Discovery of Novel Antitumor Small-Molecule Agent with Dual Action of CDK2/p-RB and MDM2/p53
Abstract
1. Introduction
2. Results
2.1. Results
2.1.1. III-13 Exhibits Comparable CDK2 Inhibitory Activity and Weaker CDK1 Inhibition Effect to PF-4091
2.1.2. III-13 Has a Robust Inhibitory Effect on Tumor Cell Proliferation, Regardless of CCNE1 Expression
2.1.3. III-13 Also Promotes P53 Activation by Inhibiting MDM2
2.1.4. III-13 Blocks Cell Cycle Progression, Inhibits Tumor Cell Migration and Colony Formation
2.1.5. III-13 Demonstrates In Vivo Antitumor Activity
2.1.6. Evaluation of the Druggability of III-13
3. Discussion
4. Materials and Methods
4.1. Reagent
4.2. Animals
4.3. Cell Culture
4.4. Molecular Docking
4.5. Synthesis of Compound III-13
4.6. Kinase Antagonist Activity Assay
4.7. Cell Proliferation Assay
4.8. Western Blot
4.9. Cell Cycle Detection
4.10. Cell Scratch Test
4.11. Experiments in Colony Formation
4.12. Tumor Xenograft Experiments
4.13. mRNA Sequencing
4.14. Real-Time Quantitative Polymerase Chain Reaction
- ZNF311 (sense, 5′-3′): GATGGAAGCCAAGGAAACCTGC
- ZNF311 (antisense, 5′-3′): TGCCTTTGAGCGTAGGTCAGAC
- TBX15 (sense, 5′-3′): TGACCTCTGGAAGCGGTTC
- TBX15 (sense, 5′-3′): GATGTGGATCTAGGCCAGTGA
- ZNF784 (sense, 5′-3′): GCCAGGTTCTTTCCACTGTG
- ZNF784 (antisense, 5′-3′): CCCCGTGTGCAAGCTGTAG
- SIX3 (sense, 5′-3′): CTGCCCACCCTCAACTTCTC
- SIX3 (antisense, 5′-3′): GCAGGATCGACTCGTGTTTGT
- KLLN (sense, 5′-3′): GTTGAGTGGAAAGTACGGAACG
- KLLN (antisense, 5′-3′): TGTGGGTGCTTGTGTAACCAG
- P2RY1 (sense, 5′-3′): GGGATGCCATGTGTAAACTGC
- P2RY1 (antisense, 5′-3′): CGCTGATACAGATCGCATTCTT
- MSH4 (sense, 5′-3′): CTGGACACCACAAGTGGGATA
- MSH4 (antisense, 5′-3′): CAGCTACAATAACTGATGGGGAG
- STAR (sense, 5′-3′): GGGAGTGGAACCCCAATGTC
- STAR (antisense, 5′-3′): CCAGCTCGTGAGTAATGAATGT
- SUMO4 (sense, 5′-3′): CCACGGGGATTGTCAGTGAA
- SUMO4 (antisense, 5′-3′): CCTCCCGTAGGCTGTTGAAA
- ZC3H12D (sense, 5′-3′): AGAAACCTTCTCTTGCCGGG
- ZC3H12D (antisense, 5′-3′): CGTGCTGCTCTCTGATAGGG
- CCNE1 (sense, 5′-3′): AAGGAGCGGGACACCATGA
- CCNE1 (antisense, 5′-3′): ACGGTCACGTTTGCCTTCC
- MDM2 (sense, 5′-3′): GAATCATCGGACTCAGGTACATC
- MDM2 (antisense, 5′-3′): TCTGTCTCACTAATTGCTCTCCT
- GAPDH (sense, 5′-3′): GGAGCGAGATCCCTCCAAAAT
- GAPDH (antisense, 5′-3′): GGCTGTTGTCATACTTCTCATGG
4.15. Evaluation of Permeability and Transporter Substrates
4.16. Evaluation of Liver Microsomal Stability In Vitro
4.17. Human Ether-à-Go-Go-Related Gene (hERG) Assay
4.18. Pharmacokinetics Study
4.19. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Torre, L.A.; Siegel, R.L.; Ward, E.M.; Jemal, A. Global Cancer Incidence and Mortality Rates and Trends—An Update. Cancer Epidemiol. Biomark. Prev. 2016, 25, 16–27. [Google Scholar] [CrossRef] [Scilit]
- McGuire, S. World Cancer Report 2014. Geneva, Switzerland: World Health Organization, International Agency for Research on Cancer, WHO Press, 2015. Adv. Nutr. 2016, 7, 418–419. [Google Scholar] [CrossRef] [Scilit]
