Next Article in Journal
ZnO Nanoparticles Obtained by Green Synthesis as an Alternative to Improve the Germination Characteristics of L. esculentum
Previous Article in Journal
Nutraceutical Role of Polyphenols and Triterpenes Present in the Extracts of Fruits and Leaves of Olea europaea as Antioxidants, Anti-Infectives and Anticancer Agents on Healthy Growth
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products

Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100193, China
*
Author to whom correspondence should be addressed.
Molecules 2022, 27(7), 2342; https://doi.org/10.3390/molecules27072342
Submission received: 18 March 2022 / Revised: 1 April 2022 / Accepted: 1 April 2022 / Published: 6 April 2022

Abstract

:
Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.

1. Introduction

Ephedra L. (Ephedraceae) contains approximately 67 species, mainly distributed in arid and desert regions of Asia, America, Europe, and Northern Africa [1]. In China, there are about 15 species and 4 varieties, some of which have been used as Chinese traditional medicine for a long history [2]. Ephedra herbs show satisfactory pharmacological activities in the treatment of cold, fever, asthma, flu, chills, headache, nasal congestion, and cough. Generally they are called “Ma Huang” and commonly found existing in Chinese classical prescriptions [3]. Modern pharmacological studies have also indicated that the crude extracts and isolated compounds from Ephedra have the effects of anti-inflammatory, antibacterial, antioxidant, anticancer, and hepatoprotection [4,5]. Classified as herbal supplements in the Dietary Supplement Health and Education Act of 1994, ephedra-containing products were largely unregulated without standardization in strength or purity. Between the 1990s and early 2000s, Ephedra ingredients were prevalent in dietary supplements and drugs for weight loss and physical performance enhancement [6]. It can accelerate metabolism and fatigue remission in bodies and can alter the intestinal flora of obese people [7]. However, afterwards, high-dose and long-term use of Ephedra materials was reported to cause a series of adverse effects due to the content of ephedrine-type alkaloids [8]. Ephedrine alkaloids, such as l-ephedrine, d-pseudoephedrine, l-methylephedrine, and l-norephedrine, are considered as the main active chemical constituents of Ephedra herb, but the misuse and abuse may induce the occurrence of hypertension, insomnia, anxiety, palpitations, arrhythmia, and even sudden death [9,10]. The data from the National Poison Data System (NPDS) of the United States showed that in 2002 alone, the number of the cases of ephedra poisoning reached up to 10,326, including 108 major effects and 3 deaths [11]. Thus, in 2004, the U.S. Food and Drug Administration (FDA) announced the prohibition of the sale of Ephedra and ephedrine-containing products, and the ban is still upheld [12]. However, the investigation of 105 weight loss products sold online in 2018 revealed that nearly 20% of the samples contained ephedrine alkaloids or Ephedra herb, which violated the 2004 ban of FDA and posed health and safety risks to individuals [13].
More worryingly, Ephedra species generally contain ephedrine alkaloids, which are the pivotal chemical precursors for the synthesis of methamphetamine, commonly known as “ice drug”. Ephedra herbs and related compound preparations have become the main raw materials for methamphetamine production by criminals [14]. The report on the Drug Situation in China [15], released by the Office of National Narcotics Control Commission, pointed out that methamphetamine was the most commonly abused drug in China, causing extremely serious damage to human’s physical and mental health. The government has imposed strict controls on the production, processing, circulation, and sale of Ephedra herb and its products. Nevertheless, illicit trading activities in the market still exist, with illegal elements extracting ephedrine from herb or compound preparations for the production of methamphetamine [16]. It is known that about 0.9 g of pseudoephedrine can be extracted from a box of New Contac capsules, and a bottle (100 mL) of Compound Furacilin Nasal Drops contains 0.1 g of ephedrine, while 0.75 g methamphetamine can be produced from 1 g ephedrine [17]. At present, pharmacies within China have set a purchase quantity limit of ephedrine-containing compound preparations and also require real-name registration of customers. However, to avoid inspection authorities, drug makers often prepare Ephedra materials in the form of powder, mixture, and crude extract, which leads to difficulties in their identification and brings challenges to customs inspection and market circulation supervision [18]. Therefore, it is necessary to develop a method for the accurate detection of mixture samples, compound preparations, and highly processed products containing Ephedra herb.
HPLC (high performance liquid chromatography) has been used in ephedrine alkaloids analysis, and SDS (sodium dodecyl sulfate) is often applied into the mobile phase to improve the resolution. However, it also brings more difficulties to separate the amphiphilic compounds. Lacking a specific and strong chromophore for chemical detection is also a challenge for conventional HPLC-UV detectors. The GC (gas chromatography) method is considered as the most popular technique for the quantitation of ephedrine analogs. For samples with complex composition, to enhance the sensitivity and remove interference compounds, tedious cleanup procedures and precolumn derivatization are required, resulting in pretty time-consuming protocols. Therefore, other more feasible and rapid methods may be needed for the detection of ephedrine or Ephedra herb-containing products. DNA barcoding has been recognized as a relatively simple and universal tool for species identification [19]. Chen et al. proposed the preliminary system of DNA barcoding for herbal materials based on the combination of internal transcribed spacer 2 (ITS2) and psbA-trnH barcodes, and it has been widely used in the authentication of medical plants [20]. However, the universal barcode sequences are often unsuitable for complex materials or deeply processed products due to severe DNA degradation. Shaw et al. found that short DNA fragments (88–121 bp) could be successfully amplified from pulverized samples that had been boiled for 60 min, while the longer sequences failed [21]. Meusnier et al. presented a “mini-barcode” to well address this problem. It was indicated that the full-length CO1 with 650 bp could identify 97% of the tested species, while the identification success rates using the shorter sequences of 100 bp and 150 bp within CO1 region also achieved 90% and 95%, respectively [22]. Furthermore, Han et al. put forward the nucleotide signature, generally 20–50 bp, for the determination of specific species in extracts, decoctions, and Chinese patent medicines [23,24,25]. Ephedra genus is the representative group containing ephedrine alkaloids and is the mono-genus belonging to Ephedraceae. Thus, it might be also feasible to develop a genus-level molecular marker for Ephedra L.
In the study, we aimed to develop a short molecular marker for the identification of Ephedra herb and its processed products. A unique 23-bp nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was found highly-conserved and universal within the whole Ephedra genus. Further, the genus-universal nucleotide signature was successfully applied to the determination of Ephedra component in compound preparations with severe DNA degradation. The method developed in our study can also serve as an adjunct to chemical analysis. It can help trace the source of ephedrine in ephedrine-containing products especially in forensic science and determine whether it is caused by the presence of Ephedra herbs. This study will undoubtedly provide a strong support for the supervision of Ephedra-containing products.

