Next Article in Journal
The Measurement of Food Insecurity in High-Income Countries: A Scoping Review
Previous Article in Journal
Cooking, Shopping, and Eating Behaviors of African American and Hispanic Families: Implications for a Culturally Appropriate Meal Kit Intervention
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterisation of Bacterial Isolates from Infected Post-Operative Patients in a Malaysian Tertiary Heart Care Centre

1
School of Health Science, International Medical University, Kuala Lumpur 57000, Malaysia
2
School of Medicine, International Medical University, Kuala Lumpur 57000, Malaysia
3
Institut Jantung Negara, Kuala Lumpur 50400, Malaysia
4
School of Pharmacy, International Medical University, Kuala Lumpur 57000, Malaysia
*
Author to whom correspondence should be addressed.
Int. J. Environ. Res. Public Health 2021, 18(18), 9828; https://doi.org/10.3390/ijerph18189828
Submission received: 17 August 2021 / Revised: 7 September 2021 / Accepted: 8 September 2021 / Published: 17 September 2021

Abstract

Several bacterial species cause post-operative infections, which has been a critical health concern among hospital patients. Our study in this direction is a much-needed exploratory study that was carried out at the National Heart Institute (IJN) of Malaysia to examine the virulence properties of causative bacteria obtained from postoperative patients. The bacterial isolates and data were provided by the IJN. Antibiotic resistance gene patterns, and the ability to form biofilm were investigated for 127 isolates. Klebsiella pneumoniae (36.2%) was the most common isolate collected, which was followed by Pseudomonas aeruginosa (26%), Staphylococcus aureus (23.6%), Streptococcus spp. (8.7%) and Acinetobacter baumannii (5.5%). There were 49 isolates that showed the presence of multidrug resistance genes. The mecA gene was surprisingly found in methicillin-susceptible S. aureus (MSSA), which also carried the ermA gene from those erythromycin-susceptible strains. The phenotypic antibiotic resistance profiles varied greatly between isolates. Findings from the biofilm assay revealed that 44 of the 127 isolates demonstrated the ability to produce biofilms. Our findings provide insights into the possibility of some of these bacteria surviving under antibiotic stress, and some antibiotic resistance genes being silenced.

1. Introduction

Post-operative infections constitute a major problem among post-surgical patients, and they are one of the most frequently reported healthcare-associated infections all over the world. More than 30% of health-acquired infections are post-operative infections [1]. Most of the infections are usually caused by endogenous infections, which are derived from microorganisms that are already present in the patient’s body [2,3]. It is well-known that distinct microbiota compositions are observed in different skin sites in humans [4,5]. However, the causative agents may also originate from exogenous factors such as unclean operating rooms and infected surgical instruments [3]. Unsurprisingly the isolated causative agents (either endogenous or exogenous microorganisms) were mostly reported with bacteria, such as Staphylococcus aureus, Klebsiella pneumoniae, coagulase-negative staphylococci and Enterococcus species [6,7,8].
Post-operative infections after a heart surgery particularly, deep sternal site infections and mediastinitis, increases the rate of morbidity, mortality, and cost. The mediastinitis treatment requires more than 2 weeks additional hospital stay, as reported by Hollenbeak et al. [9]. The proportion of cardiovascular patients at high risk for post-operative infection is increasing due to a growing number of elderly patients who undergo cardiac surgery re-operation. Staphylococci is the predominant pathogen among Gram-positive bacteria isolated in patients with infection at the venous graft harvesting sites after a coronary artery bypass graft and also in patients with mediastinitis [10]. These pathogens play an important role in intraoperative wound contamination by infecting the sternotomy wounds during the long time intervals in open-heart surgery. Consequently, meticulous care and excessive medical supplies such as local blood supply, nutrition, and immunological support services are needed.
As might be expected, the severity of postoperative infections is always associated with prolonged use of invasive medical devices, as well as the long-term hospitalisations in intensive care units (ICU) and hospital wards [11]. In addition, the prolonged use and administration of antibiotics with inappropriate dosing have also resulted in developing resistance towards drugs [12,13,14]. Several studies conducted in certain countries have found the issue of improper use of antibiotics, which is prevalent among healthcare institutions [15,16,17]. All these factors could potentially contribute to the emergence of resistant bacterial strains. The problem of bacterial resistance towards multiple drugs was detected from the clinical isolates, where it comes to the paradigm of intraspecies or interspecies dissemination of antibiotic resistance genes. According to the Centers for Disease Control (CDC), a multidrug-resistant organism is defined as a microorganism that is resistant to one or more classes of antimicrobial agents [18]. Noordin et al. collected 318 MRSA isolates from various hospitals in Malaysia and reported that a number of strains from the total isolates were resistant to gentamicin, ciprofloxacin and erythromycin [19]. Moreover, in another study from Malaysia, researchers revealed the emergence of Gram-negative bacterial isolates that were resistant to multiple classes of antibiotics. For instance, Acinetobacter baumannii strains that were observed in a tertiary-care centre in Terengganu (Malaysia), were resistant to more than three types of antibiotic classes and a total of 72.2% were multidrug-resistant. A study conducted by Low et al., found that 39 isolates of K. pneumoniae were classified as multidrug-resistant and most of them showed high resistance towards polymyxin [20,21]. Furthermore, a study conducted in Malaysia showed that three multidrug-resistant strains of Pseudomonas aeruginosa possessing MBL genes (blaIMP, blaVIM and blaNDM) showed multidrug resistance to carbapenem, aminoglycosides, cephalosporin, fluoroquinolone and β- lactamase inhibitor (ticarcillin-clavulanic acid) [22].
Biofilm-producing isolates have been a challenging problem in post-operative infections. During hospitalization, patients are exposed to a pathogen-rich environment, thereby increasing the risk of infections. Healthcare workers should raise more awareness on biofilm-producing isolates to minimise the risk of postoperative infections. This is crucial because biofilm-producing strains of bacteria are more problematic than non-biofilm-producing bacteria, due to the ability of the former to secrete extracellular polymeric substances (EPSs) [23]. These EPSs could protect the bacteria by enabling them to resist the attack of antibiotics and host defences [24]. There are several notable reports where the findings have demonstrated that biofilm producers may increase their resistance towards routine surgical preparation protocols such as skin preparation and antisepsis procedures [25,26,27]. In a study conducted by Howard et al., biofilm producer strains of A. baumannii were identified as a threat to cause postoperative infections due to their ability to become an opportunistic nosocomial pathogen [28]. Additionally, there were several studies indicating that the majority of the bacteria in biofilms were detected from the genera of Staphylococcus and Acinetobacter and they were considered as the most common biofilm producers [29,30,31]. A number of studies conducted in Malaysian hospitals also identified that biofilm-forming bacteria were associated with several problems during the treatment of extremely drug-resistant P. aeruginosa infections [32,33,34]. Consequently, the increased resistance of biofilm-associated bacterial strains towards cephalosporins and carbapenem could lead physicians to depend on colistin. This drug has been the last-resort antibiotic, which was widely used previously but discontinued in the 1980s as it caused kidney and neurological problems [35,36]. Vuotto et al. also found that the biofilm-forming K. pneumoniae strains isolated from medical devices had developed resistance towards amikacin, ciprofloxacin and piperacillin [37].
Despite having numerous investigators who have studied a range of bacterial isolates collected from different healthcare settings in Malaysia, the availability of general data on the characteristics of causative agents with regard to cardiovascular diseases is still meagre. To address these gaps, this study was conducted to explore the characteristics of S. aureus, K. pneumoniae, A. baumannii, P. aeruginosa and Streptococcus spp. that were isolated from the National Referral Centre for Cardiovascular Disease. The study primarily was focused on profiling the phenotypic and genotypic antimicrobial resistance in such pathogens. Moreover, we further examined the ability of these organisms to form biofilms. The findings from this study may help understand the resistance traits of the above-mentioned bacteria in greater detail. This may further assist in strategizing the postoperative infectious disease management plan for biofilm-related infections and multiple drug resistant bacterial isolates.