- Faisca Phillips, A.M. Recent Developments in Anti-Cancer Drug Research. Curr. Med. Chem. 2019, 26, 7282–7284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pérez-Herrero, E.; Fernández-Medarde, A. Advanced targeted therapies in cancer: Drug nanocarriers, the future of chemotherapy. Eur. J. Pharm. Biopharm. 2015, 93, 52–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arora, M.; Moser, J.; Hoffman, T.E.; Watts, L.P.; Min, M.; Musteanu, M.; Rong, Y.; Ill, C.R.; Nangia, V.; Schneider, J.; et al. Rapid adaptation to CDK2 inhibition exposes intrinsic cell-cycle plasticity. Cell 2023, 186, 2628–2643.e21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suski, J.M.; Braun, M.; Strmiska, V.; Sicinski, P. Targeting cell-cycle machinery in cancer. Cancer Cell 2021, 39, 759–778. [Google Scholar] [CrossRef] [Scilit]
- Chong, Q.Y.; Kok, Z.H.; Bui, N.L.; Xiang, X.; Wong, A.L.; Yong, W.P.; Sethi, G.; Lobie, P.E.; Wang, L.; Goh, B.C. A unique CDK4/6 inhibitor: Current and future therapeutic strategies of abemaciclib. Pharmacol. Res. 2020, 156, 104686. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Braal, C.L.; Jongbloed, E.M.; Wilting, S.M.; Mathijssen, R.H.J.; Koolen, S.L.W.; Jager, A. Inhibiting CDK4/6 in Breast Cancer with Palbociclib, Ribociclib, and Abemaciclib: Similarities and Differences. Drugs 2021, 81, 317–331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- O’Leary, B.; Finn, R.S.; Turner, N.C. Treating cancer with selective CDK4/6 inhibitors. Nat. Rev. Clin. Oncol. 2016, 13, 417–430. [Google Scholar] [CrossRef] [Scilit]
- Teh, J.L.F.; Aplin, A.E. Arrested Developments: CDK4/6 Inhibitor Resistance and Alterations in the Tumor Immune Microenvironment. Clin. Cancer Res. 2019, 25, 921–927. [Google Scholar] [CrossRef] [Scilit]
- Turner, N.C.; Liu, Y.; Zhu, Z.; Loi, S.; Colleoni, M.; Loibl, S.; DeMichele, A.; Harbeck, N.; André, F.; Bayar, M.A.; et al. Cyclin E1 Expression and Palbociclib Efficacy in Previously Treated Hormone Receptor-Positive Metastatic Breast Cancer. J. Clin. Oncol. 2019, 37, 1169–1178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Freeman-Cook, K.; Hoffman, R.L.; Miller, N.; Almaden, J.; Chionis, J.; Zhang, Q.; Eisele, K.; Liu, C.; Zhang, C.; Huser, N.; et al. Expanding control of the tumor cell cycle with a CDK2/4/6 inhibitor. Cancer Cell 2021, 39, 1404–1421.e11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herrera-Abreu, M.T.; Palafox, M.; Asghar, U.; Rivas, M.A.; Cutts, R.J.; Garcia-Murillas, I.; Pearson, A.; Guzman, M.; Rodriguez, O.; Grueso, J.; et al. Early Adaptation and Acquired Resistance to CDK4/6 Inhibition in Estrogen Receptor-Positive Breast Cancer. Cancer Res. 2016, 76, 2301–2313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berthet, C.; Aleem, E.; Coppola, V.; Tessarollo, L.; Kaldis, P. Cdk2 knockout mice are viable. Curr. Biol. 2003, 13, 1775–1785. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santamaría, D.; Barrière, C.; Cerqueira, A.; Hunt, S.; Tardy, C.; Newton, K.; Cáceres, J.F.; Dubus, P.; Malumbres, M.; Barbacid, M. Cdk1 is sufficient to drive the mammalian cell cycle. Nature 2007, 448, 811–815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koo, N.; Sharma, A.K.; Narayan, S. Therapeutics Targeting p53-MDM2 Interaction to Induce Cancer Cell Death. Int. J. Mol. Sci. 2022, 23, 5005. [Google Scholar] [CrossRef] [Scilit]
- Muller, P.A.; Vousden, K.H.; Norman, J.C. p53 and its mutants in tumor cell migration and invasion. J. Cell Biol. 2011, 192, 209–218. [Google Scholar] [CrossRef] [Scilit]
- Rutkowski, R.; Hofmann, K.; Gartner, A. Phylogeny and function of the invertebrate p53 superfamily. Cold Spring Harb. Perspect. Biol. 2010, 2, a001131. [Google Scholar] [CrossRef] [Scilit]
