Innovative Purification Method of Ovatodiolide from Anisomeles indica to Induce Apoptosis in Human Gastric Cancer Cells
Abstract
:1. Introduction
2. Results
2.1. Extraction Yields and Ovatodiolide Contents of the AI Extract
2.2. Ovatodiolide Content in Different Solvent Partitions of 95% Ethanol Extract
2.3. Ovatodiolide Purification by Ascending Mode of CPC
2.4. HPLC and LC/MS Determine the CPC Purified Ovatodiolide
2.5. Inhibition Rate of 95% Ethanol Extract on Gastric Cancer AGS Cells
2.6. Ovatodiolide Induces Mmorphological Changes and Apoptosis in AGS Cells
2.7. Ovatidiolide Induces Cell Cycle Arrested at G2/M Phase
2.8. Expression Levels of Bcl-2, Bax and Caspase-3 Genes Are Modulated by Ovatodiolide
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Plant Material and Extraction
4.3. HPLC-MS Determination of Ovatodiolide in Crude Extracts and Partitions
4.4. CPC Procedure in the Purification of Ovatodiolide
4.5. Effects of Ovatodiolide on AGS Gastric Cancer Cell Growth
4.6. DAPI and Annexin V/Propidium Iodide (AnnV/PI) Staining
4.7. Flow Cytometric Analysis of Cell Cycle
4.8. RNA Isolation and Quantitative Real-Time PCR (qPCR)
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Arisawa, M.; Nimura, M.; Ikeda, A.; Hayashi, T.; Morita, N.; Momose, Y.; Takeda, R.; Nakanishi, S. Biologically active macrocyclic diterpenoids from Chinese drug “Fáng Féng Cáo” I. Isolation and structure. Planta Med. 1986, 52, 38–41. [Google Scholar] [CrossRef] [PubMed]
- Rao, Y.K.; Lien, H.M.; Lin, Y.H.; Hsu, Y.M.; Yeh, C.T.; Chen, C.C.; Lai, C.H.; Tzeng, Y.M. Antibacterial activities of Anisomeles indica constituents and their inhibition effect on Helicobacter pylori-induced inflammation in human gastricepithelial cells. Food Chem. 2012, 132, 780–787. [Google Scholar] [CrossRef]
- Kunwar, R.M.; Shrestha, K.P.; Bussmann, R.W. Traditional herbal medicine in Far-west Nepal: A pharmacological appraisal. J. Ethnobiol. Ethnomed. 2010, 6, 35. [Google Scholar] [CrossRef] [Green Version]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [Green Version]
- Reddavid, R.; Dagatti, S.; Franco, C.; Puca, L.; Tomatis, M.; Corso, S.; Giordano, S.; Degiuli, M. Molecularly targeted therapies for gastric cancer. state of the art. Cancers 2021, 13, 4094. [Google Scholar] [CrossRef] [PubMed]
- Rao, Y.K.; Fang, S.H.; Hsieh, S.C.; Yeh, T.H.; Tzeng, Y.M. The constituents of Anisomeles indica and their anti-inflammatory activities. J. Ethnopharmacol. 2009, 121, 292–296. [Google Scholar] [CrossRef] [PubMed]
- Shahidul Alam, M.; Quader, M.A.; Rashid, M.A. HIV-inhibitory diterpenoid from Anisomeles indica. Fitoterapia 2000, 71, 574–576. [Google Scholar] [CrossRef]
- Wang, C.N.; Lee, Y.L.; Lin, Y.P.; Chung, W.H.; Tzeng, Y.M.; Lee, C.C. Ovatodiolide suppresses allergic airway inflammation and hyperresponsiveness in a murine model of asthma. Eur. J. Pharmacol. 2017, 812, 9–17. [Google Scholar] [CrossRef]
- Yu, C.Y.; Teng, C.L.; Hung, P.S.; Cheng, C.C.; Hsu, S.L.; Hwang, G.Y.; Tzeng, Y.M. Ovatodiolide isolated from Anisomeles indica induces cell cycle G2/M arrest and apoptosis via a ROS-dependent ATM/ATR signaling pathways. Eur. J. Pharmacol. 2018, 819, 16–29. [Google Scholar] [CrossRef]
