Small Molecule Fisetin Modulates Alpha–Synuclein Aggregation
Abstract
:1. Introduction
2. Results
2.1. Physiologically Relevant Concentrations of Fisetin Protect Neuronal Cells against Oxidative Insults
2.2. Fisetin Reduces αsyn-Mediated Toxicity in a Yeast Model of Synucleinopathy
2.3. Fisetin Reduces αsyn Aggregation in a Yeast Model of Synucleinopathy
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Cell Culture Conditions and Treatments
4.3. Quantitative Real-Time PCR
4.4. Yeast Strains and Growth Conditions
4.5. Growth Curves
4.6. Fluorescence Microscopy
4.7. Flow Cytometry Analysis
4.8. Protein Analysis
4.9. Filter Trap Analysis
4.10. Thioflavin T Assay
4.11. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- de Lau, L.M.; Breteler, M.M. Epidemiology of Parkinson’s Disease. Lancet Neurol. 2006, 5, 525–535. [Google Scholar] [CrossRef]
- Wong, Y.C.; Krainc, D. α-Synuclein Toxicity in Neurodegeneration: Mechanism and Therapeutic Strategies. Nat. Med. 2017, 23, 1–13. [Google Scholar] [CrossRef]
- Hirsch, E.C.; Vyas, S.; Hunot, S. Neuroinflammation in Parkinson’s Disease. Parkinsonism Relat. Disord. 2012, 18, S210–S212. [Google Scholar] [CrossRef]
- Figueira, I.; Menezes, R.; Macedo, D.; Costa, I.; dos Santos, C.N. Polyphenols Beyond Barriers: A Glimpse into the Brain. Curr. Neuropharmacol. 2017, 15, 562–594. [Google Scholar] [CrossRef] [Green Version]
- Vauzour, D.; Rodriguez-Mateos, A.; Corona, G.; Oruna-Concha, M.J.; Spencer, J.P.E. Polyphenols and Human Health: Prevention of Disease and Mechanisms of Action. Nutrients 2010, 2, 1106–1131. [Google Scholar] [CrossRef] [Green Version]
- Gao, X.; Cassidy, A.; Schwarzschild, M.A.; Rimm, E.B.; Ascherio, A. Habitual Intake of Dietary Flavonoids and Risk of Parkinson Disease. Neurology 2012, 78, 1138–1145. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Almeida, S.; Alves, M.G.; Sousa, M.; Oliveira, P.F.; Silva, B.M. Are Polyphenols Strong Dietary Agents Against Neurotoxicity and Neurodegeneration? Neurotox. Res. 2016, 30, 345–366. [Google Scholar] [CrossRef] [PubMed]
- Arai, Y.; Watanabe, S.; Kimira, M.; Shimoi, K.; Mochizuki, R.; Kinae, N. Dietary Intakes of Flavonols, Flavones and Isoflavones by Japanese Women and the Inverse Correlation between Quercetin Intake and Plasma LDL Cholesterol Concentration. J. Nutr. 2000, 130, 2243–2250. [Google Scholar] [CrossRef] [Green Version]
- dos Santos, C.N.; Menezes, R.; Carregosa, D.; Valentova, K.; Foito, A.; McDougall, G.; Stewart, D. Flavonols and Flavones. In Dietary Polyphenols; Tomás-Barberán, F.A., González-Sarrías, A., García-Villalba, R., Eds.; Wiley: Hoboken, NJ, USA, 2020; pp. 163–198. ISBN 978-1-119-56375-4. [Google Scholar]
- Maher, P.; Dargusch, R.; Bodai, L.; Gerard, P.E.; Purcell, J.M.; Marsh, J.L. ERK Activation by the Polyphenols Fisetin and Resveratrol Provides Neuroprotection in Multiple Models of Huntington’s Disease. Hum. Mol. Genet. 2011, 20, 261–270. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maher, P. Protective Effects of Fisetin and Other Berry Flavonoids in Parkinson’s Disease. Food Funct. 2017, 8, 3033–3042. [Google Scholar] [CrossRef]
