Search Results (2)

Background/Objectives: Species within section Chrysantha represent the only camellias known to produce golden-yellow petals. The primary objectives of this study were to characterize the chloroplast genome structure of Camellia tianeensis and to elucidate its phylogenetic position with sect. Chrysantha. Methods: The complete chloroplast genome of C. tianeensis was sequenced, assembled, and annotated. Phylogenetic inference was conducted using maximum likelihood and Bayesian methods based on complete chloroplast genomic sequences. Results: The chloroplast genome of C. tianeensis is 156,865 bp in length and exhibits a typical quadripartite structure consisting of a large single-copy (LSC) region (86,579 bp), a small single-copy (SSC) region (18,236 bp), and two inverted repeat (IR) regions (26,025 bp each). The genome encodes 164 genes, including 111 protein-coding genes, 45 tRNAs, and 8 rRNA genes. The overall GC content was 37.32%, with regional values of 35.33% (LSC), 30.59% (SSC), and 42.99% (IRs). Sixty-nine simple sequence repeats (SSRs) were identified, predominantly mononucleotide repeats, Thirty-eight dispersed repeats were categorized into three types (forward, reverse, and palindromic), with no complement repeats detected. Phylogenetic analysis strongly supported that C. tianeensis is a member within sect. Chrysantha. Conclusions: C. tianeensis is phylogenetically closely related to C. huana, forming a well-supported clade. This study enhances the molecular research available for sect. Chrysantha and provides a genomic foundation for future phylogenetic and taxonomic studies in this group. Full article

In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes. Full article