- Chen, J.H.; Wu, A.T.H.; Bamodu, O.A.; Yadav, V.K.; Chao, T.Y.; Tzeng, Y.M.; Mukhopadhyay, D.; Hsiao, M.; Lee, J.C. Ovatodiolide suppresses oral cancer malignancy by down-regulating exosomal Mir-21/STAT3/β-Catenin cargo and preventing oncogenic transformation of normal gingival fibroblasts. Cancers 2019, 12, 56. [Google Scholar] [CrossRef] [Green Version]
- Ho, J.Y.; Hsu, R.J.; Wu, C.L.; Chang, W.L.; Cha, T.L.; Yu, D.S.; Yu, C.P. Ovatodiolide targets β-catenin signaling in suppressing tumorigenesis and overcoming drug resistance in renal cell carcinoma. Evid. Based Complement. Alternat. Med. 2013, 161628. [Google Scholar] [CrossRef] [Green Version]
- Lu, K.T.; Wang, B.Y.; Chi, W.Y.; Chien, J.C.; Yang, J.J.; Lee, H.T.; Tzeng, Y.M.; Chang, W.W. Ovatodiolide inhibits breast cancer stem/progenitor cells through SMURF2-mediated downregulation of Hsp27. Toxins 2016, 8, 127. [Google Scholar] [CrossRef] [Green Version]
- Rodrigues, I.G.; Miguel, M.G.; Mnif, W. A brief review on new naturally occurring cembranoid diterpene derivatives from the soft corals of the genera Sarcophyton, Sinularia, and Lobophytum Since 2016. Molecules 2019, 24, 781. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.-L.; Lan, Y.-H.; Hsieh, P.-W.; Wu, C.-C.; Chen, S.-L.; Yen, C.-T.; Chang, F.R.; Hung, W.C.; Wu, Y.C. Bioactive cembrane diterpenoids of Anisomeles indica. J. Nat. Prod. 2008, 71, 1207–1212. [Google Scholar] [CrossRef]
- Bojczuk, M.; Żyżelewicz, D.; Hodurek, P. Centrifugal partition chromatography—A review of recent applications and some classic references. J. Sep. Sci. 2017, 40, 1597–1609. [Google Scholar] [CrossRef]
- Ito, Y.; Bowman, R.L. Countercurrent chromatography: Liquid-liquid partition chromatography without solid support. Science 1970, 167, 281–283. [Google Scholar] [CrossRef]
- Lien, H.M.; Wu, H.Y.; Hung, C.L.; Chen, C.J.; Wu, C.L.; Chen, K.W.; Huang, C.L.; Chang, S.J.; Chen, C.C.; Lin, H.J.; et al. Antibacterial activity of ovatodiolide isolated from Anisomeles indica against Helicobacter pylori. Sci Rep. 2019, 9, 4205. [Google Scholar] [CrossRef] [PubMed]
- Mousavi, B.; Tafvizi, F.; Zaker Bostanabad, S. Green synthesis of silver nanoparticles using Artemisia turcomanica leaf extract and the study of anti-cancer effect and apoptosis induction on gastric cancer cell line (AGS). Artif. Cells Nanomed. Biotechnol. 2018, 46 (Suppl. S1), 499–510. [Google Scholar] [CrossRef] [Green Version]
- Rahimivand, M.; Tafvizi, F.; Noorbazargan, H. Synthesis and characterization of alginate nanocarrier encapsulating Artemisia ciniformis extract and evaluation of the cytotoxicity and apoptosis induction in AGS cell line. Int. J. Biol. Macromol. 2020, 158, 338–357. [Google Scholar] [CrossRef]
- Chen, J.C.; Dai, Y.Z.; Tzeng, Y.M.; Liao, J.W. Genotoxicity and 28-day repeated dose oral toxicity study of ovatodiolide in rats. Toxicol. Rep. 2021, 8, 1783–1791. [Google Scholar] [CrossRef] [PubMed]
- Narrandes, S.; Xu, W. Gene expression detection assay for cancer clinical use. J. Cancer 2018, 9, 2249–2265. [Google Scholar] [CrossRef] [PubMed]
- Korsmeyer, S.J.; Shutter, J.R.; Veis, D.J.; Merry, D.E.; Oltvai, Z.N. Bcl-2/BAX: A rheostat that regulates an anti-oxidant pathway and cell death. Semin. Cancer Biol. 1993, 4, 327–332. [Google Scholar] [PubMed]