- Zheng, L.T.; Ock, J.; Kwon, B.-M.; Suk, K. Suppressive Effects of Flavonoid Fisetin on Lipopolysaccharide-Induced Microglial Activation and Neurotoxicity. Int. Immunopharmacol. 2008, 8, 484–494. [Google Scholar] [CrossRef]
- Shia, C.-S.; Tsai, S.-Y.; Kuo, S.-C.; Hou, Y.-C.; Chao, P.-D.L. Metabolism and Pharmacokinetics of 3,3′,4′,7-Tetrahydroxyflavone (Fisetin), 5-Hydroxyflavone, and 7-Hydroxyflavone and Antihemolysis Effects of Fisetin and Its Serum Metabolites. J. Agric. Food Chem. 2009, 57, 83–89. [Google Scholar] [CrossRef]
- Touil, Y.S.; Auzeil, N.; Boulinguez, F.; Saighi, H.; Regazzetti, A.; Scherman, D.; Chabot, G.G. Fisetin Disposition and Metabolism in Mice: Identification of Geraldol as an Active Metabolite. Biochem. Pharmacol. 2011, 82, 1731–1739. [Google Scholar] [CrossRef] [Green Version]
- Krasieva, T.B.; Ehren, J.; O’Sullivan, T.; Tromberg, B.J.; Maher, P. Cell and Brain Tissue Imaging of the Flavonoid Fisetin Using Label-Free Two-Photon Microscopy. Neurochem. Int. 2015, 89, 243–248. [Google Scholar] [CrossRef] [Green Version]
- Pal, H.C.; Pearlman, R.L.; Afaq, F. Fisetin and Its Role in Chronic Diseases. In Anti-inflammatory Nutraceuticals and Chronic Diseases; Gupta, S.C., Prasad, S., Aggarwal, B.B., Eds.; Advances in Experimental Medicine and Biology; Springer International Publishing: Cham, Switzerland, 2016; Volume 928, pp. 213–244. ISBN 978-3-319-41332-7. [Google Scholar]
- Maher, P.; Akaishi, T.; Abe, K. Flavonoid Fisetin Promotes ERK-Dependent Long-Term Potentiation and Enhances Memory. Proc. Natl. Acad. Sci. USA 2006, 103, 16568–16573. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Patel, M.Y.; Panchal, H.V.; Ghribi, O.; Benzeroual, K.E. The Neuroprotective Effect of Fisetin in the MPTP Model of Parkinson’s Disease. J. Parkinson’s Dis. 2012, 2, 287–302. [Google Scholar] [CrossRef]
- Menezes, R.; Tenreiro, S.; Macedo, D.; Santos, C.; Outeiro, T. From the Baker to the Bedside: Yeast Models of Parkinson’s Disease. MIC 2015, 2, 262–279. [Google Scholar] [CrossRef] [PubMed]
- Manach, C.; Scalbert, A.; Morand, C.; Rémésy, C.; Jiménez, L. Polyphenols: Food Sources and Bioavailability. Am. J. Clin. Nutr. 2004, 79, 727–747. [Google Scholar] [CrossRef] [Green Version]
- Outeiro, T.F. Yeast Cells Provide Insight into Alpha-Synuclein Biology and Pathobiology. Science 2003, 302, 1772–1775. [Google Scholar] [CrossRef] [Green Version]
- Oliveira, A.V.; Vilaça, R.; Santos, C.N.; Costa, V.; Menezes, R. Exploring the Power of Yeast to Model Aging and Age-Related Neurodegenerative Disorders. Biogerontology 2017, 18, 3–34. [Google Scholar] [CrossRef]
