.4. Chemicals and Cell Lines
2.5. Cell Treatments
2.6. RNA Extraction, Reverse Transcription, and Real Time-PCR
2.7. Statistical Analysis
3. Results
3.1. Workflow for Ligand–Protein Interactions Discovery Using Binding-Affinity Selection
3.2. Discovery of Bioactive Molecules Targeting COVID-19 and Pharyngitis
3.3. Multi-Target Action Mode of Bioactive Compounds
3.4. Docking Poses and Experimental Validation of Two Hit Compounds
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ciotti, M.; Ciccozzi, M.; Terrinoni, A.; Jiang, W.C.; Wang, C.B.; Bernardini, S. The COVID 19 Pandemic. Crit. Rev. Clin. Lab. Sci. 2020, 57, 365–388. [Google Scholar] [CrossRef] [PubMed]
- Vihta, K.-D.; Pouwels, K.B.; Peto, T.E.A.; Pritchard, E.; House, T.; Studley, R.; Walker, A.S. Omicron-Associated Changes in Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) Symptoms in the United Kingdom. Clin. Infect. Dis. 2023, 76, e133–e141. [Google Scholar]
- Iranmanesh, B.; Khalili, M.; Amiri, R.; Zartab, H.; Aflatoonian, M. Oral manifestations of COVID-19 disease: A review article. Dermatol. Ther. 2021, 34, e14578. [Google Scholar] [CrossRef]
- Cots, J.M.; Alós, J.-I.; Bárcena, M.; Boleda, X.; Cañada, J.L.; Gómez, N.; Mendoza, A.; Vilaseca, I.; Llor, C. Recommendations for Management of Acute Pharyngitis in Adults. Acta Otorrinolaringol. Engl. Ed. 2015, 66, 159–170. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Cheng, S.; Lin, H.; Wu, W.; Liang, L.; Chen, X.; Zheng, X.; He, Y.; Zhang, K. Antibacterial, Anti-Inflammatory, Analgesic, and Hemostatic Activities of Acanthopanax Trifoliatus (L.) Merr. Food Sci. Nutr. 2021, 9, 2191–2202. [Google Scholar] [CrossRef]
- Sithisarn, P.; Jarikasem, S.; Muensaen, S. Comparative HPLC analysis of phenolic compounds in the roots of Acanthopanax trifoliatus and Acanthopanax senticosus. Acta Hortic. 2016, 1125, 19–24. [Google Scholar] [CrossRef]
- Hamid, R.; Kee, T.; Othman, F.; Ra, H.; Th, K. Anti-inflammatory and anti-hyperalgesic activities of Acanthopanax trifoliatus (L) Merr leaves. Pharmacogn. Res. 2013, 5, 129–133. [Google Scholar] [CrossRef]
- Lin, Y.; Pan, J.; Liu, Y.; Yang, H.; Wu, G.; Pan, Y. Acanthopanax trifoliatus (L.) Merr polysaccharides ameliorates hyperglycemia by regulating hepatic glycogen metabolism in type 2 diabetic mice. Front. Nutr. 2023, 10, 1111287. [Google Scholar] [CrossRef]
- Li, P.; Chen, Y.; Luo, L.; Yang, H.; Pan, Y. Immunoregulatory Effect of Acanthopanax trifoliatus (L.) Merr. Polysaccharide on T1DM Mice. Drug Des. Dev. Ther. 2021, 15, 2629–2639. [Google Scholar] [CrossRef]
- Duke, J.A.; Ayensu, E.S. Medicinal Plants of China; Plunkett, G.M., Ghillean, T., Eds.; Reference Publications Inc.: Algonac, MI, USA, 1985; p. 194. [Google Scholar]
- Sadybekov, A.V.; Katritch, V. Computational Approaches Streamlining Drug Discovery. Nature 2023, 616, 673–685. [Google Scholar] [CrossRef] [PubMed]
- Frye, L.; Bhat, S.; Akinsanya, K.; Abel, R. From computer-aided drug discovery to computer-driven drug discovery. Drug Discov. Today Technol. 2021, 39, 111–117. [Google Scholar] [CrossRef]
- Yang, X.; Wang, Y.; Byrne, R.; Schneider, G.; Yang, S. Concepts of Artificial Intelligence for Computer-Assisted Drug Discovery. Chem. Rev. 2019, 119, 10520–10594. [Google Scholar] [CrossRef] [PubMed]
- Jiménez-Luna, J.; Grisoni, F.; Weskamp, N.; Schneider, G. Artificial intelligence in drug discovery: Recent advances and future perspectives. Expert Opin. Drug Discov. 2021, 16, 949–959. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Bhardwaj, V.K.; Purohit, R. Inhibition of Nonstructural Protein 15 of Sars-CoV-2 by Golden Spice: A Computational Insight. Cell Biochem. Funct. 2022, 40, 926–934. [Google Scholar] [CrossRef] [PubMed]
- Sharma, J.; Bhardwaj, V.K.; Singh, R.; Rajendran, V.; Purohit, R.; Kumar, S. An in-Silico Evaluation of Different Bioactive Molecules of Tea for Their Inhibition Potency against Non Structural Protein-15 of SARS-CoV-2. Food Chem. 2021, 346, 128933. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Bhardwaj, V.K.; Sharma, J.; Kumar, D.; Purohit, R. Identification of Potential Plant Bioactive as SARS-CoV-2 Spike Protein and Human Ace2 Fusion Inhibitors. Comput. Biol. Med. 2021, 136, 104631. [Google Scholar] [CrossRef]
- Wang, H.; Li, D.; Du, Z.; Huang, M.-T.; Cui, X.; Lu, Y.; Li, C.; Woo, S.L.; Conney, A.H.; Zheng, X.; et al. Antioxidant and anti-inflammatory properties of Chinese ilicifolius vegetable (Acanthopanax trifoliatus (L.) Merr) and its reference compounds. Food Sci. Biotechnol. 2015, 24, 1131–1138. [Google Scholar] [CrossRef]
- Wang, B.Q.; Guo, X.L.; Liu, Y.; Lian, Y.Y.; Zhang, Q. Research Advances in Chemical Constituents and Pharmacological Activities of Acanthopanan Trifoliatus (L.) Merr. North. Hortic. 2018, 7. Available online: https://qikan.cqvip.com/Qikan/Article/Detail?id=675603723 (accessed on 20 December 2024).