2. Materials and Methods

2.1. Bacterial Strains

A total of 30 S. aureus, 46 K. pneumoniae, 7 A. baumannii, 33 P. aeruginosa and 11 Streptococcus isolates were kindly provided by the National Heart Institute (IJN) of Malaysia at Kuala Lumpur. These bacterial strains were sampled from blood, wound and respiratory specimens of postoperative patients with cardiovascular diseases. All the pure bacterial cultures were stored at −70 °C in 20% glycerol after being allowed to grow at 37 °C in brain heart infusion (BHI) broth for 24 h.

2.2. Ethics

This study was approved by the respective research ethics board, and committees of IJN as each of these isolates was accompanied by patient data that included age, gender, hospital/community acquisition, and the infection source. In addition, the IJN had also provided antimicrobial susceptibility testing provisions for up to 35 antimicrobial agents. All authors ensured that every data, such as the patient profile and medical records, were strictly used only for research purposes, and strict confidentiality was maintained.

2.3. DNA Extraction

DNA was extracted from all the isolates with PrestoTM Mini gDNA Bacteria Kit (Geneaid Biotech Ltd., New Taipei City, Taiwan) following the manufacturer’s instructions. The quantity and quality of the extracted DNA were determined by Tecan NanoQuant plate infinite F200 (Tecan Group Ltd., Männedorf, Switzerland).

2.4. Polymerase Chain Reaction Amplification (PCR) of Resistance Genes

PCR analyses were performed by using an exTEN 2 × PCR Master Mix (Axil Scientific Pte Ltd., Singapore) with its PCR primers and programme to screen the antibiotic resistance genes, as shown in Table 1. The PCR products were separated and analysed on a 1.4% agarose gel electrophoresis that was stained with Midori Green Advance (ca. 0.8%) (Nippon Genetics Europe, Düren, Germany). K. pneumoniae ATCC BAA-1705, K. pneumoniae M48000, S. aureus ATCC 4330, and Enterococcus faecalis ATCC 51299 were used as control strains for genotypic screening of certain antibiotic resistance genes. Clinical resistant bacterial isolates that harboured the genetic determinants of antibiotic resistance were used as positive controls if there were no reference strains that served as control.