2. Materials and Methods

2.1. Collection of Materials

A total of 224 sequences of internal transcribed spacer 2 (ITS2) representing 59 taxa in Ephedra were downloaded from GenBank (https://www.ncbi.nlm.nih.gov/genbank/) (accessed on 19 August 2021) to develop the nucleotide signature. The accession numbers of downloaded sequences were shown in Table S1. To further verify the nucleotide signature, 125 individuals of 12 Ephedra species and varieties were collected from all over China (Table 1). The voucher specimens were deposited in the Herbarium of the Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences, Beijing, China. To evaluate the detection ability of this method, seven batches of Chinese patent medicines containing Ephedra herb (called Ephedrae Herba in formulas) were purchased from drug stores in Beijing, Heilongjiang, Shandong, and Guangdong provinces, in the forms of tablets, honeyed pills, watered pills, and concentrated pills (Table 2).

2.2. DNA Extraction

Voucher samples: The surface of specimen samples was cleaned up with 75% ethanol, and then approximately 20 mg of each sample was added to a centrifuge tube for DNA extraction. The samples were ground into fine powder with a ball-milling instrument (Retsch Co., Shanghai, China) at a frequency of 30 Hz for 2 min. Then the genomic DNA was extracted using a Plant Genomic DNA Extraction Kit (Tiangen Biotech Beijing Co., Beijing, China) according to manufacturer’s instructions.
Chinese patent medicines: Approximately 50 mg of the Chinese patent medicines was added to a centrifuge tube, and six parallel tubes of each preparation were prepared. Seven-hundred microliters of the prewash buffer (700 mM NaCl; 100 mM Tris-HCl, pH 8.0; 20 mM EDTA, pH 8.0; 2% PVP-40; and 0.4% β-mercaptoethanol) was added to the tubes to wash the powder several times until the supernatant was colorless and transparent, and then the mixture was centrifuged at 7500× g for 5 min. The genomic DNA was subsequently extracted from the precipitate via Plant Genomic DNA Extraction Kit (Tiangen Biotech Beijing Co.) in accordance with manufacturer’s instructions. Finally, the DNA in six replicates of the same batch was eluted with 50 μL of double-distilled water into a single tube. The DNA quality of voucher samples and Chinese patent medicines was examined via Nanodrop 2000 (Thermo Scientific, Waltham, Massachusetts, USA). The value of A260/280 was 1.8–2.0, and the DNA concentration ranged from 60 ng/μL to 80 ng/μL, which met the requirements of subsequent PCR reaction.

2.3. Primer Design, PCR Amplification and Sequencing

The primer pair MH-1F (5′-TCATCGAGTCTTTGAACGC-3′)/MH-1R (5′- ATGCGAAGGTCCCCTTTT-3′) was designed using Primer Premier 6.0 software (Premier Co., Palo Alto, CA, USA) for the amplification of the short DNA fragments (~150 bp) containing the nucleotide signature of Ephedra L. Polymerase chain reactions (PCR) were performed in a 25-µL system consisting of 12.5 µL of 2 × PCR Master Mix (Aidlab Biotechnologies Co., Beijing, China), 1.0 μL of forward/reverse primers (MH-1F/MH-1R, 2.5 μM), and 2.0 μL of DNA templates and filled with double-distilled water. The reactions were then performed as follows: 94 °C for 5 min; followed by 35 cycles of 94 °C for 45 s, 56 °C for 1 min, and 72 °C for 1 min; and a final extension at 72 °C for 10 min. The PCR products were examined via 1% (w/v) agarose gel electrophoresis that had been prestained by GelRed (Mei5 Biotechnology Co., Beijing, China) and bidirectionally sequenced using an ABI 3730XL sequencer (Applied Biosystems Co., Foster City, CA, USA) at the Major Engineering laboratory of Chinese Academy of Agricultural Sciences (Beijing, China).

2.4. Sequence Analysis

The relatively conserved regions, screened out from downloaded ITS2 sequences of Ephedra L, were selected as the candidates of the nucleotide signature. BLAST analysis was carried out in the website of National Center for Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/) (accessed on 19 August 202) for the validation of the intragenus conservation and intergeneric specificity of the nucleotide signature. The sequencing data of voucher specimens and Chinese patent medicine were edited and assembled via CodonCode Aligner 5.2.0 (CodonCode Co., Centerville, MA, USA). The sequences were then aligned by MEGA-X software. All the experimental sequences of the 125 specimens were submitted to GenBank database, with accession numbers listed in Table 1.

3. Results

3.1. Development of the Genus-Universal Nucleotide Signature for Ephedra L.

Through sequence screening of 224 ITS2 sequences representing 59 taxa downloaded from GenBank, a 55-bp relatively conserved fragment was obtained as the candidate of the nucleotide signature of Epedra L. The regions with different lengths within the selected fragment were intercepted and BLAST analysis was performed to determine the optimal sequence size of the nucleotide signature. It was indicated that longer DNA segments were less conserved in genus level, and a single sequence cannot cover the entire Ephedra L. (Figures S1–S5). However, too short sequences lost their intergeneric specificity and matched the species outside Ephedra genus (Figure S6). Finally, a 23-bp fragment (GTCCGGTCCGCCTCGGCGGTGCG) was identified as the unique nucleotide signature for Ephedra (Table 3). This sequence was highly conservative in Ephedra L., and no mutation sites were found in the nucleotide signature region of the 224 downloaded ITS2 sequences. BLAST results in NCBI also showed that the 23-bp nucleotide signature was specific to Ephedra genus, and there was at least one variation in this region between Ephedra and non-Ephedra (Figure S7). Therefore, the 23-bp nucleotide signature can be considered as a genus-universal molecular marker for Ephedra L.