- Dey, A.; Lane, D.P.; Verma, C.S. Modulating the p53 pathway. Semin. Cancer Biol. 2010, 20, 3–9. [Google Scholar] [CrossRef] [Scilit]
- Hu, L.; Liu, S.; Yao, H.; Hu, Y.; Wang, Y.; Jiang, J.; Li, X.; Fu, F.; Yin, Q.; Wang, H. Identification of a novel heterogeneous nuclear ribonucleoprotein A2B1 (hnRNPA2B1) ligand that disrupts HnRNPA2B1/nucleic acid interactions to inhibit the MDMX-p53 axis in gastric cancer. Pharmacol. Res. 2023, 189, 106696. [Google Scholar] [CrossRef] [Scilit]
- Baslan, T.; Morris, J.P.; Zhao, Z.; Reyes, J.; Ho, Y.J.; Tsanov, K.M.; Bermeo, J.; Tian, S.; Zhang, S.; Askan, G.; et al. Ordered and deterministic cancer genome evolution after p53 loss. Nature 2022, 608, 795–802. [Google Scholar] [CrossRef] [Scilit]
- Luo, Z.; Cui, R.; Tili, E.; Croce, C. Friend or Foe: MicroRNAs in the p53 network. Cancer Lett. 2018, 419, 96–102. [Google Scholar] [CrossRef] [Scilit]
- Sabapathy, K.; Lane, D.P. Therapeutic targeting of p53: All mutants are equal, but some mutants are more equal than others. Nat. Rev. Clin. Oncol. 2018, 15, 13–30. [Google Scholar] [CrossRef] [Scilit]
- Olivier, M.; Hollstein, M.; Hainaut, P. TP53 mutations in human cancers: Origins, consequences, and clinical use. Cold Spring Harb. Perspect. Biol. 2010, 2, a001008. [Google Scholar] [CrossRef] [Scilit]
- Meek, D.W.; Anderson, C.W. Posttranslational modification of p53: Cooperative integrators of function. Cold Spring Harb. Perspect. Biol. 2009, 1, a000950. [Google Scholar] [CrossRef] [Scilit]
- Chao, C.C. Mechanisms of p53 degradation. Clin. Chim. Acta 2015, 438, 139–147. [Google Scholar] [CrossRef] [Scilit]
- Ebrahim, M.; Mulay, S.R.; Anders, H.J.; Thomasova, D. MDM2 beyond cancer: Podoptosis, development, inflammation, and tissue regeneration. Histol. Histopathol. 2015, 30, 1271–1282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yap, T.A.; Elhaddad, A.M.; Grisham, R.N.; Hamm, J.T.; Marks, D.K.; Shapiro, G.; Corre, C.L.; Li, J.; Lin, T.T.; Liu, F.; et al. First-in-human phase 1/2a study of a potent and novel CDK2-selective inhibitor PF-07104091 in patients (pts) with advanced solid tumors, enriched for CDK4/6 inhibitor resistant HR+/HER2- breast cancer. J. Clin. Oncol. 2023, 41, 3010. [Google Scholar] [CrossRef] [Scilit]
- Choi, Y.J.; Wenglowsky, S.; Brown, V.; Bifulco, N.; Choi, Y.S.; Guo, J.; Hatlen, M.; Kim, J.; LaBranche, T.; Lobbardi, R.; et al. Abstract 1279: Development of a selective CDK2-E inhibitor in CCNE driven cancers. Cancer Res. 2021, 81, 1279. [Google Scholar] [CrossRef] [Scilit]
- Mitchell, M.S. Immunotherapy as part of combinations for the treatment of cancer. Int. Immunopharmacol. 2003, 3, 1051–1059. [Google Scholar] [CrossRef] [Scilit]
- Boshuizen, J.; Peeper, D.S. Rational Cancer Treatment Combinations: An Urgent Clinical Need. Mol. Cell 2020, 78, 1002–1018. [Google Scholar] [CrossRef] [Scilit]
- Álvarez-Fernández, M.; Malumbres, M. Mechanisms of Sensitivity and Resistance to CDK4/6 Inhibition. Cancer Cell 2020, 37, 514–529. [Google Scholar] [CrossRef] [Scilit]