- Pimpão, R.C.; Ventura, M.R.; Ferreira, R.B.; Williamson, G.; Santos, C.N. Phenolic Sulfates as New and Highly Abundant Metabolites in Human Plasma after Ingestion of a Mixed Berry Fruit Purée. Br. J. Nutr. 2015, 113, 454–463. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schildknecht, S.; Pöltl, D.; Nagel, D.M.; Matt, F.; Scholz, D.; Lotharius, J.; Schmieg, N.; Salvo-Vargas, A.; Leist, M. Requirement of a Dopaminergic Neuronal Phenotype for Toxicity of Low Concentrations of 1-Methyl-4-Phenylpyridinium to Human Cells. Toxicol. Appl. Pharmacol. 2009, 241, 23–35. [Google Scholar] [CrossRef] [Green Version]
- Storch, A.; Ludolph, A.C.; Schwarz, J. Dopamine Transporter: Involvement in Selective Dopaminergic Neurotoxicity and Degeneration. J. Neural Transm. 2004, 111, 1267–1286. [Google Scholar] [CrossRef] [Green Version]
- Daubner, S.C.; Le, T.; Wang, S. Tyrosine Hydroxylase and Regulation of Dopamine Synthesis. Arch. Biochem. Biophys. 2011, 508, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bezard, E.; Gross, C.E.; Fournier, M.-C.; Dovero, S.; Bloch, B.; Jaber, M. Absence of MPTP-Induced Neuronal Death in Mice Lacking the Dopamine Transporter. Exp. Neurol. 1999, 155, 268–273. [Google Scholar] [CrossRef] [PubMed]
- Macedo, D.; Tavares, L.; McDougall, G.J.; Vicente Miranda, H.; Stewart, D.; Ferreira, R.B.; Tenreiro, S.; Outeiro, T.F.; Santos, C.N. (Poly)Phenols Protect from α-Synuclein Toxicity by Reducing Oxidative Stress and Promoting Autophagy. Hum. Mol. Genet. 2015, 24, 1717–1732. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gitler, A.D.; Bevis, B.J.; Shorter, J.; Strathearn, K.E.; Hamamichi, S.; Su, L.J.; Caldwell, K.A.; Caldwell, G.A.; Rochet, J.-C.; McCaffery, J.M.; et al. The Parkinson’s Disease Protein -Synuclein Disrupts Cellular Rab Homeostasis. Proc. Natl. Acad. Sci. USA 2008, 105, 145–150. [Google Scholar] [CrossRef] [Green Version]
- Hytti, M.; Piippo, N.; Korhonen, E.; Honkakoski, P.; Kaarniranta, K.; Kauppinen, A. Fisetin and Luteolin Protect Human Retinal Pigment Epithelial Cells from Oxidative Stress-Induced Cell Death and Regulate Inflammation. Sci. Rep. 2016, 5, 17645. [Google Scholar] [CrossRef]
- Kang, K.A.; Piao, M.J.; Kim, K.C.; Cha, J.W.; Zheng, J.; Yao, C.W.; Chae, S.; Hyun, J.W. Fisetin Attenuates Hydrogen Peroxide-Induced Cell Damage by Scavenging Reactive Oxygen Species and Activating Protective Functions of Cellular Glutathione System. In Vitro Cell. Dev. Biol. Anim. 2014, 50, 66–74. [Google Scholar] [CrossRef]
- Watanabe, R.; Kurose, T.; Morishige, Y.; Fujimori, K. Protective Effects of Fisetin Against 6-OHDA-Induced Apoptosis by Activation of PI3K-Akt Signaling in Human Neuroblastoma SH-SY5Y Cells. Neurochem. Res. 2018, 43, 488–499. [Google Scholar] [CrossRef]
- Rajendran, M.; Ramachandran, R. Fisetin Protects against Rotenone-Induced Neurotoxicity through Signaling Pathway. Front. Biosci. (Elite Ed.) 2019, 11, 20–28. [Google Scholar]
- Rosado-Ramos, R.; Godinho-Pereira, J.; Figueira, I.; Jardim, C.; Garcia, G.; Menezes, R. Exploring the Benefits of Cellular Models to Uncover Bioactive Polyphenols for Neurodegeneration. Curr. Pharm. Des. 2018, 24, 2076–2106. [Google Scholar] [CrossRef]