3.2. Verification of the Nucleotide Signature in the Species and Varieties within Ephedra L.

To further test the reliability and universality of the nucleotide signature in Ephedra L., 125 individuals covering 12 species and varieties were collected. The primer pair MH-1F/MH-1R was designed to amplify the short DNA fragments containing the nucleotide signature. The results showed that all specimens were successfully amplified, indicating a good applicability of the primers (Figure 1). Finally, 125 sequences of 152–153 bp were obtained from specimen samples, which were subsequently aligned with the 224 ITS2 sequences of Ephedra L. downloaded from GenBank. The alignment of the total 349 ITS2 regions demonstrated that the 23-bp nucleotide signature existed in all the sequences without any variations. In conclusion, the developed nucleotide signature was universal within Ephedra L. and could be amplified successfully from specimens by using the primers MH-1F/MH-1R.

3.3. Application of the Nucleotide Signature on the Detection of Ephedra Herb in Compound Preparations

To validate the application of this method on complex and processed products, a total of seven batches of commercial Chinese patent medicines containing Ephedra herb were gathered from pharmacies in China, i.e., Mahuang Fuzi Xixin Soup, Maxing Zhike Tablets, Mahuang Zhisou Pills, Tongxuan Lifei Pills, Xiaoer Feire Kechuan Granules, Zhengtian Pills, and Qiguanyan Pills. The formulations of these preparations consisted of 3 (Mahuang Fuzi Xixin Soup) to 31 (Qiguanyan Pills) ingredients, respectively (Table 2). All the compound preparations were successfully amplified and sequenced using the designed primers MH-1F/MH-1R. It was showed that the Ephedra herb listed on label could be detected in the seven Chinese patent medicine samples by retrieving the nucleotide signature in sequencing results. Moreover, the direct sequencing of the PCR products presented very clean traces (Figure 2), which illustrated that the MH-1F/1R primer pair could specifically amplify the nucleotide signature of Ephedra in a complex system. To sum up, the nucleotide signature together with specific primers was suitable for the inspection of Ephedra ingredients in compound preparations and other deeply processed products.

4. Discussion

4.1. Significance of the Development of a Nucleotide Signature for Ephedra

DNA barcoding is a powerful tool for species authentication based on species-specific differences of a standard and short DNA sequence. It can help achieve the rapid, accurate, and automated identification of plants and animals [26,27]. At present, a universal standard as well as the databases for DNA barcoding have been established and widely applied [28]. It was also suggested as an efficient tool for the supervision of herbal markets. Han et al. investigated 1436 samples representing 295 medicinal species from seven herb markets in China, and found that 1260 samples were successfully identified by ITS2 barcodes, among which approximately 4.2% were adulterants [29]. The survey of species authenticity for herbal products using DNA barcoding showed that only 62% of the 21 samples labeled as “Nan-she-teng (Celastrus orbiculatus)” and 31% of the 26 samples labeled as “Lei-gong-teng (Tripterygium wilfordii)” were genuine [30]. However, in view of the strict regulation, to avoid inspection authorities, the Ephedra raw materials are often transported and traded by lawbreakers in the forms of powder, crude extract, compound preparations, and other processed products. In this circumstance, conventional DNA barcodes are no longer applicable due to severe DNA degradation. Liu et al. found that complete ITS2 region could not be amplified from herbal decoction using universal primers 2F/3R [23]. Song et al. also indicated that the five primary barcode loci (ITS2, psbA-trnH, rbcL, matK, and trnL) could be successfully amplified in only 8.89%–20% of processed samples, while the amplification rate of the short trnL (UAA) intron P6 loop was up to 75.56% [31]. Thus, in this study, we aimed to develop a short nucleotide signature to more effectively identify Ephedra-containing products.
An ideal nucleotide signature at genus level should meet the qualifications of both intragenus conservation and intergenus specificity. In this study, 224 ITS2 sequences of 59 taxa in Ephedra L. were downloaded from GenBank to develop a 23-bp nucleotide signature. Then 125 individuals representing 12 Ephedra species and varieties were collected together to test the nucleotide signature. In total, nearly 90% of the taxa within Ephedra genus were involved. Considering the possible errors in published data, firstly we verified the accuracy of the sequences downloaded from GenBank by BLAST analysis to ensure their reliability. Finally, it was proved that the 23-bp nucleotide signature universally indeed existed in Ephedra L. The 125 experiment specimens, collected from different areas in China, were identified by professional taxonomists, and the nucleotide signature was found to exist in all the samples without any mutations. It can be inferred that the nucleotide signature is ubiquitous and highly conserved in Ephedra genus. In addition, the BLAST results in NCBI also showed that the nucleotide signature was unique to Ephedra L. Therefore, we believe that currently available data is sufficient to support that the 23-bp DNA fragment can serve as a molecular tag for the identification of Ephedra-containing products. Additionally, compared to species-specific molecular markers, the genus-level nucleotide signature can effectively avoid the complex work of developing multiple detection methods for different taxa in Ephedra.