- Guerrero-Zotano, Á.; Belli, S.; Zielinski, C.; Gil-Gil, M.; Fernandez-Serra, A.; Ruiz-Borrego, M.; Ciruelos Gil, E.M.; Pascual, J.; Muñoz-Mateu, M.; Bermejo, B.; et al. CCNE1 and PLK1 Mediate Resistance to Palbociclib in HR+/HER2- Metastatic Breast Cancer. Clin. Cancer Res. 2023, 29, 1557–1568. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kanska, J.; Zakhour, M.; Taylor-Harding, B.; Karlan, B.Y.; Wiedemeyer, W.R. Cyclin E as a potential therapeutic target in high grade serous ovarian cancer. Gynecol. Oncol. 2016, 143, 152–158. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, L.; Fang, D.; Chen, H.; Lu, Y.; Dong, Z.; Ding, H.F.; Jing, Q.; Su, S.B.; Huang, S. Cyclin-dependent kinase 2 is an ideal target for ovary tumors with elevated cyclin E1 expression. Oncotarget 2015, 6, 20801–20812. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Au-Yeung, G.; Lang, F.; Azar, W.J.; Mitchell, C.; Jarman, K.E.; Lackovic, K.; Aziz, D.; Cullinane, C.; Pearson, R.B.; Mileshkin, L.; et al. Selective Targeting of Cyclin E1-Amplified High-Grade Serous Ovarian Cancer by Cyclin-Dependent Kinase 2 and AKT Inhibition. Clin. Cancer Res. 2017, 23, 1862–1874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, P.; Lee, N.V.; Hu, W.; Xu, M.; Ferre, R.A.; Lam, H.; Bergqvist, S.; Solowiej, J.; Diehl, W.; He, Y.A.; et al. Spectrum and Degree of CDK Drug Interactions Predicts Clinical Performance. Mol. Cancer Ther. 2016, 15, 2273–2281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Z.F.; Orvig, C.; Liang, H. Multi-Target Metal-Based Anticancer Agents. Curr. Top. Med. Chem. 2017, 17, 3131–3145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Z.; Huang, M.; Hong, Y.; Wang, S.; Xu, Y.; Zhong, C.; Zhang, J.; Zhuang, Z.; Shan, S.; Ren, T. Isovalerylspiramycin I suppresses non-small cell lung carcinoma growth through ROS-mediated inhibition of PI3K/AKT signaling pathway. Int. J. Biol. Sci. 2022, 18, 3714–3730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oliner, J.D.; Saiki, A.Y.; Caenepeel, S. The Role of MDM2 Amplification and Overexpression in Tumorigenesis. Cold Spring Harb. Perspect. Med. 2016, 6, a026336. [Google Scholar] [CrossRef] [Scilit]
- Momand, J.; Jung, D.; Wilczynski, S.; Niland, J. The MDM2 gene amplification database. Nucleic Acids Res. 1998, 26, 3453–3459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gupta, A.; Shah, K.; Oza, M.J.; Behl, T. Reactivation of p53 gene by MDM2 inhibitors: A novel therapy for cancer treatment. Biomed. Pharmacother. 2019, 109, 484–492. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chène, P. Inhibiting the p53-MDM2 interaction: An important target for cancer therapy. Nat. Rev. Cancer 2003, 3, 102–109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yap, D.B.; Hsieh, J.K.; Chan, F.S.; Lu, X. mdm2: A bridge over the two tumour suppressors, p53 and Rb. Oncogene 1999, 18, 7681–7689. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsieh, J.K.; Chan, F.S.; O’Connor, D.J.; Mittnacht, S.; Zhong, S.; Lu, X. RB regulates the stability and the apoptotic function of p53 via MDM2. Mol. Cell 1999, 3, 181–193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hernandez-Monge, J.; Martínez-Sánchez, M.; Rousset-Roman, A.; Medina-Medina, I.; Olivares-Illana, V. MDM2 regulates RB levels during genotoxic stress. EMBO Rep. 2021, 22, e50615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [Scilit]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Wang, S.; Li, W. RSeQC: Quality control of RNA-seq experiments. Bioinformatics 2012, 28, 2184–2185. [Google Scholar] [CrossRef] [Scilit]