- Zhi, N. The Chemical Constituents of Volatile Oil from the Leaves of Acanthopanax trifoliatus. Guihaia 2005, 25, 261–263. [Google Scholar]
- Liu, J.Z.; Yan, H.J.; Fang, Z.J. Analysis of Volatile Oil Components in Acanthopanan trifoliatus (L.) Merr. Henan Tradit. Chin. Med. 2009, 29, 505–506. [Google Scholar]
- Muselli, A.; Hoi, T.M.; Cu, L.D.; Moi, L.D.; Bessière, J.; Bighelli, A.; Casanova, J. Composition of the essential oil of Acanthopanax trifoliatus (L.) Merr. (Araliacaea) from Vietnam. Flavour Fragr. J. 1999, 14, 41–44. [Google Scholar] [CrossRef]
- Jiang, D.; Lin, G. Studies on Chemical Constituents of the Leaves of Acanthopanax trifoliatus (Linn) Merr. China J. Chin. Mater. Medica 1992, 17, 2. [Google Scholar]
- Yook, C.S.; Chang, S.Y.; Lai, J.H.; Ko, S.K.; Jeong, J.H.; Nohara, T. Lupane-Glycoside of Acanthopanax trifoliatus Forma Tristigmatis Leaves. Arch. Pharm. Res. 1999, 22, 629–632. [Google Scholar] [CrossRef] [PubMed]
- Van Kiem, P.; Van Minh, C.; Cai, X.F.; Lee, J.J.; Kim, Y.H. A New 24-nor-lupane-glycoside of Acanthopanax trifoliatus. Arch. Pharmacal. Res. 2003, 26, 706–708. [Google Scholar] [CrossRef]
- Li, D.-L.; Zheng, X.; Chen, Y.-C.; Jiang, S.; Zhang, Y.; Zhang, W.-M.; Wang, H.-Q.; Du, Z.-Y.; Zhang, K. Terpenoid composition and the anticancer activity of Acanthopanax trifoliatus. Arch. Pharmacal. Res. 2015, 39, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Van Kiem, P.; Van Minn, C.; Dat, N.T.; Cai, X.F.; Lee, J.J.; Kim, Y.H. Two new phenylpropanoid glycosides from the stem bark of Acanthopanax trifoliatus. Arch. Pharmacal. Res. 2003, 26, 1014–1017. [Google Scholar] [CrossRef] [PubMed]
- Morris, G.M.; Huey, R.; Lindstrom, W.; Sanner, M.F.; Belew, R.K.; Goodsell, D.S.; Olson, A.J. AutoDock4 and AutoDockTools4: Automated docking with selective receptor flexibility. J. Comput. Chem. 2009, 30, 2785–2791. [Google Scholar] [CrossRef]
- Gorgulla, C.; Boeszoermenyi, A.; Wang, Z.-F.; Fischer, P.D.; Coote, P.W.; Das, K.M.P.; Malets, Y.S.; Radchenko, D.S.; Moroz, Y.S.; Scott, D.A.; et al. An open-source drug discovery platform enables ultra-large virtual screens. Nature 2020, 580, 663–668. [Google Scholar] [CrossRef] [PubMed]
- Berman, H.M.; Westbrook, J.; Feng, Z.; Gilliland, G.; Bhat, T.N.; Weissig, H.; Bourne, P.E. The Protein Data Bank. Nucleic Acids Res. 2000, 28, 235–242. [Google Scholar] [CrossRef] [PubMed]
- Schöning-Stierand, K.; Diedrich, K.; Fährrolfes, R.; Flachsenberg, F.; Meyder, A.; Nittinger, E.; Steinegger, R.; Rarey, M. ProteinsPlus: Interactive analysis of protein–ligand binding interfaces. Nucleic Acids Res. 2020, 48, W48–W53. [Google Scholar] [CrossRef] [PubMed]
- Fährrolfes, R.; Bietz, S.; Flachsenberg, F.; Meyder, A.; Nittinger, E.; Otto, T.; Volkamer, A.; Rarey, M. ProteinsPlus: A web portal for structure analysis of macromolecules. Nucleic Acids Res. 2017, 45, W337–W343. [Google Scholar] [CrossRef] [PubMed]
- Trott, O.; Olson, A.J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2010, 31, 455–461. [Google Scholar] [CrossRef] [PubMed]
- Quiroga, R.; Villarreal, M.A. Vinardo: A Scoring Function Based on Autodock Vina Improves Scoring, Docking, and Virtual Screening. PLoS ONE 2016, 11, e0155183. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, R.; Smith, J.C. Speed vs Accuracy: Effect on Ligand Pose Accuracy of Varying Box Size and Exhaustiveness in AutoDock Vina. Mol. Inform. 2022, 42, e2200188. [Google Scholar] [CrossRef] [PubMed]
- Adasme, M.F.; Linnemann, K.L.; Bolz, S.N.; Kaiser, F.; Salentin, S.; Haupt, V.J.; Schroeder, M. PLIP 2021: Expanding the scope of the protein–ligand interaction profiler to DNA and RNA. Nucleic Acids Res. 2021, 49, W530–W534. [Google Scholar] [CrossRef]
- Gullón, B.; Lu-Chau, T.A.; Moreira, M.T.; Lema, J.M.; Eibes, G. Rutin: A review on extraction, identification and purification methods, biological activities and approaches to enhance its bioavailability. Trends Food Sci. Technol. 2017, 67, 220–235. [Google Scholar] [CrossRef]
- Wang, H.-N.; Shen, Z.; Liu, Q.; Hou, X.-Y.; Cao, Y.; Liu, D.-H.; Jiang, H.; DU, H.-Z. Isochlorogenic acid (ICGA): Natural medicine with potentials in pharmaceutical developments. Chin. J. Nat. Med. 2020, 18, 860–871. [Google Scholar] [CrossRef] [PubMed]
- Xian, Y.; Zhang, J.; Bian, Z.; Zhou, H.; Zhang, Z.; Lin, Z.; Xu, H. Bioactive natural compounds against human coronaviruses: A review and perspective. Acta Pharm. Sin. B 2020, 10, 1163–1174. [Google Scholar] [CrossRef] [PubMed]
- Soosai, D.; Ravindhran, R.; Perumal, E.; Sasikumar, C.S.; Charles, P. Mitigation of H2O2 induced Reactive Oxygen species and Proinflammatory cytokines by Buckwheat (Fagopyrum tataricum) rutin in cultured RAW264.7 cells. Biocatal. Agric. Biotechnol. 2024, 63, 103462. [Google Scholar] [CrossRef]
- Zhao, L.; Zhang, H.; Xu, M.; Bao, X.; Ai, X.; Chen, Y. Anti-Inflammatory Effect of Stevia Residue Extract and Its Main Components Isochlorogenic Acids. J. Chin. Inst. Food Sci. Technol. 2021, 21, 117–124. [Google Scholar]