- Chen, T.-J.; Feng, Y.; Liu, T.; Wu, T.-T.; Chen, Y.-J.; Li, X.; Li, Q.; Wu, Y.-C. Fisetin Regulates Gut Microbiota and Exerts Neuroprotective Effect on Mouse Model of Parkinson’s Disease. Front. Neurosci. 2020, 14, 549037. [Google Scholar] [CrossRef]
- Zbarsky, V.; Datla, K.P.; Parkar, S.; Rai, D.K.; Aruoma, O.I.; Dexter, D.T. Neuroprotective Properties of the Natural Phenolic Antioxidants Curcumin and Naringenin but Not Quercetin and Fisetin in a 6-OHDA Model of Parkinson’s Disease. Free Radic. Res. 2005, 39, 1119–1125. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Pu, X.-P. Neuroprotective Effect of Kaempferol against a 1-Methyl-4-Phenyl-1,2,3,6-Tetrahydropyridine-Induced Mouse Model of Parkinson’s Disease. Biol. Pharm. Bull. 2011, 34, 1291–1296. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ay, M.; Luo, J.; Langley, M.; Jin, H.; Anantharam, V.; Kanthasamy, A.; Kanthasamy, A.G. Molecular Mechanisms Underlying Protective Effects of Quercetin against Mitochondrial Dysfunction and Progressive Dopaminergic Neurodegeneration in Cell Culture and MitoPark Transgenic Mouse Models of Parkinson’s Disease. J. Neurochem. 2017, 141, 766–782. [Google Scholar] [CrossRef]
- Karuppagounder, S.S.; Madathil, S.K.; Pandey, M.; Haobam, R.; Rajamma, U.; Mohanakumar, K.P. Quercetin Up-Regulates Mitochondrial Complex-I Activity to Protect against Programmed Cell Death in Rotenone Model of Parkinson’s Disease in Rats. Neuroscience 2013, 236, 136–148. [Google Scholar] [CrossRef]
- Nagatsu, T.; Nakashima, A.; Ichinose, H.; Kobayashi, K. Human Tyrosine Hydroxylase in Parkinson’s Disease and in Related Disorders. J. Neural Transm. 2019, 126, 397–409. [Google Scholar] [CrossRef] [PubMed]
- Meireles, M.; Moura, E.; Vieira-Coelho, M.A.; Santos-Buelga, C.; Gonzalez-Manzano, S.; Dueñas, M.; Mateus, N.; Faria, A.; Calhau, C. Flavonoids as Dopaminergic Neuromodulators. Mol. Nutr. Food Res. 2016, 60, 495–501. [Google Scholar] [CrossRef]
- Murphy, D.D.; Rueter, S.M.; Trojanowski, J.Q.; Lee, V.M. Synucleins Are Developmentally Expressed, and Alpha-Synuclein Regulates the Size of the Presynaptic Vesicular Pool in Primary Hippocampal Neurons. J. Neurosci. 2000, 20, 3214–3220. [Google Scholar] [CrossRef]
- Cabin, D.E.; Shimazu, K.; Murphy, D.; Cole, N.B.; Gottschalk, W.; McIlwain, K.L.; Orrison, B.; Chen, A.; Ellis, C.E.; Paylor, R.; et al. Synaptic Vesicle Depletion Correlates with Attenuated Synaptic Responses to Prolonged Repetitive Stimulation in Mice Lacking Alpha-Synuclein. J. Neurosci. 2002, 22, 8797–8807. [Google Scholar] [CrossRef] [Green Version]
- Perez, R.G.; Waymire, J.C.; Lin, E.; Liu, J.J.; Guo, F.; Zigmond, M.J. A Role for Alpha-Synuclein in the Regulation of Dopamine Biosynthesis. J. Neurosci. 2002, 22, 3090–3099. [Google Scholar] [CrossRef]
- Wersinger, C.; Sidhu, A. Attenuation of Dopamine Transporter Activity by α-Synuclein. Neurosci. Lett. 2003, 340, 189–192. [Google Scholar] [CrossRef]