2.5. Biofilm Formation Assay

The ability of all the 127 bacterial isolates to form biofilms was evaluated by the method described by Stepanović et al. [53]. The method essentially utilized crystal violet to identify those bacteria, which attached firmly onto the polystyrene surface of a 96-well flat-bottomed microplate. Briefly, the overnight-maintained bacterial culture was diluted with TBS, which contained 1% glucose with a factor of 1:100. All the diluted suspensions (200 μ L) were incubated in a 96-well microplate for 24 h at 37 °C without shaking. After that, the contents of each well were washed 3 times with water under vigorous shaking. The adherent bacteria were fixed with 200   μ L of 99% methanol for 15 min. Subsequently, the microplates were emptied and were left to dry. The adherent bacteria in each well were then stained with 0.2 mL of crystal violet (2%) for 5 min followed by rinsing with water prior to air-drying. After that, 160 μ L of 33% glacial acetic acid was added into each well to solubilize the adherent bacteria. The OD570 of each well was determined by a Spectramax M3 spectrophotometer (Molecular Devices, USA). S. aureus ATCC 43300 was used as a positive control, whereas negative control wells contained the TBS medium only. The cut-off OD (ODC) was expressed as 3 standard deviations above the mean OD570 of the negative control. The biofilm producers were categorized as below:
OD ≤ ODC     non-adherent
ODC < OD ≤ 2 × ODC     weakly adherent
2 × ODC < OD≤ 4 × ODC     moderately adherent
4 × ODC < OD     strongly adherent

3. Results

3.1. Clinical Samples Detail

All the isolates were collected from postoperative infected patients (69.3% males and 30.7% females) in clinical wards of the IJN between March 2019 and June 2019. The average ages of patients were between 61 and 70 years (range of 1–88 years). Overall, 41 of the total 127 bacterial isolates contained Gram-positive bacteria, and the remaining contained Gram-negative organisms. Few isolates contained Gram-positive bacteria such as Streptococcus species, which were frequently identified as S. dysgalactiae subspecies equisimillis (SDSE) and S. agalactiae. Majority of the isolates were found to have originated from blood specimens (60.0%) followed by tracheal aspirates 21.3%; pus/wounds, 17.3%; tissue, 2.4%; bronchial, 1.6%; urine, 0.79% and sputum, 0.79% as shown in Table 2. Notably, it was observed that the isolated P. aeruginosa were mostly from respiratory tract samples compared to wounds. There were 70% of the respiratory tract samples identified as P. aeruginosa.

3.2. Antibiotic Resistance Characteristics of Clinical Isolates

According to the resistance genotype, it was interesting to note that 47.3% of MSSA strains, which supposedly do not harbour the mecA gene, were found to co-carry the antibiotic resistance genes, mecA and ermA. Meanwhile, there was no ermB gene detected in MSSA. In this study, both ermC and tetM genes were also detected in the MSSA, and there were 68.4% of MSSA carrying the aacA-aphD gene. Unsurprisingly, the mecA gene was detected in all MRSA isolates and these isolates were resistant to oxacillin, which also co-carried ermC genes, tetM, as well as aacA-aphD (36.4%). None of the S. aureus strains were detected with mcr-1, mef(A), mef(E), msrA, tetK, vanA and vanB genes. In contrast, there was one isolate of K. pneumoniae, which was found to carry the mcr-1 gene among all the isolated bacteria. The co-carriage of blaCTX-M and blaSHV genes was also detected in all K. pneumoniae isolates but with the absence of blaKPC-2, blaIMP, blaSPM-1, blaOXA-24 genes.
As listed in Table 3 and Table S1, 28.6% of A. baumannii isolates harbored the pmrA and blaGES genes, respectively, while six of the seven A. baumannii isolates carried the blaSHV gene. The presence of the pmrA genes was rare in these clinical isolates. Similarly, the mcr-1, blaSPM-1, blaOXA-24 and blaOXA-58 genes were not detected in any of the seven isolates of A. baumannii. Among the ESBL genes, blaCTX-M was detected in all the P. aeruginosa isolates and the blaSHV gene was found in 93.9% of the isolates. Surprisingly, more than half of P. aeruginosa isolates showed the presence of the blaOXA-23 gene. All the P. aeruginosa isolates were blaOXA-24 and blaOXA-58 negative. Similarly, both the blaOXA-24 and blaOXA-58 genes were not detected in A. baumannii isolates as well. However, a low prevalence of the blaOXA-58 gene was observed in 6.5% of K. pneumoniae isolates. It was observed that 45.5% of Streptococcus spp. isolates carried the ermB gene but not ermA and ermC genes. Both the tetK and mef(A) genes were detected in several Streptococcus species (see Supplementary Table S1). In addition, the presence of tetM gene was presumptively found in 81.8% of Streptococcus spp. and 8 out of 11 of them carried the pmrA gene.
In this study, the high rate of MDR was most predominant in the patient’s tracheal samples with 46.9% among the MDR strains. In contrast, many non-MDR strains were originated from blood specimens with 42.3%.
According to the antimicrobial susceptibility testing (AST) data, 49 out of 127 isolates demonstrated phenotypically resistant traits to at least three antibiotic classes, which are in accordance with the multidrug-resistant criteria (Supplementary Table S1). Based on the data, it was also noted that a total of 19 S. aureus isolates were identified as MSSA, and 11 isolates were recognized as MRSA (as shown in Table 4). As expected, all MRSA strains were resistant to benzylpenicillin and oxacillin. Both MSSA and MRSA strains were susceptible to quinupristin/dalfopristin, linezolid, vancomycin, tigecycline and nitrofurantoin. Among the S. aureus isolates, MRSA had higher rates of resistance towards antibiotics compared to MSSA. For other Gram-positive bacteria, such as Streptococcus species, there was no significant susceptibility data available as routine screening for antimicrobial susceptibility was unnecessary for them. Only 3 of the 11 Streptococcus isolates were subjected to AST, which showed resistance to clindamycin and tetracycline.
For Gram-negative bacteria, the phenotypic resistance analysis revealed that 46 (100%) of the K. pneumoniae isolates were susceptible to amikacin and 2 (4.3%) were shown to have resistance phenotype to carbapenem (such as imipenem and meropenem). Some of the K. pneumoniae isolates (32.6%) were susceptible for cefazolin, and it was noted that 37% of them had susceptibility towards levofloxacin. In contrast, more than half of the total number of isolates of A. baumannii and P. aeruginosa, demonstrated susceptibility to levofloxacin. P. aeruginosa isolates showed high percentages of susceptibility (>70%) to the majority of the tested antibiotics, including imipenem, meropenem, ceftazidime, cefepime and levofloxacin as shown in Table 4. In this present study, the rate of non-susceptibility among A. baumannii isolates was as follows: 100% (n = 7) for cefazolin, 42.9% (n = 3) for tobramycin, ampicillin/sulbacyam, piperacillin/tazobactam, imipenem, meropenem, ceftazidime, cefepime, ciprofloxacin and levofloxacin, and 28.6% (n = 2) for trimethoprim/sulfamethoxazole. Some of the A. baumannii isolates sampled from the tracheal aspirates showed a similar antimicrobial susceptibility pattern to those from the bronchial aspirate, blood specimens and wounds (Table S1). However, two of A. baumannii isolates from bronchial aspirate and tracheal aspirate were resistant to all tested antibiotics by the IJN. It was also observed that ceftriaxone and levofloxacin only possessed intermediate effectiveness against A. baumannii isolates.