- Jodynis-Liebert, J.; Kujawska, M. Biphasic Dose-Response Induced by Phytochemicals: Experimental Evidence. J. Clin. Med. 2020, 9, 718. [Google Scholar] [CrossRef]
- Muvhulawa, N.; Dludla, P.V.; Ziqubu, K.; Mthembu, S.X.; Mthiyane, F.; Nkambule, B.B.; Mazibuko-Mbeje, S.E. Rutin ameliorates inflammation and improves metabolic function: A comprehensive analysis of scientific literature. Pharmacol. Res. 2022, 178, 106163. [Google Scholar] [CrossRef]
- Mazik, M. Promising Therapeutic Approach for SARS-CoV-2 Infections by Using a Rutin-Based Combination Therapy. ChemMedChem 2022, 17, e202200157. [Google Scholar] [CrossRef] [PubMed]
- Rahman, F.; Tabrez, S.; Ali, R.; Alqahtani, A.S.; Ahmed, M.Z.; Rub, A. Molecular Docking Analysis of Rutin Reveals Possible Inhibition of SARS-CoV-2 Vital Proteins. J. Tradit. Complement. Med. 2021, 11, 173–179. [Google Scholar] [CrossRef]
- Liu, Y.; Liang, J.; Ding, Q.; Xu, C.; Liu, M.; Yang, C. Isochlorogenic Acid C Restrains Erk/JNK/NF-κB Signaling to Alleviate Inflammatory Response and Promote Cell Apoptosis. J. Food Biochem. 2023, 2023, 5547108. [Google Scholar] [CrossRef]
- Tarabishi, A.A.; Mashhoud, J.; Tahan, Z.S. Quercetin and rutin as a dual approach to antibacterial and anti-biofilm activity via iron chelation mechanism. Discov. Food 2024, 4, 1–10. [Google Scholar] [CrossRef]
- Das, D.; Banerjee, A.; Mukherjee, S.; Maji, B.K. Quercetin Inhibits Nf-Kb and Jak/Stat Signaling Via Modulating Tlr in Thymocytes and Splenocytes During Msg-Induced Immunotoxicity: An in Vitro Approach. Mol. Biol. Rep. 2024, 51, 277. [Google Scholar] [CrossRef]
- Xu, J.; Li, Y.; Yang, X.; Li, H.; Xiao, X.; You, J.; Li, H.; Zheng, L.; Yi, C.; Li, Z.; et al. Quercetin inhibited LPS-induced cytokine storm by interacting with the AKT1-FoxO1 and Keap1-Nrf2 signaling pathway in macrophages. Sci. Rep. 2024, 14, 20913. [Google Scholar] [CrossRef]
- Ziaei, S.; Alimohammadi-Kamalabadi, M.; Hasani, M.; Malekahmadi, M.; Persad, E.; Heshmati, J. The effect of quercetin supplementation on clinical outcomes in COVID-19 patients: A systematic review and meta-analysis. Food Sci. Nutr. 2023, 11, 7504–7514. [Google Scholar] [CrossRef] [PubMed]
- Lee, G.B.; Kim, Y.; Lee, K.E.; Vinayagam, R.; Singh, M.; Kang, S.G. Anti-Inflammatory Effects of Quercetin, Rutin, and Troxerutin Result from the Inhibition of NO Production and the Reduction of COX-2 Levels in RAW 264.7 Cells Treated with LPS. Appl. Biochem. Biotechnol. 2024, 196, 8431–8452. [Google Scholar] [CrossRef]
- Zhang, F.X.; Gadotti, V.M.; Souza, I.A.; Chen, L.; Zamponi, G.W. BK Potassium Channels Suppress Cavalpha2delta Subunit Function to Reduce Inflammatory and Neuropathic Pain. Cell Rep. 2018, 22, 1956–1964. [Google Scholar] [CrossRef] [PubMed]
- Yuan, P.; Leonetti, M.D.; Pico, A.R.; Hsiung, Y.; MacKinnon, R. Structure of the human BK channel Ca2+-activation apparatus at 3.0 A resolution. Science 2010, 329, 182–186. [Google Scholar] [CrossRef] [PubMed]
- Yuan, D.; Liu, Z.; Kaindl, J.; Maeda, S.; Zhao, J.; Sun, X.; Xu, J.; Gmeiner, P.; Wang, H.W.; Kobilka, B.K. Activation of the alpha(2B) adrenoceptor by the sedative sympatholytic dexmedetomidine. Nat. Chem. Biol. 2020, 16, 507–512. [Google Scholar] [CrossRef] [PubMed]
- Yoon, S.I.; Logsdon, N.J.; Sheikh, F.; Donnelly, R.P.; Walter, M.R. Conformational changes mediate interleukin-10 receptor 2 (IL-10R2) binding to IL-10 and assembly of the signaling complex. J. Biol. Chem. 2006, 281, 35088–35096. [Google Scholar] [CrossRef] [PubMed]
- Yabal, M.; Muller, N.; Adler, H.; Knies, N.; Gross, C.J.; Damgaard, R.B.; Kanegane, H.; Ringelhan, M.; Kaufmann, T.; Heikenwalder, M.; et al. XIAP restricts TNF- and RIP3-dependent cell death and inflammasome activation. Cell Rep. 2014, 7, 1796–1808. [Google Scholar] [CrossRef] [PubMed]
- Xue, J.; Han, Y.; Zeng, W.; Wang, Y.; Jiang, Y. Structural mechanisms of gating and selectivity of human rod CNGA1 channel. Neuron 2021, 109, 1302–1313e4. [Google Scholar] [CrossRef]
- Xu, X.; Kaindl, J.; Clark, M.J.; Hubner, H.; Hirata, K.; Sunahara, R.K.; Gmeiner, P.; Kobilka, B.K.; Liu, X. Binding pathway determines norepinephrine selectivity for the human beta(1)AR over beta(2)AR. Cell Res. 2021, 31, 569–579. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; He, X.; Zhao, J.; Jiang, H.; Cheng, X.; Xia, Y.; Eric Xu, H.; He, Y. Structural basis of leukotriene B4 receptor 1 activation. Nat. Commun. 2022, 13, 1156. [Google Scholar] [CrossRef] [PubMed]
- Uys, M.M.; Shahid, M.; Harvey, B.H. Therapeutic Potential of Selectively Targeting the alpha(2C)-Adrenoceptor in Cognition, Depression, and Schizophrenia-New Developments and Future Perspective. Front. Psychiatry 2017, 8, 144. [Google Scholar] [CrossRef] [PubMed]
- Undem, B.J.; Carr, M.J. Targeting primary afferent nerves for novel antitussive therapy. Chest 2010, 137, 177–184. [Google Scholar] [CrossRef] [PubMed]
- Soylu, A.; Yildiz, G.; Torun Bayram, M.; Kavukcu, S. IL-1beta blockade in periodic fever, aphthous stomatitis, pharyngitis, and cervical adenitis (PFAPA) syndrome: Case-based review. Rheumatol. Int. 2021, 41, 183–188. [Google Scholar] [CrossRef] [PubMed]