- Lee, F.J.S.; Liu, F.; Pristupa, Z.B.; Niznik, H.B. Direct Binding and Functional Coupling of α-Synuclein to the Dopamine Transporters Accelerate Dopamine-Induced Apoptosis. FASEB J. 2001, 15, 916–926. [Google Scholar] [CrossRef]
- Jeannotte, A.M.; Sidhu, A. Regulation of the Norepinephrine Transporter by α-Synuclein-Mediated Interactions with Microtubules: Regulation of NET by α-Synuclein. Eur. J. Neurosci. 2007, 26, 1509–1520. [Google Scholar] [CrossRef] [PubMed]
- Brás, I.C.; Outeiro, T.F. Alpha-Synuclein: Mechanisms of Release and Pathology Progression in Synucleinopathies. Cells 2021, 10, 375. [Google Scholar] [CrossRef] [PubMed]
- Masuda, M.; Suzuki, N.; Taniguchi, S.; Oikawa, T.; Nonaka, T.; Iwatsubo, T.; Hisanaga, S.; Goedert, M.; Hasegawa, M. Small Molecule Inhibitors of α-Synuclein Filament Assembly †. Biochemistry 2006, 45, 6085–6094. [Google Scholar] [CrossRef] [PubMed]
- Griffioen, G.; Duhamel, H.; Van Damme, N.; Pellens, K.; Zabrocki, P.; Pannecouque, C.; van Leuven, F.; Winderickx, J.; Wera, S. A Yeast-Based Model of Alpha-Synucleinopathy Identifies Compounds with Therapeutic Potential. Biochim. Biophys. Acta 2006, 1762, 312–318. [Google Scholar] [CrossRef] [PubMed]
- Vepsäläinen, S.; Koivisto, H.; Pekkarinen, E.; Mäkinen, P.; Dobson, G.; McDougall, G.J.; Stewart, D.; Haapasalo, A.; Karjalainen, R.O.; Tanila, H.; et al. Anthocyanin-Enriched Bilberry and Blackcurrant Extracts Modulate Amyloid Precursor Protein Processing and Alleviate Behavioral Abnormalities in the APP/PS1 Mouse Model of Alzheimer’s Disease. J. Nutr. Biochem. 2013, 24, 360–370. [Google Scholar] [CrossRef]
- Tenreiro, S.; Rosado-Ramos, R.; Gerhardt, E.; Favretto, F.; Magalhães, F.; Popova, B.; Becker, S.; Zweckstetter, M.; Braus, G.H.; Outeiro, T.F. Yeast Reveals Similar Molecular Mechanisms Underlying Alpha- and Beta-Synuclein Toxicity. Hum. Mol. Genet. 2016, 25, 275–290. [Google Scholar] [CrossRef]
- Tenreiro, S.; Reimão-Pinto, M.M.; Antas, P.; Rino, J.; Wawrzycka, D.; Macedo, D.; Rosado-Ramos, R.; Amen, T.; Waiss, M.; Magalhães, F.; et al. Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson’s Disease. PLoS Genet. 2014, 10, e1004302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Macedo, D.; Jardim, C.; Figueira, I.; Almeida, A.F.; McDougall, G.J.; Stewart, D.; Yuste, J.E.; Tomás-Barberán, F.A.; Tenreiro, S.; Outeiro, T.F.; et al. (Poly)Phenol-Digested Metabolites Modulate Alpha-Synuclein Toxicity by Regulating Proteostasis. Sci. Rep. 2018, 8, 6965. [Google Scholar] [CrossRef]
- Ushikubo, H.; Tanimoto, Y.; Abe, K.; Asakawa, T.; Kan, T.; Akaishi, T. 3,3′,4′,5′-Tetrahydroxyflavone Induces Formation of Large Aggregates of Amyloid β Protein. Biol. Pharm. Bull. 2014, 37, 748–754. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bieschke, J.; Russ, J.; Friedrich, R.P.; Ehrnhoefer, D.E.; Wobst, H.; Neugebauer, K.; Wanker, E.E. EGCG Remodels Mature Alpha-Synuclein and Amyloid-Beta Fibrils and Reduces Cellular Toxicity. Proc. Natl. Acad. Sci. USA 2010, 107, 7710–7715. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, H.-J.; Shin, S.Y.; Choi, C.; Lee, Y.H.; Lee, S.-J. Formation and Removal of α-Synuclein Aggregates in Cells Exposed to Mitochondrial Inhibitors. J. Biol. Chem. 2002, 277, 5411–5417. [Google Scholar] [CrossRef] [Green Version]