3.3. Ability of Biofilm Formation

In biofilm assays, 44 out of 127 isolates were categorized as biofilm producers. Among them, 11.3% were strong biofilm producers. Furthermore, 12 of the 44 biofilm producers showed moderate biofilm production and the remaining 27(61.4%) demonstrated weak biofilm production. Importantly, 31.8% of biofilm producers carried multiple antibiotic resistance genes. The percentage ability in forming biofilms among the MDR isolates was as follows: 57.1% for weak biofilm producers; 28.8% for moderate biofilm producers and 14.3% for strong biofilm producers. Interestingly, there were two strong biofilm producers identified as multidrug-resistant strains according to their phenotypic resistance profiles. Both were resistant to cefazolin, ceftazidime and cefepime. Further details of each biofilm producer are summarised in Supplementary Table S1.

4. Discussion

The rising incidence of microbial resistance to antibiotics has caused considerable challenges in the management of postoperative infections due to the lack of effective therapeutic options. This rise in incidence has been leading to increased morbidity and mortality rates in postoperative infections, prolonged hospital stays and consequently higher management costs. The majority of the causative agents associated with postoperative infections are the ESCAPE (Enterococcus faecium, Staphylococcus aureus, Clostridium difficille, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacteriaceae species) group of pathogens [54]. These organisms are capable to ‘escape’ antibacterial actions of the current range of antibiotics. In addition, some of them are normal flora to humans and may acquire antibiotic resistance elements via inter- or intraspecies gene transfer between them. Meanwhile, misuse of antibiotics has also caused enormous damage in aggravating antimicrobial resistance, which now seems to develop faster than usual.
Unlike previous reports [55,56,57], which stated that the majority of postoperative infections are caused by S. aureus, our study showed that most of the cardiac surgery patients were prone to severe postoperative infections caused by K. pneumoniae. This observation was consistent with the findings from Hope et al. [58]. Besides, another study also reported that K. pneumoniae was one of the leading isolates in postoperative infections, which accounted for 50% cases, followed by S. aureus (27.8%) [59]. In the present study, we found that K. pneumoniae was the most predominant organism, which caused postoperative infections in 36.2% of subjects, followed by P. aeruginosa (26%), paralleling with the study-findings reported by Ali et al. [60]. Ali et al. stated that superficial incisional surgical site infections, which were the most common type of postoperative infections in surgical patients, were predominantly caused by K. pneumoniae [60]. The virulence factor of K. pneumoniae might be the possible explanation for the high number of K. pneumoniae infection contributors in our study. The outer layer of K. pneumoniae inhibits phagocytosis by reducing the amount of complement component 3 (C3) that binds to the surface of K. pneumoniae, as demonstrated by Guadalupe et al. [61]. Therefore, most of the polymorphonuclear cells lack the killing efficacy when K. pneumoniae was not opsonised by C3. Similarly, P. aeruginosa was also shown to be able to evade the host immunity (especially in those who are immunosuppressed and are hospitalized) via its slime production, which prevents the complement components deposition that commonly leads to phagocytosis [62,63,64]. Therefore, P. aeruginosa was identified as the second most dominant causative bacteria isolated from our study, which was followed by S. aureus. It is not surprising that S. aureus is one of the isolates harvested from these patients because it is well-known as an opportunistic bacterium associated with bacteraemia and surgical site infection. In contrast, only 11 isolates of Streptococcus spp. were collected from cases of postoperative infection. All these streptococcal isolates were isolated from blood specimens, where 81.8% of them were beta-haemolytic streptococcus. The low number of Streptococcus spp. in our total specimens is consistent with the study conducted by Chaudhary et al. [55] in a surgical ward of Bharatour Hospital, Chitwan, Nepal, which reported only 1.5% of Streptococcus spp. as observed under surgical site infections.
In the present study, the antibiotic susceptibility data were compared with the antibiotic resistance gene patterns in S. aureus, K. pneumoniae, A. baumanni, P. aeruginosa and Streptococcus spp. isolates. To our knowledge, this is the first report of bacterial genotypic and phenotypic antibiotic resistance patterns from our local heart specialist institution IJN. The antibiotic susceptibility results showed a high resistance rate among the K. pneumoniae isolates to ampicillin/sulbactam (69.6%), which is the highest among all the conventional antibiotics. All K. pneumoniae isolates were found to be positive to blaCTX-M and blaSHV as confirmed by PCR studies, unlike the report of Kiratisin et al., which stated that the majority of K. pneumoniae (99.2%) carried the blaCTX-M gene while 87.4% of ESBL-producing K. pneumoniae carried the blaSHV gene [65]. The combined presence of three ESBL genes (blaCTX-M, blaGES and blaSHV) in the same K. pneumoniae isolates were 80.4%. In contrast, a low percentage of multiple ESBL genes in ESBL-producing K. pneumoniae was reported in the findings from Mohsen et al. (28%) and Apisarnthanarak et al. (24%) [66,67]. Although all the K. pneumoniae isolates harboured the blaSHV gene that was responsible for cephalosporin resistance, some of the K. pneumoniae isolates were still susceptible to cefepime (41.3%), ceftriaxone (37.0%), cefazolin (32.6%) and ceftazidime (34.8%). There was another study, which demonstrated that, the absence of cephalosporin phenotypic properties in the blaSHV gene-carrying K. pneumoniae isolates could be caused by the growth conditions and environment of the bacteria. Changes in the growth conditions may affect the bacteria’s physiological adaptations, resulting in changes in its metabolic process [68]. The regulatory proteins of bacteria are always controlled by nutrient availability and its metabolites. In K. pneumoniae, some of the amino acids were found to bind to the repressors, which in turn had bound to the regulatory sites on DNA, which resulted in blaSHV gene suppression.