- Schultheiss, C.; Willscher, E.; Paschold, L.; Gottschick, C.; Klee, B.; Henkes, S.S.; Bosurgi, L.; Dutzmann, J.; Sedding, D.; Frese, T.; et al. The IL-1β, IL-6, and TNF cytokine triad is associated with post-acute sequelae of COVID-19. Cell Rep. Med. 2022, 3, 100663. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Pacheco, J.A.; Castillo-Diaz, L.A.; Arreola-Torres, R.; Fonseca-Coronado, S.; Gomez-Navarro, B. Diabetes mellitus: Lessons from COVID-19 for monkeypox infection. Prim. Care Diabetes 2023, 17, 113–118. [Google Scholar] [CrossRef] [PubMed]
- Rahman, W.; Dickenson, A.H. Voltage gated sodium and calcium channel blockers for the treatment of chronic inflammatory pain. Neurosci. Lett. 2013, 557 Pt A, 19–26. [Google Scholar] [CrossRef]
- Prasad, H.; Shenoy, A.R.; Visweswariah, S.S. Cyclic nucleotides, gut physiology and inflammation. FEBS J. 2020, 287, 1970–1981. [Google Scholar] [CrossRef] [PubMed]
- Peters-Golden, M.; Canetti, C.; Mancuso, P.; Coffey, M.J. Leukotrienes: Underappreciated mediators of innate immune responses. J. Immunol. 2005, 174, 589–594. [Google Scholar] [CrossRef] [PubMed]
- Orlando, B.J.; Malkowski, M.G. Substrate-selective Inhibition of Cyclooxygeanse-2 by Fenamic Acid Derivatives Is Dependent on Peroxide Tone. J. Biol. Chem. 2016, 291, 15069–15081. [Google Scholar] [CrossRef]
- Miloushev, V.Z.; Levine, J.A.; Arbing, M.A.; Hunt, J.F.; Pitt, G.S.; Palmer, A.G., 3rd. Solution structure of the NaV1.2 C-terminal EF-hand domain. J. Biol. Chem. 2009, 284, 6446–6454. [Google Scholar] [CrossRef]
- Matsuyama, T.; Kubli, S.P.; Yoshinaga, S.K.; Pfeffer, K.; Mak, T.W. An aberrant STAT pathway is central to COVID-19. Cell Death Differ. 2020, 27, 3209–3225. [Google Scholar] [CrossRef]
- Luo, Y.; Arita, K.; Bhatia, M.; Knuckley, B.; Lee, Y.H.; Stallcup, M.R.; Sato, M.; Thompson, P.R. Inhibitors and inactivators of protein arginine deiminase 4: Functional and structural characterization. Biochemistry 2006, 45, 11727–11736. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Li, Y.; Kang, L.; Wang, Q. Recent Advances in the Clinical Value and Potential of Dexmedetomidine. J. Inflamm. Res. 2021, 14, 7507–7527. [Google Scholar] [CrossRef]
- La Sala, G.; Michiels, C.; Kukenshoner, T.; Brandstoetter, T.; Maurer, B.; Koide, A.; Lau, K.; Pojer, F.; Koide, S.; Sexl, V.; et al. Selective inhibition of STAT3 signaling using monobodies targeting the coiled-coil and N-terminal domains. Nat. Commun. 2020, 11, 4115. [Google Scholar] [CrossRef] [PubMed]
- Kirvan, C.A.; Swedo, S.E.; Heuser, J.S.; Cunningham, M.W. Mimicry and autoantibody-mediated neuronal cell signaling in Sydenham chorea. Nat. Med. 2003, 9, 914–920. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.S.; Jin, X.Q.; Huang, G.X.Y.; Huang, J.; Wu, T.; Li, Z.Q.; Chen, J.F.; Kong, F.; Pan, X.J.; Yan, N.E. Structural basis for high-voltage activation and subtype-specific inhibition of human Na1.8. Proc. Natl. Acad. Sci. USA 2022, 119, e2208211119. [Google Scholar] [CrossRef] [PubMed]
- Hameed, S. Na(v)1.7 and Na(v)1.8: Role in the pathophysiology of pain. Mol. Pain 2019, 15, 1744806919858801. [Google Scholar] [CrossRef] [PubMed]
- Gilbert, N.C.; Gerstmeier, J.; Schexnaydre, E.E.; Börner, F.; Garscha, U.; Neau, D.B.; Werz, O.; Newcomer, M.E. Structural and mechanistic insights into 5-lipoxygenase inhibition by natural products. Nat. Chem. Biol. 2020, 16, 783–790. [Google Scholar] [CrossRef] [PubMed]
- Geissler, K.; Weigel, C.; Schubert, K.; Rubio, I.; Guntinas-Lichius, O. Cytokine production in patients with recurrent acute tonsillitis: Analysis of tonsil samples and blood. Sci. Rep. 2020, 10, 13006. [Google Scholar] [CrossRef]
- Ekberg, J.; Jayamanne, A.; Vaughan, C.W.; Aslan, S.; Thomas, L.; Mouldt, J.; Drinkwater, R.; Baker, M.D.; Abrahamsen, B.; Wood, J.N.; et al. μO-conotoxin MrVIB selectively blocks Na1.8 sensory neuron specific sodium channels and chronic pain behavior without motor deficits. Proc. Natl. Acad. Sci. USA 2006, 103, 17030–17035. [Google Scholar] [CrossRef] [PubMed]
- Cook, W.J.; Walter, L.J.; Walter, M.R. Drug binding by calmodulin: Crystal structure of a calmodulin-trifluoperazine complex. Biochemistry 1994, 33, 15259–15265. [Google Scholar] [CrossRef]
- Bailly, C. Medicinal applications and molecular targets of dequalinium chloride. Biochem. Pharmacol. 2021, 186, 114467. [Google Scholar] [CrossRef] [PubMed]
- Baghaki, S.; Yalcin, C.E.; Baghaki, H.S.; Aydin, S.Y.; Daghan, B.; Yavuz, E. COX2 inhibition in the treatment of COVID-19: Review of literature to propose repositioning of celecoxib for randomized controlled studies. Int. J. Infect. Dis. 2020, 101, 29–32. [Google Scholar] [CrossRef] [PubMed]
- Arnsten, A.F.T.; Ishizawa, Y.; Xie, Z. Scientific rationale for the use of alpha2A-adrenoceptor agonists in treating neuroinflammatory cognitive disorders. Mol. Psychiatry 2023, 28, 4540–4552. [Google Scholar] [CrossRef]
- Alluri, S.; Eisenberg, S.M.; Grisanti, L.A.; Tanner, M.; Volkow, N.D.; Kim, S.W.; Kil, K.E. Preclinical evaluation of new C-11 labeled benzo-1,4-dioxane PET radiotracers for brain alpha2C adrenergic receptors. Eur. J. Med. Chem. 2022, 243, 114764. [Google Scholar] [CrossRef]