4.2. Supervision of Ephedra-Containing Products with the Genus-Universal Nucleotide Signature

The genus Ephedra contains about 67 species widely distributed around the world. The chemical constituents in Ephedra generally include alkaloids, flavonoids, tannins, polysaccharides, phenolics, etc [32], among which ephedrine-type alkaloids are regarded as the main active ingredients to exert pharmacological effects [33]. Ephedra herb has been used in traditional Chinese medicine with a long history, which was originally recorded in the ancient book of Shennong’s Classic of Materia Medica. More than 60 classical prescriptions containing Ephedra herb are recorded in the Chinese Pharmacopoeia (2020 edition). Besides officinal value, Ephedra materials were also supplemented into dietary, health care products, and cosmetics for weight loss and energy enhancement [34]. However, under the unrestricted and controlled use, more and more side effects on people appeared continuously [35]. The subsequent studies found that long-term or high-dose use of ephedrine-containing products can lead to hypertension, arrhythmia, stroke, cardiac arrest, and even sudden death [36]. Though the government and regulatory authorities have strictly controlled Ephedra and ephedrine products, its illegal production and sales still exist. Worryingly, ephedrine is also an important raw material for the production of methamphetamine. Ephedrine obtained by criminals from Ephedra herbs, crude extracts, and compound preparations for the synthesis of methamphetamine have caused great damage to society and human’s physical and mental health [18]. In a survey of 592 drug users, more than 70% claimed to have injected methamphetamine, and the proportion of the participants reporting methamphetamine as their most frequently injected drug increased from 2.1% in 2005 to 29.6% in 2015 [37]. Although chemical methods such as HPLC and GC have been widely used for the detection of ephedrine and Ephedra herbs, for processed samples with complex components, the interfering components will affect the analysis results, and the tedious pre-treatment process will greatly increase the detection time. Thus, it is urgent to establish other more effective methods for the supervision of Ephedra and its deeply processed products.
In this study, a 23-bp nucleotide signature was developed for the detection of Ephedra herb and its products with severely degraded DNA, which has been proved to be conserved within Ephedra genus and divergent with other genera. Furthermore, the method was applied to the determination of seven batches of Chinese patent medicines that contained Ephedra ingredients. The results showed that Ephedra herb could be successfully detected in all the samples by seeking the nucleotide signature in sequencing results. It is worth emphasizing that in the proprietary Chinese patent medicine Qiguanyan Pills, in addition to Ephedrae Herba, there are an additional 30 kinds of other herbs, including Armeniacae Semen Amarum (Kuxingren), Gypsum Fibrosum (Shigao), Glycyrrhizae Radix Et Rhizoma (Gancao), Peucedani Radix (Qianhu), Cynanchi Stauntonii Rhizoma Et Radix (Baiqian), Stemonae Radix (Baibu), etc. The nucleotide signature could be still amplified and sequenced successfully with the newly designed primers MH-1F/MH-1R. It is suggested that even if the ingredients are complex and diverse, the Ephedra herb can still be detected, which simultaneously reflects the high sensitivity of this method. In conclusion, the genus-universal nucleotide signature proposed in this study can be considered as a powerful tool for the supervision of Ephedra and ephedrine-containing products.

5. Conclusions

In this study, a 23-bp genus-specific nucleotide signature was developed for the detection of Ephedra herb and its highly processed products. The nucleotide signature was verified to be unique and highly conserved within Ephedra, which could be successfully amplified and sequenced from processed products containing Ephedra ingredients using the primer pair MH-1F/MH-1R. This method can also serve as an adjunct to chemical analysis to help trace the source of ephedrine in ephedrine-containing products especially in forensic science. Besides, the genus-level molecular marker effectively avoids the tedious work of establishing various identification/detection methods for different species in Ephedra. Our study will undoubtedly provide a strong support for the identification and regulation of Ephedra-containing products to prevent illegal supplement and methamphetamine production.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/molecules27072342/s1, Table S1: Information of the 224 ITS2 sequences of Ephedra downloaded from GenBank; Figure S1: BLAST results in NCBI of the sequence S1; Figure S2: BLAST results in NCBI of the sequence S2; Figure S3: BLAST results in NCBI of the sequence S3; Figure S4: BLAST results in NCBI of the sequence S4; Figure S5: BLAST results in NCBI of the sequence S5; Figure S6: BLAST results in NCBI of the sequence S7; Figure S7: BLAST results in NCBI of the nucleotide signature of Ephedra L.