As expected, a total of 11 (36.7%) S. aureus isolates were found to be methicillin-resistant strains (MRSA), where all of them were resistant to benzylpenicillin and oxacillin. Interestingly, 9 of the MSSA strains, which were susceptible to oxacillin also contained the gene, which confers resistance to oxacillin, called mecA. This means some staphylococcal isolates could still be killed by oxacillin, despite the presence of mecA. Similarly, Proulx et al. revealed a similar finding where they concluded that this phenomenon may be due to genetically inactivated mecA in MSSA. This phenomenon is called silencing of antibiotic resistance by mutation (SARM). SARM results in non-functional antibiotic resistance protein as mutation is found at its genetic coding region, which affects its transcription or translation functionalities [57]. Other than the mecA gene, some of the MSSA isolates, which expressed its erythromycin susceptible phenotype, were found to harbour the ermA and ermC genes. Supposedly, the erm genes encode the erythromycin-resistance methyltransferase to initiate the ribosomal RNA methylation. The methylation of ribosomal RNA will inhibit erythromycin-binding resulting in MSSA resistance to erythromycin [69]. Similar observations were reported by Zmantar et al. [70] and Sekiguchi et al. where they had reported the absence of the resistance phenotype towards erythromycin in isolates, in spite of the presence of erm genes [71] Sekiguchi et al. suggested that there might be a mutational event in the coding or promoter region of the erm gene, which was carried by S. aureus strains as evidenced via PCR analysis [71]. In addition to the ermA or ermC gene, the presence of the ermB gene was also detected in this study for S. aureus; but only 3.3%, which corroborates with the findings of Eady et al. in clinical S. aureus isolates [72].
Infection with multidrug-resistant bacteria has been associated with significant morbidity and mortality. In this study, we found that the prevalence of multidrug-resistant (MDR) strains was 38.6% (49 out of 127 isolates), which is a significant proportion that can affect the treatment of patients with postoperative infections. Cefazolin showed the highest resistance rate (81.6%) among the multidrug-resistant isolates. Another study conducted at a national hospital in an East African country depicted a much higher rate of MDR (63%) among the pathogens that caused postoperative infections [73]. Among MDR P. aeruginosa, piperacillin exhibited the highest resistance pattern (100%). Furthermore, Tavajjohi et al. also reported that 89.3% of MDR P. aeruginosa isolates in their study were resistant to piperacillin. [74] Multidrug-resistant status is one of the significant determinants of hospital mortality. Hospital-acquired infections associated with P. aeruginosa and A. baumannii were 8.4% in the study conducted by Motbainor et al. [75]. All the isolates of MDR P. aeruginosa and A. baumannii were resistant to cefazolin and six of the nine MDR P. aeruginosa isolates were resistant to piperacillin/tazobactam. The cefazolin resistance rate was found to be lower compared to the report from Northwest Ethiopia [75]. Most recently, a study has shown that the presence of the blaKPC-2 gene in P. aeruginosa could be associated with its susceptibility to ceftazidime-avibactam by increasing the minimum inhibitory concentration value [76]. In the present study, 27.3% of P. aeruginosa were revealed to be resistant to ceftazidime. The high number of MDR among P. aeruginosa and A. baumannii observed in postoperative patients in IJN was probably related to cross-contamination of these bacteria in the hospital environment or some other unknown factors, which is not the focus of this present study.
From the 127 bacterial isolates screened for biofilm formation, 44 of them were detected to be biofilm producers. This feature may contribute to the development of antibiotic resistance and plays an important role in evading the effect of immune defense mechanism. K. pneumoniae 13 (28.2%), P. aeruginosa 11(33.3%), S. aureus 9 (30%), Streptococcus spp. 6 (54.5%), and A. baumannii 5 (71.4%) were among the leading biofilm producers as found in this study. However, the number of biofilm producers that were found in this study was not as high as in the study reported by Barsoumian et al., which reported 60.4% of biofilm producers detected in clinical samples [77]. Biofilms could be an important concern since there are studies that showed that biofilms play a key role in bacterial transmissions in different areas of a hospital. These may also include the cross-transmission of bacteria within a clinical setting or high-contact equipment items such as stethoscopes, ventilators, and phones. Healthcare workers, especially with poor hand hygiene, may be responsible for further environmental contamination as they work across different patient zones every day [78,79]. Besides, horizontal gene transfer, which is the process for antibiotic resistance gene interchange, frequently happens in biofilms [80]. This causes genetic variation in bacteria, consequently resulting in superbug infection-bacteria development. Several studies have revealed that the rate of horizontal gene transfer of antibiotic-resistant genes is typically higher in the biofilm community compared to those in planktonic cultures [81,82]. Hence, biofilm is believed to be the main antibiotic-resistant gene reservoir for genetic exchange among bacterial species. Nevertheless, the biofilm data in our study is non-conclusive to confirm if the detected MDR strains as aforementioned were a consequence of the presence of these biofilm producers.