- Zheng, W.L.; Lu, Y.; Tian, S.Y.; Ma, F.G.; Wei, Y.J.; Xu, S.S.; Li, Y. Structural insights into the heterodimeric complex of the nuclear receptors FXR and RXR. J. Biol. Chem. 2018, 293, 12535–12541. [Google Scholar] [CrossRef]
- Yin, W.; Luan, X.; Li, Z.; Zhou, Z.; Wang, Q.; Gao, M.; Wang, X.; Zhou, F.; Shi, J.; You, E.; et al. Structural basis for inhibition of the SARS-CoV-2 RNA polymerase by suramin. Nat. Struct. Mol. Biol. 2021, 28, 319–325. [Google Scholar] [CrossRef] [PubMed]
- White, M.A.; Lin, W.; Cheng, X. Discovery of COVID-19 Inhibitors Targeting the SARS-CoV2 Nsp13 Helicase. J. Phys. Chem. Lett. 2020, 11, 9144–9151. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.Q.; Li, Q.S.; Zheng, X.Q.; Lu, J.L.; Liang, Y.R. Antiviral Effects of Green Tea EGCG and Its Potential Application against COVID-19. Molecules 2021, 26, 3962. [Google Scholar] [CrossRef]
- Varela, F.H.; Sartor, I.T.S.; Polese-Bonatto, M.; Azevedo, T.R.; Kern, L.B.; Fazolo, T.; de David, C.N.; Zavaglia, G.O.; Fernandes, I.R.; Krauser, J.R.M.; et al. Rhinovirus as the main co-circulating virus during the COVID-19 pandemic in children. J. Pediatr. (Rio J.) 2022, 98, 579–586. [Google Scholar] [CrossRef] [PubMed]
- van der Hoek, L.; Pyrc, K.; Berkhout, B. Human coronavirus NL63, a new respiratory virus. FEMS Microbiol. Rev. 2006, 30, 760–773. [Google Scholar] [CrossRef] [PubMed]
- Tugaeva, K.V.; Sysoev, A.A.; Kapitonova, A.A.; Smith, J.L.R.; Zhu, P.; Cooley, R.B.; Antson, A.A.; Sluchanko, N.N. Human 14-3-3 Proteins Site-selectively Bind the Mutational Hotspot Region of SARS-CoV-2 Nucleoprotein Modulating its Phosphoregulation. J. Mol. Biol. 2023, 435, 167891. [Google Scholar] [CrossRef] [PubMed]
- Teng, Y.; Xu, F.; Zhang, X.; Mu, J.; Sayed, M.; Hu, X.; Lei, C.; Sriwastva, M.; Kumar, A.; Sundaram, K.; et al. Plant-derived exosomal microRNAs inhibit lung inflammation induced by exosomes SARS-CoV-2 Nsp12. Mol. Ther. 2021, 29, 2424–2440. [Google Scholar] [CrossRef] [PubMed]
- Swaminathan, G.J.; Holloway, D.E.; Colvin, R.A.; Campanella, G.K.; Papageorgiou, A.C.; Luster, A.D.; Acharya, K.R. Crystal structures of oligomeric forms of the IP-10/CXCL10 chemokine. Structure 2003, 11, 521–532. [Google Scholar] [CrossRef] [PubMed]
- Stojanov, S.; Lapidus, S.; Chitkara, P.; Feder, H.; Salazar, J.C.; Fleisher, T.A.; Brown, M.R.; Edwards, K.M.; Ward, M.M.; Colbert, R.A.; et al. Periodic fever, aphthous stomatitis, pharyngitis, and adenitis (PFAPA) is a disorder of innate immunity and Th1 activation responsive to IL-1 blockade. Proc. Natl. Acad. Sci. USA 2011, 108, 7148–7153. [Google Scholar] [CrossRef] [PubMed]
- Soni, B.; Singh, S. COVID-19 co-infection mathematical model as guided through signaling structural framework. Comput. Struct. Biotec. 2021, 19, 1672–1683. [Google Scholar] [CrossRef]
- Somers, W.; Stahl, M.; Seehra, J.S. 1.9 A crystal structure of interleukin 6: Implications for a novel mode of receptor dimerization and signaling. EMBO J. 1997, 16, 989–997. [Google Scholar] [CrossRef]
- Smyth, J.S.; Truong, J.K.; Rao, A.; Lin, R.; Foulke-Abel, J.; Adorini, L.; Donowitz, M.; Dawson, P.A.; Keely, S.J. Farnesoid X receptor enhances epithelial ACE2 expression and inhibits virally induced IL-6 secretion: Implications for intestinal symptoms of SARS-CoV-2. Am. J. Physiol. Gastrointest. Liver. Physiol. 2023, 325, G446–G452. [Google Scholar] [CrossRef] [PubMed]
- Sijbesma, E.; Skora, L.; Leysen, S.; Brunsveld, L.; Koch, U.; Nussbaumer, P.; Jahnke, W.; Ottmann, C. Identification of Two Secondary Ligand Binding Sites in 14-3-3 Proteins Using Fragment Screening. Biochemistry 2017, 56, 3972–3982. [Google Scholar] [CrossRef] [PubMed]
- Shi, D.; Chen, M.; Liu, L.; Wang, Q.; Liu, S.; Wang, L.; Wang, R. Anti-influenza A virus mechanism of three representative compounds from Flos Trollii via TLRs signaling pathways. J. Ethnopharmacol. 2020, 253, 112634. [Google Scholar] [CrossRef] [PubMed]
- Santiago, C.; Mudgal, G.; Reguera, J.; Recacha, R.; Albrecht, S.; Enjuanes, L.; Casasnovas, J.M. Allosteric inhibition of aminopeptidase N functions related to tumor growth and virus infection. Sci. Rep. 2017, 7, 46045. [Google Scholar] [CrossRef] [PubMed]
- Park, M.S.; Araya-Secchi, R.; Brackbill, J.A.; Phan, H.D.; Kehling, A.C.; Abd El-Wahab, E.W.; Dayeh, D.M.; Sotomayor, M.; Nakanishi, K. Multidomain Convergence of Argonaute during RISC Assembly Correlates with the Formation of Internal Water Clusters. Mol. Cell 2019, 75, 725. [Google Scholar] [CrossRef] [PubMed]
- Palakkott, A.R.; Alneyadi, A.; Muhammad, K.; Eid, A.H.; Amiri, K.M.A.; Akli Ayoub, M.; Iratni, R. The SARS-CoV-2 Spike Protein Activates the Epidermal Growth Factor Receptor-Mediated Signaling. Vaccines 2023, 11, 768. [Google Scholar] [CrossRef]
- Obst-Sander, U.; Ricci, A.; Kuhn, B.; Friess, T.; Koldewey, P.; Kuglstatter, A.; Hewings, D.; Goergler, A.; Steiner, S.; Rueher, D.; et al. Discovery of Novel Allosteric EGFR L858R Inhibitors for the Treatment of Non-Small-Cell Lung Cancer as a Single Agent or in Combination with Osimertinib. J. Med. Chem. 2022, 65, 13052–13073. [Google Scholar] [CrossRef] [PubMed]