Author Contributions

Conceptualization, J.H.; Data curation, G.W. and X.B.; Investigation, G.W.; Resources, G.W., X.B. and Y.R.; Writing—original draft, G.W.; Writing—review & editing, X.C. and J.H. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Research and Development Program of China (2019YFC1604701).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are openly available in https://www.ncbi.nlm.nih.gov/ with the GenBamk accession numbers in Table 1.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Bánki, O.; Roskov, Y.; Vandepitte, L.; DeWalt, R.E.; Remsen, D.; Schalk, P.; Orrell, T.; Keping, M.; Miller, J.; Aalbu, R.; et al. Catalogue of Life Checklist; Catalogue of Life: Leiden, The Netherlands, 2021. [Google Scholar] [CrossRef]
  2. González-Juárez, D.E.; Escobedo-Moratilla, A.; Flores, J.; Hidalgo-Figueroa, S.; Martínez-Tagüeña, N.; Morales-Jiménez, J.; Muñiz-Ramírez, A.; Pastor-Palacios, G.; Pérez-Miranda, S.; Ramírez-Hernández, A.; et al. A Review of the Ephedra genus: Distribution, Ecology, Ethnobotany, Phytochemistry and Pharmacological Properties. Molecules 2020, 25, 3283. [Google Scholar] [CrossRef] [PubMed]
  3. Miao, S.-M.; Zhang, Q.; Bi, X.-B.; Cui, J.-L.; Wang, M.-L. A review of the phytochemistry and pharmacological activities of Ephedra herb. Chin. J. Nat. Med. 2020, 18, 321–344. [Google Scholar] [CrossRef]
  4. Seif, M.; Deabes, M.; El-Askary, A.; El-Kott, A.F.; Albadrani, G.M.; Seif, A.; Wang, Z. Ephedra sinica mitigates hepatic oxidative stress and inflammation via suppressing the TLR4/MyD88/NF-κB pathway in fipronil-treated rats. Environ. Sci. Pollut. Res. 2021, 28, 62943–62958. [Google Scholar] [CrossRef] [PubMed]
  5. Khalil, M.; Khalifeh, H.; Saad, F.; Serale, N.; Salis, A.; Damonte, G.; Lupidi, G.; Daher, A.; Vergani, L. Protective effects of extracts from Ephedra foeminea Forssk fruits against oxidative injury in human endothelial cells. J. Ethnopharmacol. 2020, 260, 112976. [Google Scholar] [CrossRef]
  6. Palamar, J. How ephedrine escaped regulation in the United States: A historical review of misuse and associated policy. Health Policy 2011, 99, 1–9. [Google Scholar] [CrossRef]
  7. Kim, B.-S.; Song, M.-Y.; Kim, H. The anti-obesity effect of Ephedra sinica through modulation of gut microbiota in obese Korean women. J. Ethnopharmacol. 2014, 152, 532–539. [Google Scholar] [CrossRef]
  8. Munafò, A.; Frara, S.; Perico, N.; Di Mauro, R.; Cortinovis, M.; Burgaletto, C.; Cantarella, G.; Remuzzi, G.; Giustina, A.; Bernardini, R. In search of an ideal drug for safer treatment of obesity: The false promise of pseudoephedrine. Rev. Endocr. Metab. Disord. 2021, 22, 1013–1025. [Google Scholar] [CrossRef]
  9. Duan, S.; Xie, L.; Zheng, L.; Huang, J.; Guo, R.; Sun, Z.; Xie, Y.; Lv, J.; Lin, Z.; Ma, S. Long-term exposure to ephedrine leads to neurotoxicity and neurobehavioral disorders accompanied by up-regulation of CRF in prefrontal cortex and hippocampus in rhesus macaques. Behav. Brain Res. 2020, 393, 112796. [Google Scholar] [CrossRef]
  10. Takemoto, H.; Takahashi, J.; Hyuga, S.; Odaguchi, H.; Uchiyama, N.; Maruyama, T.; Yamashita, T.; Hyuga, M.; Oshima, N.; Amakura, Y.; et al. Ephedrine Alkaloids-Free Ephedra Herb Extract, EFE, Has No Adverse Effects Such as Excitation, Insomnia, and Arrhythmias. Biol. Pharm. Bull. 2018, 41, 247–253. [Google Scholar] [CrossRef] [Green Version]
  11. Zell-Kanter, M.; Quigley, M.A.; Leikin, J.B. Reduction in Ephedra Poisonings after FDA Ban. N. Engl. J. Med. 2015, 372, 2172–2174. [Google Scholar] [CrossRef]
  12. Food and Drug Administration. Final Rule Declaring Dietary Supplements Containing Ephedrine Alkaloids Adulterated Because They Present an Unreasonable Risk; Final Rule. Fed. Regist. 2004, 69, 6788–6854. Available online: https://www.govinfo.gov/content/pkg/FR-2004-02-11/pdf/04-2912.pdf (accessed on 5 February 2022).
  13. Lai, S.; Yu, C.; Dennehy, C.E.; Tsourounis, C.; Lee, K.P. Online Marketing of Ephedra Weight Loss Supplements: Labeling and Marketing Compliance with the U.S. Food and Drug Administration Ban on Ephedra. J. Altern. Complement. Med. 2021, 27, 796–802. [Google Scholar] [CrossRef]
  14. Głowacka, K.; Wiela-Hojeńska, A. Pseudoephedrine—Benefits and Risks. Int. J. Mol. Sci. 2021, 22, 5146. [Google Scholar] [CrossRef]
  15. China National Narcotics Control Commission. Drug Situation in China (2019). Available online: http://www.nncc626.com/2020-06/25/c_1210675877.htm (accessed on 5 February 2022).
  16. Yu, W.-N.; Wang, L.-H.; Cheng, H.-W. Regulatory analysis on the medical use of ephedrine-related products in Taiwan. J. Food Drug Anal. 2018, 26, 481–486. [Google Scholar] [CrossRef] [Green Version]
  17. Shi, L.; Wang, Z.; Xin, Z.; Ren, Z. Problems in Supervision of Ephedrine Compound Prescription Preparation. Chin. J. Pharmacovigil. 2010, 7, 673–675. [Google Scholar]