5. Conclusions

Taken together, the findings of this present study could further guide and advance the knowledge base of existing antibiotic resistance principles and surgical procedure guidelines, which may, in turn, improve the quality of postoperative care for patients. Furthermore, our study also reports the high prevalence of postoperative infection cases and the emergence of MDR bacteria, which have highlighted the challenges and difficulties in the management of postoperative infections. Although the number of MDR isolates and biofilm producer rates were relatively low in this present study, prudent antimicrobial use and effective infection prevention and control (IPC) strategies are important to prevent further development of multidrug resistance and the emergence of newer biofilm-producing strains.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/ijerph18189828/s1, Table S1: Degree of biofilm formation and resistance gene among the patient’s specimen with the resistance pattern of bacterial isolates to 11 antibiotic classes.

Author Contributions

Y.K.L. provided the conceptualisation and supervision; Y.K.Y. was involved in investigation, writing and original draft preparation; N.C.M.W., G.E.C.Y. and Z.X.C. involved in investigation and analysis; L.L.C., N.Z.M.Z. and D.K.C. reviewed and edited the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by IMU undergraduate research, grant number BMSc I-2019 (01).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the IJN Research Ethics Committee (IJNREC/412/2019 and 24 June 2019).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data presented in this study are available in Supplementary Table S1.