- Gross, A.; McDonnell, J.M.; Korsmeyer, S.J. BCL-2 family members and the mitochondria in apoptosis. Genes Dev. 1999, 13, 1899–1911. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cory, S.; Adams, J.M. The BCL2 family: Regulators of the cellular life-or-death switch. Nat. Rev. Cancer 2002, 2, 647–656. [Google Scholar] [CrossRef]
- Gryko, M.; Pryczynicz, A.; Zareba, K.; Kędra, B.; Kemona, A.; Guzińska-Ustymowicz, K. The expression of Bcl-2 and BID in gastric cancer cells. J. Immunol. Res. 2014, 2014, 953203. [Google Scholar] [CrossRef] [Green Version]
- Wallace, D.C. A mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: A dawn for evolutionary medicine. Annu. Rev. Genet. 2005, 39, 359–407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hou, Y.Y.; Wu, M.L.; Hwang, Y.C.; Chang, F.R.; Wu, Y.C.; Wu, C.C. The natural diterpenoid ovatodiolide induces cell cycle arrest and apoptosis in human oral squamous cell carcinoma Ca9-22 cells. Life Sci. 2009, 85, 26–32. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.J.; Huang, T.H.; Yadav, V.K.; Sumitra, M.R.; Tzeng, D.T.; Wei, P.L.; Shih, J.W.; Wu, A.T. Preclinical investigation of ovatodiolide as a potential inhibitor of colon cancer stem cells via downregulating sphere-derived exosomal β-catenin/STAT3/miR-1246 cargoes. Am. J. Cancer Res. 2020, 10, 2337–2354. [Google Scholar]
- Kostanyan, A.A.; Voshkin, A.A.; Belova, V.V. Analytical, preparative, and industrial-scale separation of substances by methods of countercurrent liquid-liquid chromatography. Molecules 2020, 25, 6020. [Google Scholar] [CrossRef]
- Morley, R.; Minceva, M. Operating mode and parameter selection in liquid-liquid chromatography. J. Chromatogr. A. 2020, 1617, 460479. [Google Scholar] [CrossRef] [PubMed]
- Khadhraoui, B.; Ummat, V.; Tiwari, B.K.; Fabiano-Tixier, A.S.; Chemat, F. Review of ultrasound combinations with hybrid and innovative techniques for extraction and processing of food and natural products. Ultrason. Sonochem. 2021, 76, 105625. [Google Scholar] [CrossRef] [PubMed]
- Michel, T.; Destandau, E.; Elfakir, C. New advances in countercurrent chromatography and centrifugal partition chromatography: Focus on coupling strategy. Anal. Bioanal. Chem. 2014, 406, 957–969. [Google Scholar] [CrossRef] [PubMed]
- Messaili, S.; Colas, C.; Fougère, L.; Destandau, E. Combination of molecular network and centrifugal partition chromatography fractionation for targeting and identifying Artemisia annua L. antioxidant compounds. J. Chromatogr. A 2020, 1615, 460785. [Google Scholar] [CrossRef] [PubMed]
- Lorántfy, L.; Rutterschmid, D.; Örkényi, R.; Bakonyi, D.; Faragó, J.; Dargó, G.; Könczöl, Á. Continuous Industrial-scale centrifugal partition chromatography with automatic solvent system handling: Concept and instrumentation. Org. Process. Res. Dev. 2020, 24, 2676–2688. [Google Scholar] [CrossRef]
- Lee, W.C.; Peng, C.C.; Chang, C.H.; Huang, S.H.; Chyau, C.C. Extraction of antioxidant components from Bidens pilosa flowers and their uptake by human intestinal Caco-2 cells. Molecules 2013, 18, 1582–1601. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, T.Y.; Tan, Z.J.; Jiang, L.; Gu, J.F.; Wu, X.S.; Cao, Y.; Li, M.L.; Wu, K.J.; Liu, Y.B. Curcumin induces apoptosis in gallbladder carcinoma cell line GBC-SD cells. Cancer Cell Int. 2013, 13, 64. [Google Scholar] [CrossRef] [Green Version]