  18. Zhu, B.; Conlan, X.; Cao, J.; Meng, L.; Zheng, K.; Yang, D.; Yang, W. Case studies on illegal production of ephedrine/pseudoephedrine within Fujian China. Forensic Sci. Int. 2020, 312, 110326. [Google Scholar] [CrossRef]
  19. CBOL Plant Working Group; Hollingsworth, P. M.; Forrest, L.L.; Spouge, J.L.; Hajibabaei, M.; Ratnasingham, S.; van der Bank, M.; Chase, M.W.; Cowan, R.S.; Erickson, D.L.; et al. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 2009, 106, 12794–12797. [Google Scholar] [CrossRef] [Green Version]
  20. Chen, S.; Pang, X.; Song, J.; Shi, L.; Yao, H.; Han, J.; Leon, C. A renaissance in herbal medicine identification: From morphology to DNA. Biotechnol. Adv. 2014, 32, 1237–1244. [Google Scholar] [CrossRef]
  21. Lo, Y.-T.; Li, M.; Shaw, P.-C. Identification of constituent herbs in ginseng decoctions by DNA markers. Chin. Med. 2015, 10, 1–7. [Google Scholar] [CrossRef] [Green Version]
  22. Meusnier, I.; Singer, G.A.; Landry, J.-F.; Hickey, D.A.; Hebert, P.D.; Hajibabaei, M. A universal DNA mini-barcode for biodiversity analysis. BMC Genom. 2008, 9, 214. [Google Scholar] [CrossRef] [Green Version]
  23. Liu, Y.; Wang, X.; Wang, L.; Chen, X.; Pang, X.; Han, J. A Nucleotide Signature for the Identification of American Ginseng and Its Products. Front. Plant Sci. 2016, 7, 319. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Wang, X.; Liu, Y.; Wang, L.; Han, J.; Chen, S. A Nucleotide Signature for the Identification of Angelicae Sinensis Radix (Danggui) and Its Products. Sci. Rep. 2016, 6, 34940. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Guo, M.; Jiang, W.; Yu, J.; Pang, X. Investigating the authenticity of Ophiopogonis Radix and its Chinese patent medicines by using a nucleotide signature. J. Ethnopharmacol. 2020, 261, 113134. [Google Scholar] [CrossRef] [PubMed]
  26. De Boer, H.J.; Ichim, M.C.; Newmaster, S.G. DNA Barcoding and Pharmacovigilance of Herbal Medicines. Drug Saf. 2015, 38, 611–620. [Google Scholar] [CrossRef]
  27. Matthes, N.; Pietsch, K.; Rullmann, A.; Näumann, G.; Popping, B.; Szabo, K. The Barcoding Table of Animal Species (BaTAnS): A new tool to select appropriate methods for animal species identification using DNA barcoding. Mol. Biol. Rep. 2020, 47, 6457–6461. [Google Scholar] [CrossRef]
  28. Tnah, L.; Lee, S.; Tan, A.; Lee, C.T.; Ng, K.K.S.; Ng, C.; Farhanah, Z.N. DNA barcode database of common herbal plants in the tropics: A resource for herbal product authentication. Food Control 2018, 95, 318–326. [Google Scholar] [CrossRef]
  29. Han, J.; Pang, X.; Liao, B.; Yao, H.; Song, J.; Chen, S. An authenticity survey of herbal medicines from markets in China using DNA barcoding. Sci. Rep. 2016, 6, 18723. [Google Scholar] [CrossRef]
  30. Zhang, J.; Hu, X.; Wang, P.; Huang, B.; Sun, W.; Xiong, C.; Hu, Z.; Chen, S. Investigation on Species Authenticity for Herbal Products of Celastrus Orbiculatus and Tripterygum Wilfordii from Markets Using ITS2 Barcoding. Molecules 2018, 23, 967. [Google Scholar] [CrossRef] [Green Version]
  31. Song, M.; Dong, G.-Q.; Zhang, Y.-Q.; Liu, X.; Sun, W. Identification of processed Chinese medicinal materials using DNA mini-barcoding. Chin. J. Nat. Med. 2017, 15, 481–486. [Google Scholar] [CrossRef]
  32. Ibragic, S.; Sofic, E. Chemical composition of various Ephedra species. Bosn. J. Basic Med. Sci. 2015, 15, 21. [Google Scholar] [CrossRef] [Green Version]
  33. Yun, N.; Kim, H.J.; Park, S.C.; Park, G.; Kim, M.K.; Choi, Y.H.; Jang, Y.P. Localization of Major Ephedra Alkaloids in Whole Aerial Parts of Ephedrae Herba Using Direct Analysis in Real Time-Time of Flight-Mass Spectrometry. Molecules 2021, 26, 580. [Google Scholar] [CrossRef]
  34. Pawar, R.S.; Grundel, E. Overview of regulation of dietary supplements in the USA and issues of adulteration with phenethylamines (PEAs). Drug Test. Anal. 2017, 9, 500–517. [Google Scholar] [CrossRef]
  35. European Food Safety Authority. Scientific Opinion on safety evaluation of Ephedra species for use in food. EFSA J. 2013, 11, 3467. [Google Scholar]
  36. Gardner, S.F.; Franks, A.; Gurley, B.J.; Haller, C.A.; Singh, B.K.; Mehta, J.L. Effect of a multicomponent, ephedra-containing dietary supplement (Metabolife 356) on Holter monitoring and hemostatic parameters in healthy volunteers. Am. J. Cardiol. 2003, 91, 1510–1513. [Google Scholar] [CrossRef]
  37. Al-Tayyib, A.; Koester, S.; Langegger, S.; Raville, L. Heroin and Methamphetamine Injection: An Emerging Drug Use Pattern. Subst. Use Misuse 2017, 52, 1051–1058. [Google Scholar] [CrossRef] [Green Version]
Figure 1. Amplification of 12 species and varieties in Ephedra genus with the primers MH-1F/MH-1R. M. DNA marker; CK. Negative control; 1–3. E. equisetina; 4. E. fedtschenkoae; 5–6. E. gerardiana; 7–9. E. intermedia; 10–13. E. intermedia var. tibetica; 14. E. likiangensis; 15. E. minuta; 16. E. monosperma; 17–18. E. przewalskii; 19. E. regeliana; 20–21. E. saxatilis; 22–24. E. sinica.