Acknowledgments

Y.K.Y. and Y.K.L. would like to thank the School of Postgraduate Studies and the Institute for Research, Development and Innovation (IRDI) of the International Medical University for the support given.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. WHO. Global Guidelines on the Prevention of Surgical Site Infection; WHO: Geneva, Switzerland, 2017. [Google Scholar]
  2. Haque, M.; Sartelli, M.; McKimm, J.; Bakar, M.A. Health care-associated infections—An overview. Infect. Drug Resist. 2018, 11, 2321–2333. [Google Scholar] [CrossRef]
  3. Torpy, J.M.; Burke, A.E.; Glass, R.M. Postoperative infections. JAMA—J. Am. Med. Assoc. 2010, 303, 2544. [Google Scholar] [CrossRef]
  4. Byrd, A.L.; Belkaid, Y.; Segre, J.A. The human skin microbiome. Nat. Rev. Microbiol. 2018, 16, 143–155. [Google Scholar] [CrossRef]
  5. Shibagaki, N.; Suda, W.; Clavaud, C.; Bastien, P.; Takayasu, L.; Iioka, E.; Kurokawa, R.; Yamashita, N.; Hattori, Y.; Shindo, C.; et al. Aging-related changes in the diversity of women’s skin microbiomes associated with oral bacteria. Sci. Rep. 2017, 7, 10567. [Google Scholar] [CrossRef] [PubMed]
  6. Mundhada, A.; Tenpe, S. A study of organisms causing surgical site infections and their antimicrobial susceptibility in a tertiary care Government Hospital. Indian J. Pathol. Microbiol. 2015, 58, 195–200. [Google Scholar] [CrossRef] [PubMed]
  7. Lin, Y.T.; Hsieh, K.S.; Chen, Y.S.; Huang, I.F.; Cheng, M.F. Infective endocarditis in children without underlying heart disease. J. Microbiol. Immunol. Infect. 2013, 46, 121–128. [Google Scholar] [CrossRef] [PubMed]
  8. NNIS System. National Nosocomial Infections Surveillance (NNIS) System Report, data summary from January 1992 through June 2003, issued August 2003. Am. J. Infect. Control 2003, 31, 481–498. [Google Scholar] [CrossRef] [PubMed]
  9. Hollenbeak, C.S.; Murphy, D.M.; Koenig, S.; Woodward, R.S.; Dunagan, W.C.; Fraser, V.J. The clinical and economic impact of deep chest surgical site infections following coronary artery bypass graft surgery. Chest 2000, 118, 397–402. [Google Scholar] [CrossRef] [PubMed]
  10. Michalopoulos, A.; Geroulanos, S.; Rosmarakis, E.S.; Falagas, M.E. Frequency, characteristics, and predictors of microbiologically documented nosocomial infections after cardiac surgery. Eur. J. Cardio-Thorac. Surg. 2006, 29, 456–460. [Google Scholar] [CrossRef] [PubMed]
  11. Markogiannakis, H.; Pachylaki, N.; Samara, E.; Kalderi, M.; Minettou, M.; Toutouza, M.; Toutouzas, K.G.; Theodorou, D.; Katsaragakis, S. Infections in a surgical intensive care unit of a university hospital in Greece. Int. J. Infect. Dis. 2009, 13, 145–153. [Google Scholar] [CrossRef] [PubMed]
  12. Alavi, S.M.; Roozbeh, F.; Behmanesh, F.; Alavi, L. Antibiotics use patterns for surgical prophylaxis site infection in different surgical wards of a teaching hospital in Ahvaz, Iran. Jundishapur J. Microbiol. 2014, 7, e12251. [Google Scholar] [CrossRef] [PubMed]
  13. Enzler, M.J.; Berbari, E.; Osmon, D.R. Antimicrobial prophylaxis in adults. Mayo Clin. Proc. 2011, 86, 686–701. [Google Scholar] [CrossRef]
  14. Talbot, T.R. Surgical site infections and antimicrobial prophylaxis. In Principle and Practice of Infectious Diseases, 7th ed.; Mandell, G.L., Bennett, J.E., Dolin, R., Eds.; Churchill Livingstone: Philadelphia, PA, USA, 2010. [Google Scholar]
  15. Yadesa, T.M.; Gudina, E.K.; Angamo, M.T. Antimicrobial use-related problems and predictors among hospitalized medical in-patients in Southwest Ethiopia: Prospective observational study. PLoS ONE 2015, 10, e0138385. [Google Scholar] [CrossRef] [PubMed]
  16. Lim, M.K.; Lai, P.S.M.; Ponnampalavanar, S.S.L.S.; Omar, S.F.S.; Taib, N.A.; Yusof, M.Y.; Italiano, C.M.; Kong, D.C.M.; Kamarulzaman, A. Antibiotics in surgical wards: Use or misuse? A newly industrialized country’s perspective. J. Infect. Dev. Ctries. 2015, 9, 1264–1271. [Google Scholar] [CrossRef]
  17. Abrha, S.; Assefa, R.; Molla, F.; Melkam, W.; Assen, A.; Mulugeta, A.; Wondimu, A.; Mohammed, J.; Birhanetensae, M.; Masresha, B. Antibiotics Utilization and their Cost in Ayder Referral Hospital, Mekelle, Ethiopia. Glob. J. Med. Res. 2015, 15, 1–9. [Google Scholar]
  18. Background|MDRO Management|Guidelines Library|Infection Control|CDC. Available online: https://www.cdc.gov/infectioncontrol/guidelines/mdro/background.html (accessed on 31 January 2021).