- Ma, M.; Yang, Y.; Du, G.; Dai, Y.; Zhu, X.; Wang, W.; Xu, H.; Zhang, J.; Zheng, L.; Zou, F.; et al. Improving the treatment of Parkinson’s disease: Structure-based development of novel 5-HT(2A) receptor antagonists/inverse agonists. Eur. J. Med. Chem. 2022, 234, 114246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Liu, Z.; Lu, J.; Wang, W.; Wang, L.; Yang, Y.; Wang, H.; Ye, L.; Zhang, J.; Tian, J. Biological evaluation and in silico studies of novel compounds as potent TAAR1 agonists that could be used in schizophrenia treatment. Front. Pharmacol. 2023, 14, 1161964. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Compound | Tmax (h) | Cmax (nM) | AUClast (h·nM) | T1/2 (h) | Vz/F (L/kg) | CL/F (L/h/kg) | MRTlast (h) | F (%) |
|---|---|---|---|---|---|---|---|---|
| III-13 (2 mg/kg. i.v.) | - | 5502 ± 2307 | 2052 ± 337 | 0.37 ± 0.13 | 1304 ± 374 | 2470 ± 442 | 0.45 ± 0.25 | - |
| III-13 (5 mg/kg. i.g.) | 0.25 | 389 ± 87.9 | 293 ± 64.6 | 0.84 ± 0.12 | - | - | 0.85 ± 0.10 | 3.57 |
| PF-4091 (2 mg/kg. i.v.) | - | 6711 ± 1480 | 5340 ± 621 | 2.60 ± 0.27 | 3515 ± 222 | 944 ± 106 | 1.20 ± 0.18 | - |
| PF-4091 (5 mg/kg. i.g.) | 0.33 ± 0.14 | 3458 ± 2204 | 9976 ± 3409 | 6.37 ± 5.35 | - | - | 4.07 ± 1.73 | 46.7 |
| Compound | Mean Papp (10−6 cm/s) | Efflux Ratio | Rank | ||
|---|---|---|---|---|---|
| A to B | B to A | Papp | Efflux Transporter Substrate | ||
| III-13 | 1.60 | 8.56 | 5.34 | 47.7 | 52.5 |
| PF-4091 | 4.3 | 37.0 | 8.57 | 80.5 | 99.3 |
| Compound | T1/2 (min) | CLint (mic) (mL/min/kg) | CLint (liver) (mL/min/kg) | Remaining (%, T = 60 min) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Human | Mice | Rat | Human | Mice | Rat | Human | Mice | Rat | Human | Mice | Rat | |
| III-13 | 21.9 | 6.53 | 28.1 | 63.4 | 212 | 49.4 | 59.9 | 840 | 88.9 | 15.4 | 1.29 | 22.8 |
| PF-4091 | >186 | 87.7 | >186 | <7.5 | 15.8 | <7.5 | <13.5 | 62.6 | <6.75 | 97.0 | 61.5 | 90.5 |
| Compound | IC50 |
|---|---|
| III-13 | 30 μM |
| PF-4091 | >30 μM |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Z.; Yang, Y.; Sun, X.; Ma, R.; Zhang, W.; Wang, W.; Yang, G.; Wang, H.; Zhang, J.; Wang, Y.; et al. Discovery of Novel Antitumor Small-Molecule Agent with Dual Action of CDK2/p-RB and MDM2/p53. Molecules 2024, 29, 725. https://doi.org/10.3390/molecules29030725
Liu Z, Yang Y, Sun X, Ma R, Zhang W, Wang W, Yang G, Wang H, Zhang J, Wang Y, et al. Discovery of Novel Antitumor Small-Molecule Agent with Dual Action of CDK2/p-RB and MDM2/p53. Molecules. 2024; 29(3):725. https://doi.org/10.3390/molecules29030725
Chicago/Turabian StyleLiu, Zhaofeng, Yifei Yang, Xiaohui Sun, Runchen Ma, Wenjing Zhang, Wenyan Wang, Gangqiang Yang, Hongbo Wang, Jianzhao Zhang, Yunjie Wang, and et al. 2024. "Discovery of Novel Antitumor Small-Molecule Agent with Dual Action of CDK2/p-RB and MDM2/p53" Molecules 29, no. 3: 725. https://doi.org/10.3390/molecules29030725
APA StyleLiu, Z., Yang, Y., Sun, X., Ma, R., Zhang, W., Wang, W., Yang, G., Wang, H., Zhang, J., Wang, Y., & Tian, J. (2024). Discovery of Novel Antitumor Small-Molecule Agent with Dual Action of CDK2/p-RB and MDM2/p53. Molecules, 29(3), 725. https://doi.org/10.3390/molecules29030725