- Nocini, R.; Henry, B.M.; Mattiuzzi, C.; Lippi, G. Evolution of throat symptoms during the COVID-19 pandemic in the US. Diagnosis 2022, 9, 485–490. [Google Scholar] [CrossRef]
- Newman, J.A.; Douangamath, A.; Yadzani, S.; Yosaatmadja, Y.; Aimon, A.; Brandao-Neto, J.; Dunnett, L.; Gorrie-Stone, T.; Skyner, R.; Fearon, D.; et al. Structure, mechanism and crystallographic fragment screening of the SARS-CoV-2 NSP13 helicase. Nat. Commun. 2021, 12, 4848. [Google Scholar] [CrossRef] [PubMed]
- Nassar, A.; Ibrahim, I.M.; Amin, F.G.; Magdy, M.; Elgharib, A.M.; Azzam, E.B.; Nasser, F.; Yousry, K.; Shamkh, I.M.; Mahdy, S.M.; et al. A Review of Human Coronaviruses’ Receptors: The Host-Cell Targets for the Crown Bearing Viruses. Molecules 2021, 26, 6455. [Google Scholar] [CrossRef] [PubMed]
- Metwally, K.; Abo-Dya, N.E.; Hamdan, A.M.E.; Alrashidi, M.N.; Alturki, M.S.; Aly, O.M.; Aljoundi, A.; Ibrahim, M.; Soliman, M.E.S. Investigation of Simultaneous and Sequential Cooperative Homotropic Inhibitor Binding to the Catalytic Chamber of SARS-CoV-2 RNA-dependent RNA Polymerase (RdRp). Cell. Biochem. Biophys. 2023, 81, 697–706. [Google Scholar] [CrossRef]
- Lu, Y.; Shen, F.; He, W.Q.; Li, A.Q.; Li, M.H.; Feng, X.L.; Zheng, Y.T.; Pang, W. HR121 targeting HR2 domain in S2 subunit of spike protein can serve as a broad-spectrum SARS-CoV-2 inhibitor intranasal administration. Acta Pharm. Sin. B 2023, 13, 3339–3351. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Cao, S.; Ding, G.; Wang, B.; Li, Y.; Zhao, Y.; Shao, Q.; Feng, J.; Liu, S.; Qin, L.; et al. The role of 14-3-3 proteins in cell signalling pathways and virus infection. J. Cell. Mol. Med. 2021, 25, 4173–4182. [Google Scholar] [CrossRef]
- Kolb, A.F.; Hegyi, A.; Maile, J.; Heister, A.; Hagemann, M.; Siddell, S.G. Molecular analysis of the coronavirus-receptor function of aminopeptidase N. Adv. Exp. Med. Biol. 1998, 440, 61–67. [Google Scholar] [PubMed]
- Kattner, S.; Muller, J.; Glanz, K.; Manoochehri, M.; Sylvester, C.; Vainshtein, Y.; Berger, M.M.; Brenner, T.; Sohn, K. Identification of two early blood biomarkers ACHE and CLEC12A for improved risk stratification of critically ill COVID-19 patients. Sci. Rep. 2023, 13, 4388. [Google Scholar] [CrossRef]
- Jin, Z.; Du, X.; Xu, Y.; Deng, Y.; Liu, M.; Zhao, Y.; Zhang, B.; Li, X.; Zhang, L.; Peng, C.; et al. Structure of M(pro) from SARS-CoV-2 and discovery of its inhibitors. Nature 2020, 582, 289–293. [Google Scholar] [CrossRef]
- Ishida, H.; Asami, J.; Zhang, Z.; Nishizawa, T.; Shigematsu, H.; Ohto, U.; Shimizu, T. Cryo-EM structures of Toll-like receptors in complex with UNC93B1. Nat. Struct. Mol. Biol. 2021, 28, 173–180. [Google Scholar] [CrossRef] [PubMed]
- Huang, P.; Zhang, J.H.; Duan, W.Q.; Jiao, J.Y.; Leng, A.J.; Qu, J.L. Plant polysaccharides with anti-lung injury effects as a potential therapeutic strategy for COVID-19. Front. Pharmacol. 2022, 13, 982893. [Google Scholar] [CrossRef] [PubMed]
- Huang, K.; Zhang, P.; Zhang, Z.; Youn, J.Y.; Wang, C.; Zhang, H.; Cai, H. Traditional Chinese Medicine (TCM) in the treatment of COVID-19 and other viral infections: Efficacies and mechanisms. Pharmacol. Ther. 2021, 225, 107843. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Zhou, C.; Deng, J.N.; Zhou, J.F. JAK inhibition as a new treatment strategy for patients with COVID-19. Biochem. Pharmacol. 2022, 202, 115162. [Google Scholar] [CrossRef] [PubMed]
- Hu, M.S.; Yang, T.; Yang, L.Y.; Niu, L.; Zhu, J.B.; Zhao, A.L.; Shi, M.S.; Yuan, X.; Tang, M.H.; Yang, J.H.; et al. Preclinical studies of Flonoltinib Maleate, a novel JAK2/FLT3 inhibitor, in treatment of -induced myeloproliferative neoplasms. Blood Cancer J. 2022, 12, 37. [Google Scholar] [CrossRef] [PubMed]
- He, M.M.; Smith, A.S.; Oslob, J.D.; Flanagan, W.M.; Braisted, A.C.; Whitty, A.; Cancilla, M.T.; Wang, J.; Lugovskoy, A.A.; Yoburn, J.C.; et al. Small-molecule inhibition of TNF-alpha. Science 2005, 310, 1022–1025. [Google Scholar] [CrossRef] [PubMed]
- Gobeil, S.M.; Henderson, R.; Stalls, V.; Janowska, K.; Huang, X.; May, A.; Speakman, M.; Beaudoin, E.; Manne, K.; Li, D.; et al. Structural diversity of the SARS-CoV-2 Omicron spike. Mol. Cell 2022, 82, 2050–2068.e6. [Google Scholar] [CrossRef] [PubMed]
- Geng, Q.; Shi, K.; Ye, G.; Zhang, W.; Aihara, H.; Li, F. Structural Basis for Human Receptor Recognition by SARS-CoV-2 Omicron Variant BA.1. J. Virol. 2022, 96, e0024922. [Google Scholar] [CrossRef] [PubMed]
- Fraser, B.J.; Beldar, S.; Seitova, A.; Hutchinson, A.; Mannar, D.; Li, Y.; Kwon, D.; Tan, R.; Wilson, R.P.; Leopold, K.; et al. Structure and activity of human TMPRSS2 protease implicated in SARS-CoV-2 activation. Nat. Chem. Biol. 2022, 18, 963–971. [Google Scholar] [CrossRef] [PubMed]
- Elahi, R.; Karami, P.; Heidary, A.H.; Esmaeilzadeh, A. An updated overview of recent advances, challenges, and clinical considerations of IL-6 signaling blockade in severe coronavirus disease 2019 (COVID-19). Int. Immunopharmacol. 2022, 105, 108536. [Google Scholar] [CrossRef] [PubMed]