Figure 1. Amplification of 12 species and varieties in Ephedra genus with the primers MH-1F/MH-1R. M. DNA marker; CK. Negative control; 1–3. E. equisetina; 4. E. fedtschenkoae; 5–6. E. gerardiana; 7–9. E. intermedia; 10–13. E. intermedia var. tibetica; 14. E. likiangensis; 15. E. minuta; 16. E. monosperma; 17–18. E. przewalskii; 19. E. regeliana; 20–21. E. saxatilis; 22–24. E. sinica.
Molecules 27 02342 g001
Figure 2. Sequencing peak profiles of seven batches of Chinese patent medicine containing Ephedra herb.
Figure 2. Sequencing peak profiles of seven batches of Chinese patent medicine containing Ephedra herb.
Molecules 27 02342 g002
Table 1. Information of the Ephedra samples in this study.
Table 1. Information of the Ephedra samples in this study.
No.SpeciesVoucher No.Collection SiteGenBank Accession
1E. equisetinaIMD0001954HebeiOL456774
2E. equisetinaIMD0001953ShaanxiOL456770
3E. equisetinaIMD0001955ShanxiOL456771
4E. equisetinaIMD0001952HebeiOL456772
5E. equisetinaIMD0001951XinjiangOL456773
6E. equisetinaIMD0001950XinjiangOL456775
7E. equisetinaIMD0001949XinjiangOL456776
8E. equisetinaIMD0001946XinjiangOL456777
9E. equisetinaIMD0001964BeijingOL456763
10E. equisetinaIMD0001963BeijingOL456764
11E. equisetinaIMD0001966XinjiangOL456765
12E. equisetinaIMD0001961HebeiOL456766
13E. equisetinaIMD0001958JiangsuOL456767
14E. equisetinaIMD0001957BeijingOL456768
15E. equisetinaIMD0001956BeijingOL456769
16E. fedtschenkoaeIMD0001967QinghaiOL456778
17E. gerardianaIMD0001970XizangOL456779
18E. gerardianaIMD0001969XizangOL456780
19E. gerardianaIMD0001968XizangOL456781
20E. gerardianaIMD0001971XizangOL456782
21E. gerardianaIMD0001972XizangOL456783
22E. intermediaIMD0001980QinghaiOL456784
23E. intermediaIMD0001978QinghaiOL456785
24E. intermediaIMD0001976XinjiangOL456786
25E. intermediaIMD0001975QinghaiOL456787
26E. intermediaIMD0001974XinjiangOL456788
27E. intermediaIMD0001995SichuanOL456789
28E. intermediaIMD0001994NeimengguOL456790
29E. intermediaIMD0001992XinjiangOL456791
30E. intermediaIMD0001991XinjiangOL456792
31E. intermediaIMD0001989XinjiangOL456793
32E. intermediaIMD0001988HebeiOL456794
33E. intermediaIMD0001996NeimengguOL456795
34E. intermediaIMD0001986XinjiangOL456796
35E. intermediaIMD0001984GansuOL456797
36E. intermediaIMD0001983XinjiangOL456798
37E. intermediaIMD0001981GansuOL456799
38E. intermediaIMD0001985SichuanOL456800
39E. intermediaIMD0001987XinjiangOL456801
40E. intermedia var. tibeticaIMD0001982XizangOL456802
41E. intermedia var. tibeticaIMD0002003XizangOL456803
42E. intermedia var. tibeticaIMD0002002XizangOL456804
43E. intermedia var. tibeticaIMD0002001XizangOL456805
44E. intermedia var. tibeticaIMD0002000XizangOL456806
45E. intermedia var. tibeticaIMD0001999XizangOL456807
46E. intermedia var. tibeticaIMD0001998XizangOL456808
47E. intermedia var. tibeticaIMD0001997XizangOL456809
48E. intermedia var. tibeticaIMD0002016XizangOL456810
49E. intermedia var. tibeticaIMD0002014XizangOL456811
50E. intermedia var. tibeticaIMD0002013XizangOL456812
51E. intermedia var. tibeticaIMD0002012XizangOL456813
52E. intermedia var. tibeticaIMD0002011XizangOL456814
53E. intermedia var. tibeticaIMD0002010XizangOL456815
54E. intermedia var. tibeticaIMD0002009XizangOL456816
55E. intermedia var. tibeticaIMD0002007XizangOL456817
56E. intermedia var. tibeticaIMD0002006XizangOL456818
57E. intermedia var. tibeticaIMD0002005XizangOL456819
58E. intermedia var. tibeticaIMD0002008XizangOL456820
59E. intermedia var. tibeticaIMD0002021XizangOL456821
60E. intermedia var. tibeticaIMD0002017XizangOL456822
61E. intermedia var. tibeticaIMD0002019XizangOL456823
62E. intermedia var. tibeticaIMD0002020XizangOL456824
63E. intermedia var. tibeticaIMD0002018XizangOL456825
64E. intermedia var. tibeticaIMD0002024XizangOL456826
65E. intermedia var. tibeticaIMD0002023XizangOL456827
66E. intermedia var. tibeticaIMD0002022XizangOL456828
67E. likiangensisIMD0002027YunnanOL456829
68E. likiangensisIMD0002026SichuanOL456830
69E. likiangensisIMD0002025YunnanOL456831
70E. minutaIMD0002029XizangOL456832
71E. minutaIMD0002030XizangOL456833
72E. minutaIMD0002028SichuanOL456834
73E. monospermaIMD0002037QinghaiOL456835
74E. monospermaIMD0002043XizangOL456836
75E. monospermaIMD0002044XizangOL456837
76E. przewalskiiIMD0002060GansuOL456841
77E. przewalskiiIMD0002059QinghaiOL456842
78E. przewalskiiIMD0002057GansuOL456843
79E. przewalskiiIMD0002056XinjiangOL456844
80E. przewalskiiIMD0002055QinghaiOL456845
81E. przewalskiiIMD0002063GansuOL456846
82E. przewalskiiIMD0002062GansuOL456838
83E. przewalskiiIMD0002061GansuOL456839
84E. przewalskiiIMD0002051XinjiangOL456840
85E. regelianaIMD0002066QinghaiOL456850
86E. regelianaIMD0002064XinjiangOL456847
87E. regelianaIMD0002067QinghaiOL456848
88E. regelianaIMD0002070XinjiangOL456849
89E. saxatilisIMD0002071XizangOL456851
90E. saxatilisIMD0002078XizangOL456852
91E. saxatilisIMD0002076XizangOL456853
92E. saxatilisIMD0002075XizangOL456854
93E. saxatilisIMD0002077SichuanOL456855
94E. saxatilisIMD0002081XizangOL456856