- Baskić, D.; Popović, S.; Ristić, P.; Arsenijević, N.N. Analysis of cycloheximide-induced apoptosis in human leukocytes: Fluorescence microscopy using annexin V/propidium iodide versus acridin orange/ethidium bromide. Cell Biol. Int. 2006, 30, 924–932. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]









| Ethanol Concentration (%) | Yield (%, w/w) * |
|---|---|
| 0 | 11.40 ± 1.24 c |
| 25 | 19.38 ± 0.13 b |
| 50 | 22.57 ± 0.13 a |
| 75 | 21.26 ± 0.84 a |
| 95 | 11.57 ± 0.38 c |
| Partition Solvent | Yield (%, w/w) * | Ovatodiolide (HPLC, %) * |
|---|---|---|
| n-Hexane | 2.87 ± 1.06 ab | 11.26 ± 1.01 a |
| Ethyl acetate | 1.42 ± 0.24 bc | 11.76 ± 1.47 a |
| n-Butanol | 4.70 ± 0.88 a | 6.94 ± 0.56 b |
| Aqueous | 0.99 ± 0.05 c | 1.71 ± 0.25 c |
| Two-Phase Solvent System | Ratio (v/v/v/v) | Kd * | Ka * |
|---|---|---|---|
| n-hexane:ethyl acetate:methanol:water | 1.0:4.0:1.0:4.0 | 0.30 | 3.36 |
| n-hexane:ethyl acetate:methanol:water | 1.4:3.6:1.4:3.6 | 0.31 | 3.26 |
| n-hexane:ethyl acetate:methanol:water | 2.0:3.0:2.0:3.0 | 0.16 | 6.09 |
| n-hexane:ethyl acetate:methanol:water | 1.0:1.0:1.0:1.0 | 1.42 | 0.70 |
| n-hexane:ethyl acetate:methanol:water | 3.0:2.0:3.0:2.0 | 7.17 | 0.14 |
| n-hexane:ethyl acetate:methanol:water | 3.6:1.4:3.6:1.4 | 0.12 | 8.44 |
| n-hexane:ethyl acetate:methanol:water | 4.0:1.0:4.0:1.0 | 0.12 | 8.55 |
| n-hexane:ethyl acetate:methanol:water | 4.3:0.7:4.3:0.7 | 0.10 | 10.35 |
| Samples | IC50 * | |
|---|---|---|
| 24 h | 48 h | |
| 95% ethanol extract | >200 μg/mL | 126 μg/mL |
| Ovatodiolide | 13.02 ± 3.06 μM | 6.18 ± 0.80 μM |
| Gene (Accession No.) | Primer (5′ to 3′) | Product Length (bp) |
|---|---|---|
| Bcl-2 (NM_000633.3) | F: ACTGGCTCTGTCTGAGTAAG R: CCTGATGCTCTGGGTAAC | 103 |
| Bax (NM_138761.4) | F: CCCGAGAGGTCTTTTCCGAG R: CCAGCCCATGATGGTTCTGAT | 155 |
| Caspase-3 (NM_004346.4) | F: GAAATTGTGGAATTGATGCGTGA R: CTACAACGATCCCCTCTGAAAAA | 164 |
| β-actin (NM_001101.5) | F: TGGCACCCAGCACAATGAA R: CTAAGTCATAGTCCGGGTAGAAGCA | 186 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lien, H.-M.; Huang, S.-H.; Chang, C.-H.; Huang, C.-L.; Chen, C.-C.; Chyau, C.-C. Innovative Purification Method of Ovatodiolide from Anisomeles indica to Induce Apoptosis in Human Gastric Cancer Cells. Molecules 2022, 27, 587. https://doi.org/10.3390/molecules27030587
Lien H-M, Huang S-H, Chang C-H, Huang C-L, Chen C-C, Chyau C-C. Innovative Purification Method of Ovatodiolide from Anisomeles indica to Induce Apoptosis in Human Gastric Cancer Cells. Molecules. 2022; 27(3):587. https://doi.org/10.3390/molecules27030587
Chicago/Turabian StyleLien, Hsiu-Man, Shiau-Huei Huang, Chi-Huang Chang, Chao-Lu Huang, Chia-Chang Chen, and Charng-Cherng Chyau. 2022. "Innovative Purification Method of Ovatodiolide from Anisomeles indica to Induce Apoptosis in Human Gastric Cancer Cells" Molecules 27, no. 3: 587. https://doi.org/10.3390/molecules27030587
APA StyleLien, H.-M., Huang, S.-H., Chang, C.-H., Huang, C.-L., Chen, C.-C., & Chyau, C.-C. (2022). Innovative Purification Method of Ovatodiolide from Anisomeles indica to Induce Apoptosis in Human Gastric Cancer Cells. Molecules, 27(3), 587. https://doi.org/10.3390/molecules27030587