- Deutsch, E.; Kaufman, M.; Nisman, B.; Barak, V. Cytokine evaluation in throat infections. Ann. Otol. Rhinol. Laryngol. 1998, 107, 713–716. [Google Scholar] [CrossRef] [PubMed]
- De Sanctis, J.B.; García, A.; Garmendia, J.; Moreno, D.; Hajduch, M.; Radzioch, D. Importance of miRNA in SARS-CoV2 infection. Gac. Médica Caracas 2020, 128, 7–22. [Google Scholar] [CrossRef]
- Calleja, D.J.; Kuchel, N.; Lu, B.G.C.; Birkinshaw, R.W.; Klemm, T.; Doerflinger, M.; Cooney, J.P.; Mackiewicz, L.; Au, A.E.; Yap, Y.Q.; et al. Insights Into Drug Repurposing, as Well as Specificity and Compound Properties of Piperidine-Based SARS-CoV-2 PLpro Inhibitors. Front. Chem. 2022, 10, 861209. [Google Scholar] [CrossRef] [PubMed]
- Bertoglio, F.; Fühner, V.; Ruschig, M.; Heine, P.A.; Abassi, L.; Klünemann, T.; Rand, U.; Meier, D.; Langreder, N.; Steinke, S.; et al. A SARS-CoV-2 neutralizing antibody selected from COVID-19 patients binds to the ACE2-RBD interface and is tolerant to most known RBD mutations. Cell Rep. 2021, 36, 109433. [Google Scholar] [CrossRef] [PubMed]
- Bella, J.; Kolatkar, P.R.; Marlor, C.W.; Greve, J.M.; Rossmann, M.G. The structure of the two amino-terminal domains of human ICAM-1 suggests how it functions as a rhinovirus receptor and as an LFA-1 integrin ligand. Proc. Natl. Acad. Sci. USA 1998, 95, 4140–4145. [Google Scholar] [CrossRef] [PubMed]
- Baby, K.; Maity, S.; Mehta, C.H.; Suresh, A.; Nayak, U.Y.; Nayak, Y. SARS-CoV-2 entry inhibitors by dual targeting TMPRSS2 and ACE2: An in silico drug repurposing study. Eur. J. Pharmacol. 2021, 896, 173922. [Google Scholar] [CrossRef]
- Zivancevic-Simonovic, S.; Minic, R.; Cupurdija, V.; Stanojevic-Pirkovic, M.; Milosevic-Djordjevic, O.; Jakovljevic, V.; Mihaljevic, O. Transforming growth factor beta 1 (TGF-beta1) in COVID-19 patients: Relation to platelets and association with the disease outcome. Mol. Cell. Biochem. 2023, 478, 2461–2471. [Google Scholar] [CrossRef]
- Zeng, F.M.; Li, Y.W.; Deng, Z.H.; He, J.Z.; Li, W.; Wang, L.; Lyu, T.; Li, Z.; Mei, C.; Yang, M.; et al. SARS-CoV-2 spike spurs intestinal inflammation via VEGF production in enterocytes. EMBO Mol. Med. 2022, 14, e14844. [Google Scholar] [CrossRef] [PubMed]
- Zak, M.; Mendonca, R.; Balazs, M.; Barrett, K.; Bergeron, P.; Blair, W.S.; Chang, C.; Deshmukh, G.; DeVoss, J.; Dragovich, P.S.; et al. Discovery and Optimization of -2 Methyl Imidazopyrrolopyridines as Potent and Orally Bioavailable JAK1 Inhibitors with Selectivity over JAK2. J. Med. Chem. 2012, 55, 6176–6193. [Google Scholar] [CrossRef]
- Villoutreix, B.O.; Badiola, I.; Khatib, A.-M. Furin and COVID-19: Structure, Function and Chemoinformatic Analysis of Representative Active Site Inhibitors. Front. Drug Discov. 2022, 2, 899239. [Google Scholar] [CrossRef]
- Santiago, R.P.; Carvalho, M.O.S.; Figueiredo, C.V.B.; Fiuza, L.M.; Oliveira, R.M.; Yahouedehou, S.; Nascimento, V.M.L.; Lyra, I.M.; Araujo-Santos, T.; Luz, N.F.; et al. Associations between TGF-beta1 Levels and Markers of Hemolysis, Inflammation, and Tissue Remodeling in Pediatric Sickle Cell Patients. Mediat. Inflamm. 2021, 2021, 4651891. [Google Scholar] [CrossRef] [PubMed]
- Pissarnitski, D.A.; Zhao, Z.; Cole, D.; Wu, W.L.; Domalski, M.; Clader, J.W.; Scapin, G.; Voigt, J.; Soriano, A.; Kelly, T.; et al. Scaffold-hopping from xanthines to tricyclic guanines: A case study of dipeptidyl peptidase 4 (DPP4) inhibitors. Bioorg. Med. Chem. 2016, 24, 5534–5545. [Google Scholar] [CrossRef] [PubMed]
- Pan, B.; Li, B.; Russell, S.J.; Tom, J.Y.K.; Cochran, A.G.; Fairbrother, W.J. Solution structure of a phage-derived peptide antagonist in complex with vascular endothelial growth factor. J. Mol. Biol. 2002, 316, 769–787. [Google Scholar] [CrossRef] [PubMed]
- Omran, Z. Novel Disulfiram Derivatives as ALDH1a1-Selective Inhibitors. Molecules 2022, 27, 480. [Google Scholar] [CrossRef]
- Natesh, R.; Schwager, S.L.; Sturrock, E.D.; Acharya, K.R. Crystal structure of the human angiotensin-converting enzyme–lisinopril complex. Nature 2003, 421, 551–554. [Google Scholar] [CrossRef] [PubMed]
- Morgan, C.A.; Hurley, T.D. Development of a high-throughput in vitro assay to identify selective inhibitors for human ALDH1A1. Chem. Biol. Interact. 2015, 234, 29–37. [Google Scholar] [CrossRef]
- Mora-Rodríguez, J.M.; Sánchez, B.G.; Bort, A.; Díaz-Yuste, A.; Ballester-González, R.; Arrieta, F.; Sebastián-Martín, A.; Díaz-Laviada, I. Diabetic individuals with COVID-19 exhibit reduced efficacy of gliptins in inhibiting dipeptidyl peptidase 4 (DPP4). A suggested explanation for increased COVID-19 susceptibility in patients with type 2 diabetes mellitus (T2DM). Life Sci. 2024, 336, 122292. [Google Scholar] [CrossRef] [PubMed]
- McLornan, D.P.; Pope, J.E.; Gotlib, J.; Harrison, C.N. Current and future status of JAK inhibitors. Lancet 2021, 398, 803–816. [Google Scholar] [CrossRef] [PubMed]