95E. saxatilisIMD0002080XizangOL456857
96E. saxatilisIMD0002079XizangOL456858
97E. saxatilisIMD0002090XizangOL456859
98E. saxatilisIMD0002089XizangOL456860
99E. saxatilisIMD0002088XizangOL456861
100E. saxatilisIMD0002087XizangOL456862
101E. sinicaIMD0002098HebeiOL456887
102E. sinicaIMD0002099HebeiOL456863
103E. sinicaIMD0002097HebeiOL456864
104E. sinicaIMD0002095ShanxiOL456865
105E. sinicaIMD0002106HebeiOL456866
106E. sinicaIMD0002105NeimengguOL456867
107E. sinicaIMD0002104HebeiOL456868
108E. sinicaIMD0002103HebeiOL456869
109E. sinicaIMD0002101ShanxiOL456870
110E. sinicaIMD0002109NeimengguOL456871
111E. sinicaIMD0002108HebeiOL456872
112E. sinicaIMD0002118NeimengguOL456873
113E. sinicaIMD0002117NeimengguOL456874
114E. sinicaIMD0002115NeimengguOL456875
115E. sinicaIMD0002112NeimengguOL456876
116E. sinicaIMD0002111JilinOL456877
117E. sinicaIMD0002125NeimengguOL456878
118E. sinicaIMD0002122NeimengguOL456879
119E. sinicaIMD0002123NeimengguOL456880
120E. sinicaIMD0002121NeimengguOL456881
121E. sinicaIMD0002119HebeiOL456882
122E. sinicaIMD0002136NeimengguOL456883
123E. sinicaIMD0002135NeimengguOL456884
124E. sinicaIMD0002134NeimengguOL456885
125E. sinicaIMD0002132NeimengguOL456886
Table 2. Detailed information of the seven batches of Chinese patent medicine.
Table 2. Detailed information of the seven batches of Chinese patent medicine.
No.Sample NameTypeCollection SiteNumber of IngredientsIngredients on Label
ZCY-01Mahuang Fuzi Xixin SoupConcentrated pillsGuangdong3Ephedrae Herba, Aconiti Lateralis Radix Praeparata, Asari Radix Et Rhizoma
ZCY-02Maxing Zhike TabletsTabletsJilin4Ephedrae Herba, Armeniacae Semen Amarum, Gypsum Fibrosum, Glycyrrhizae Radix Et Rhizoma Praeparata Cum Melle
ZCY-03Mahuang Zhisou PillsWatered pillsShandong7Citri Exocarpium Rubrum, Ephedrae Herba, Platycodonis Radix, Fritillariae Cirrhosae Bulbus, Schisandrae Chinensis Fructus, Poria, Asari Radix Et Rhizoma
ZCY-04Tongxuan Lifei PillsHoneyed pillsBeijing11Perillae Folium, Peucedani Radix, Platycodonis Radix, Armeniacae Semen Amarum, Ephedrae Herba, Glycyrrhizae Radix Et Rhizoma, Citri Reticulatae Pericarpium, Pinelliae Rhizoma, Poria, Aurantii Fructus, Scutellariae Radix
ZCY-05Xiaoer Feire Kechuan GranulesGranulesHeilongjiang11Ephedrae Herba, Armeniacae Semen Amarum, Gypsum Fibrosum, Glycyrrhizae Radix Et Rhizoma, Lonicerae Japonicae Flos, Forsythiae Fructus, Anemarrhenae Rhizoma, Scutellariae Radix, Isatidis Radix, Ophiopogonis Radix, Houttuyniae Herba
ZCY-06Zhengtian PillsWatered pillsGuangdong15Uncariae Ramulus Cum Uncis, Paeoniae Radix Alba, Chuanxiong Rhizoma, Angelicae Sinensis Radix, Rehmanniae Radix, Angelicae Dahuricae Radix, Saposhnikoviae Radix, Notopterygii Rhizoma Et Radix, Persicae Semen, Carthami Flos, Asari Radix Et Rhizoma, Angelicae Pubescentis Radix, Ephedrae Herba, Aconiti Lateralis Radix Praeparata, Spatholobi Caulis
ZCY-07Qiguanyan PillsWatered pillsBeijing31Ephedrae Herba, Armeniacae Semen Amarum, Gypsum Fibrosum, Glycyrrhizae Radix Et Rhizoma, Peucedani Radix, Cynanchi Stauntonii Rhizoma Et Radix, Stemonae Radix, Asteris Radix Et Rhizoma, Farfarae Flos, Meretricis Concha Cyclinae Concha, Descurainiae Semen Lepidii Semen, Citri Grandis Exocarpium, Platycodonis Radix, Poria, Pinelliae Rhizoma, Polygalae Radix, Inulae Flos, Pumice, Perillae Fructus, Codonopsis Radix, Jujubae Fructus, Schisandrae Chinensis Fructus, Cinnamomi Ramulus, Allii Macrostemonis Bulbus, Paeoniae Radix Alba, Mori Folium, Belamcandae Rhizoma, Scutellariae Radix, Indigo Naturalis, Taraxaci Herba, Eriobotryae Folium
Table 3. BLAST results of the candidate sequences with different lengths in NCBI.
Table 3. BLAST results of the candidate sequences with different lengths in NCBI.
No.Sequences (5′-3′)Length/bpIntergeneric SpecificityIntragenus Conservation
S1TCGGGGGGACGGCCTTGACCGTCCGGTCCGCCTCGGCGGTGCGGTCGGTTGAAAT55×
S2GGGGGACGGCCTTGACCGTCCGGTCCGCCTCGGCGGTGCGGTCGG45×
S3GCCTTGACCGTCCGGTCCGCCTCGGCGGTGCGGTC35×
S4GACCGTCCGGTCCGCCTCGGCGGTGCGGTC30×
S5CCGTCCGGTCCGCCTCGGCGGTGCGGT27×
S6GTCCGGTCCGCCTCGGCGGTGCG23
S7CCGGTCCGCCTCGGCGGTGC20×
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wang, G.; Bai, X.; Chen, X.; Ren, Y.; Han, J. Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products. Molecules 2022, 27, 2342. https://doi.org/10.3390/molecules27072342

AMA Style

Wang G, Bai X, Chen X, Ren Y, Han J. Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products. Molecules. 2022; 27(7):2342. https://doi.org/10.3390/molecules27072342

Chicago/Turabian Style

Wang, Gang, Xuanjiao Bai, Xiaochen Chen, Ying Ren, and Jianping Han. 2022. "Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products" Molecules 27, no. 7: 2342. https://doi.org/10.3390/molecules27072342

APA Style

Wang, G., Bai, X., Chen, X., Ren, Y., & Han, J. (2022). Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products. Molecules, 27(7), 2342. https://doi.org/10.3390/molecules27072342

Article Metrics

Back to TopTop