- Yoon, Y.-S.; Ahn, W.J.; Ricarte, D.; Ortiz, D.; Shin, C.Y.; Lee, S.-J.; Lee, H.-J. Alpha-Synuclein Inclusion Formation in Human Oligodendrocytes. Biomol. Ther. 2021, 29, 83–89. [Google Scholar] [CrossRef] [PubMed]
- Scholz, D.; Pöltl, D.; Genewsky, A.; Weng, M.; Waldmann, T.; Schildknecht, S.; Leist, M. Rapid, Complete and Large-Scale Generation of Post-Mitotic Neurons from the Human LUHMES Cell Line: LUHMES as Widely Applicable Neuronal Model System. J. Neurochem. 2011, 119, 957–971. [Google Scholar] [CrossRef]
- Krug, A.K.; Gutbier, S.; Zhao, L.; Pöltl, D.; Kullmann, C.; Ivanova, V.; Förster, S.; Jagtap, S.; Meiser, J.; Leparc, G.; et al. Transcriptional and Metabolic Adaptation of Human Neurons to the Mitochondrial Toxicant MPP+. Cell Death Dis. 2014, 5, e1222. [Google Scholar] [CrossRef]
- Menezes, R.; Foito, A.; Jardim, C.; Costa, I.; Garcia, G.; Rosado-Ramos, R.; Freitag, S.; Alexander, C.J.; Outeiro, T.F.; Stewart, D.; et al. Bioprospection of Natural Sources of Polyphenols with Therapeutic Potential for Redox-Related Diseases. Antioxidants 2020, 9, 789. [Google Scholar] [CrossRef]
Gene | Nomenclature | Sequence |
---|---|---|
TH | Tyrosine hydroxylase | Fwd 1: AGCCCTACCAAGACCAGACG Rev 1: GCGTGTACGGGTCGAACTT |
DAT | Dopamine transporter | Fwd: ACCTTCCTCCTGTCCCTGTT Rev: CACCATAGAACCAGGCCACT |
SNCA | Alpha-synuclein | Fwd:AGTGACAAATGTTGGAGGAG Rev: GCTTCAGGTTCGTAGTCTTG |
HPTR1 | Hypoxanthine phosphoribosyltransferase 1 | Fwd: CCTGGCGTCGTGATTAGTGA Rev: CGAGCAAGACGTTCAGTCCT |
GAPDH | Glyceraldehyde 3-phosphate dehydrogenase | Fwd: AGAAGGCTGGGGCTCATTTG Rev: AGGGGCCATCCACAGTCTTC |
B2M | β2 microglobulin | Fwd: GGCTATCCAGCGTACTCCAA Rev: ACCAGTCCTTGCTGAAAGACAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rosado-Ramos, R.; Godinho-Pereira, J.; Marques, D.; Figueira, I.; Fleming Outeiro, T.; Menezes, R.; Nunes dos Santos, C. Small Molecule Fisetin Modulates Alpha–Synuclein Aggregation. Molecules 2021, 26, 3353. https://doi.org/10.3390/molecules26113353
Rosado-Ramos R, Godinho-Pereira J, Marques D, Figueira I, Fleming Outeiro T, Menezes R, Nunes dos Santos C. Small Molecule Fisetin Modulates Alpha–Synuclein Aggregation. Molecules. 2021; 26(11):3353. https://doi.org/10.3390/molecules26113353
Chicago/Turabian StyleRosado-Ramos, Rita, Joana Godinho-Pereira, Daniela Marques, Inês Figueira, Tiago Fleming Outeiro, Regina Menezes, and Cláudia Nunes dos Santos. 2021. "Small Molecule Fisetin Modulates Alpha–Synuclein Aggregation" Molecules 26, no. 11: 3353. https://doi.org/10.3390/molecules26113353
APA StyleRosado-Ramos, R., Godinho-Pereira, J., Marques, D., Figueira, I., Fleming Outeiro, T., Menezes, R., & Nunes dos Santos, C. (2021). Small Molecule Fisetin Modulates Alpha–Synuclein Aggregation. Molecules, 26(11), 3353. https://doi.org/10.3390/molecules26113353