- Kinoshita, T.; Yoshida, I.; Nakae, S.; Okita, K.; Gouda, M.; Matsubara, M.; Yokota, K.; Ishiguro, H.; Tada, T. Crystal structure of human mono-phosphorylated ERK1 at Tyr204. Biochem. Bioph. Res. Commun. 2008, 377, 1123–1127. [Google Scholar] [CrossRef]
- Khaledi, M.; Sameni, F.; Yahyazade, S.; Radandish, M.; Owlia, P.; Bagheri, N.; Afkhami, H.; Mahjoor, M.; Esmaelpour, Z.; Kohansal, M.; et al. COVID-19 and the potential of Janus family kinase (JAK) pathway inhibition: A novel treatment strategy. Front. Med. 2022, 9, 961027. [Google Scholar] [CrossRef] [PubMed]
- Ke, Z.; Su, Z.; Zhang, X.; Cao, Z.; Ding, Y.; Cao, L.; Ding, G.; Wang, Z.; Liu, H.; Xiao, W. Discovery of a potent angiotensin converting enzyme inhibitor via virtual screening. Bioorg. Med. Chem. Lett. 2017, 27, 3688–3692. [Google Scholar] [CrossRef] [PubMed]
- Hardes, K.; Becker, G.L.; Lu, Y.; Dahms, S.O.; Kohler, S.; Beyer, W.; Sandvig, K.; Yamamoto, H.; Lindberg, I.; Walz, L.; et al. Novel Furin Inhibitors with Potent Anti-infectious Activity. ChemMedChem 2015, 10, 1218–1231. [Google Scholar] [CrossRef]
- Han, Y.; Yang, L.; Kim, T.W.; Nair, M.S.; Harschnitz, O.; Wang, P.; Zhu, J.; Koo, S.Y.; Tang, X.; Lacko, L.A.; et al. SARS-CoV-2 Infection Causes Dopaminergic Neuron Senescence. Cell Stem Cell 2024, 31, 196–211.e6. [Google Scholar]
- Gorecki, L.; Gerlits, O.; Kong, X.; Cheng, X.; Blumenthal, D.K.; Taylor, P.; Ballatore, C.; Kovalevsky, A.; Radic, Z. Rational design, synthesis, and evaluation of uncharged, “smart” bis-oxime antidotes of organophosphate-inhibited human acetylcholinesterase. J. Biol. Chem. 2020, 295, 4079–4092. [Google Scholar] [CrossRef]
- González-Rayas, J.M.; Rayas-Gómez, A.L.; García-González, J.J.; González-Yáñez, J.M.; Hernández-Hernández, J.A.; López-Sánchez, R.d.C. COVID-19 and ACE -inhibitors and angiotensin receptor blockers-: The need to differentiate between early infection and acute lung injury. Rev. Colomb. Cardiol. 2020, 27, 129–131. [Google Scholar] [CrossRef]
- Ghasemnejad-Berenji, M.; Pashapour, S. SARS-CoV-2 and the Possible Role of Raf/MEK/ERK Pathway in Viral Survival: Is This a Potential Therapeutic Strategy for COVID-19? Pharmacology 2021, 106, 119–122. [Google Scholar] [CrossRef]
- Dong, X.; Zhao, B.; Iacob, R.E.; Zhu, J.; Koksal, A.C.; Lu, C.; Engen, J.R.; Springer, T.A. Force interacts with macromolecular structure in activation of TGF-beta. Nature 2017, 542, 55–59. [Google Scholar] [CrossRef]
- Drucker, D.J. Coronavirus Infections and Type 2 Diabetes—Shared Pathways with Therapeutic Implications. Endocr. Rev. 2020, 41, bnaa011. [Google Scholar] [CrossRef]
- Dankwa, B.; Broni, E.; Enninful, K.S.; Kwofie, S.K.; Wilson, M.D. Consensus docking and MM-PBSA computations identify putative furin protease inhibitors for developing potential therapeutics against COVID-19. Struct. Chem. 2022, 33, 2221–2241. [Google Scholar] [CrossRef]
- Arun, P.V.P.S.; Naidu, G.A.; Rao, A.A.; Muppalaneni, N.B. Computational Prediction of Ligands with Multiple Protein Targets Involved in Type II Diabetes. In Cognitive Science and Health Bioinformatics: Advances and Applications; Korrapati, R.B., Divakar, C., Devi, G.L., Eds.; Springer: Singapore, 2018; pp. 107–112. [Google Scholar]
Gene Name | Primers | Sequence (5′–3′) |
---|---|---|
GAPDH | F | CATCACTGCCACCCAGAAGACTG |
R | ATGCCAGTGAGCTTCCCGTTCAG | |
FXR/RXR | F | GGGATGAGTGTGAAGCCAGCTA |
R | GTGGCTGAACTTGAGGAAACGG | |
DPP4 | F | TGTCACCTGACCGACTGTTTG |
R | CTCCTGTCGATGTGATCCTATGA | |
JAK2 | F | GCTACCAGATGGAAACTGTGCG |
R | GCCTCTGTAATGTTGGTGAGATC | |
ACE | F | AGCCCAAGTGTTGTTGAACGA |
R | TGGATACCTCCGTGCTTTTCT | |
BLT1 | F | GACTTGGCTGTGTTGCTCACTG |
R | AGCAGGACACTGGCATACATGC | |
COX2 | F | GCGACATACTCAAGCAGGAGCA |
R | AGTGGTAACCGCTCAGGTGTTG | |
CNGA1 | F | CGGATGGAAAATGGAGCGTGCA |
R | CTCTGTGATGGTCCTCGCCTTT | |
5-LOX | F | TCTTCCTGGCACGACTTTGCTG |
R | GCAGCCATTCAGGAACTGGTAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Q.; He, H.; Zhu, Y.; Li, X.; Fang, J.; Li, Z.; Liu, P.; Zhou, L.; Pan, Y.; Wu, G. Identification of Acanthopanax trifoliatus (L.) Merr as a Novel Potential Therapeutic Agent Against COVID-19 and Pharyngitis. Molecules 2025, 30, 1055. https://doi.org/10.3390/molecules30051055
Chen Q, He H, Zhu Y, Li X, Fang J, Li Z, Liu P, Zhou L, Pan Y, Wu G. Identification of Acanthopanax trifoliatus (L.) Merr as a Novel Potential Therapeutic Agent Against COVID-19 and Pharyngitis. Molecules. 2025; 30(5):1055. https://doi.org/10.3390/molecules30051055
Chicago/Turabian StyleChen, Qi, Hui He, Yanghong Zhu, Xiang Li, Junhao Fang, Zhexi Li, Panghui Liu, Lin Zhou, Yufang Pan, and Guoyu Wu. 2025. "Identification of Acanthopanax trifoliatus (L.) Merr as a Novel Potential Therapeutic Agent Against COVID-19 and Pharyngitis" Molecules 30, no. 5: 1055. https://doi.org/10.3390/molecules30051055
APA StyleChen, Q., He, H., Zhu, Y., Li, X., Fang, J., Li, Z., Liu, P., Zhou, L., Pan, Y., & Wu, G. (2025). Identification of Acanthopanax trifoliatus (L.) Merr as a Novel Potential Therapeutic Agent Against COVID-19 and Pharyngitis. Molecules, 30(5), 1055. https://doi.org/10.3390/molecules30051055