  19. Noordin, A.; Sapri, H.F.; Sani, N.A.M.; Leong, S.K.; Tan, X.E.; Tan, T.L.; Zin, N.M.; Neoh, H.M.; Hussin, S. Antimicrobial resistance profiling and molecular typing of methicillin-resistant Staphylococcus aureus isolated from a Malaysian teaching hospital. J. Med. Microbiol. 2016, 65, 1476–1481. [Google Scholar] [CrossRef]
  20. Lean, S.S.; Suhaili, Z.; Ismail, S.; Rahman, N.I.A.; Othman, N.; Abdullah, F.H.; Jusoh, Z.; Yeo, C.C.; Thong, K.L. Prevalence and genetic characterization of carbapenem- and polymyxin-resistant Acinetobacter baumannii isolated from a tertiary hospital in Terengganu, Malaysia. ISRN Microbiol. 2014, 2014, 953417. [Google Scholar] [CrossRef]
  21. Low, Y.M.; Yap, P.S.X.; Abdul Jabar, K.; Ponnampalavanar, S.; Karunakaran, R.; Velayuthan, R.; Chong, C.W.; Abu Bakar, S.; Md Yusof, M.Y.; Teh, C.S.J. The emergence of carbapenem resistant Klebsiella pneumoniae in Malaysia: Correlation between microbiological trends with host characteristics and clinical factors. Antimicrob. Resist. Infect. Control 2017, 6, 5. [Google Scholar] [CrossRef] [PubMed]
  22. Liew, S.M.; Rajasekaram, G.; Puthucheary, S.D.; Chua, K.H. Detection of VIM-2-, IMP-1- and NDM-1-producing multidrug-resistant Pseudomonas aeruginosa in Malaysia. J. Glob. Antimicrob. Resist. 2018, 13, 271–273. [Google Scholar] [CrossRef]
  23. Nirwati, H.; Sinanjung, K.; Fahrunissa, F.; Wijaya, F.; Napitupulu, S.; Hati, V.P.; Hakim, M.S.; Meliala, A.; Aman, A.T.; Nuryastuti, T. Biofilm formation and antibiotic resistance of Klebsiella pneumoniae isolated from clinical samples in a tertiary care hospital, Klaten, Indonesia. BMC Proc. 2019, 13, 20. [Google Scholar] [CrossRef] [PubMed]
  24. Chung, P.Y. The emerging problems of Klebsiella pneumoniae infections: Carbapenem resistance and biofilm formation. FEMS Microbiol. Lett. 2016, 363, fnw219. [Google Scholar] [CrossRef] [PubMed]
  25. Bonez, P.C.; Dos Santos Alves, C.F.; Dalmolin, T.V.; Agertt, V.A.; Mizdal, C.R.; Flores, V.D.C.; Marques, J.B.; Santos, R.C.V.; Anraku De Campos, M.M. Chlorhexidine activity against bacterial biofilms. Am. J. Infect. Control 2013, 41, e119–e122. [Google Scholar] [CrossRef] [PubMed]
  26. Knobloch, J.K.M.; Horstkotte, M.A.; Rohde, H.; Kaulfers, P.M.; Mack, D. Alcoholic ingredients in skin disinfectants increase biofilm expression of Staphylococcus epidermidis. J. Antimicrob. Chemother. 2002, 49, 683–687. [Google Scholar] [CrossRef] [PubMed]
  27. Rood, K.M.; Buhimschi, I.A.; Jurcisek, J.A.; Summerfield, T.L.; Zhao, G.; Ackerman, W.E.; Wang, W.; Rumpf, R.W.; Thung, S.F.; Bakaletz, L.O.; et al. Skin microbiota in obese women at risk for surgical site infection after cesarean delivery. Sci. Rep. 2018, 8, 8756. [Google Scholar] [CrossRef]
  28. Howard, A.; O’Donoghue, M.; Feeney, A.; Sleator, R.D. Acinetobacter baumannii: An emerging opportunistic pathogen. Virulence 2012, 3, 243–250. [Google Scholar] [CrossRef]
  29. Choong, P.F.M.; Dowsey, M.M.; Carr, D.; Daffy, J.; Stanley, P. Risk factors associated with acute hip prosthetic joint infections and outcome of treatment with a rifampinbased regimen. Acta Orthop. 2007, 78, 755–765. [Google Scholar] [CrossRef]
  30. Jämsen, E.; Huhtala, H.; Puolakka, T.; Moilanen, T. Risk factors for infection after knee arthroplasty. A register-based analysis of 43,149 cases. J. Bone Joint Surg. Am. 2009, 91, 38–47. [Google Scholar] [CrossRef]
  31. Revdiwala, S.; Rajdev, B.M.; Mulla, S. Characterization of bacterial etiologic agents of biofilm formation in medical devices in critical care setup. Crit. Care Res. Pract. 2012, 2012, 945805. [Google Scholar] [CrossRef]
  32. Mulcahy, L.R.; Isabella, V.M.; Lewis, K. Pseudomonas aeruginosa biofilms in disease. Microb. Ecol. 2014, 68, 1–12. [Google Scholar] [CrossRef]
  33. Moradali, M.F.; Ghods, S.; Rehm, B.H.A. Pseudomonas aeruginosa lifestyle: A paradigm for adaptation, survival, and persistence. Front. Cell. Infect. Microbiol. 2017, 7, 39. [Google Scholar] [CrossRef]
  34. Solomkin, J.S.; Mazuski, J.E.; Bradley, J.S.; Rodvold, K.A.; Goldstein, E.J.C.; Baron, E.J.; O’Neill, P.J.; Chow, A.W.; Patchen Dellinger, E.; Eachempati, S.R.; et al. Diagnosis and management of complicated intra-abdominal infection in adults and children: Guidelines by the surgical infection society and the infectious diseases society of america. Clin. Infect. Dis. 2010, 50, 133–164. [Google Scholar] [CrossRef]
  35. Johansen, H.K.; Moskowitz, S.M.; Ciofu, O.; Pressler, T.; Høiby, N. Spread of colistin resistant non-mucoid Pseudomonas aerginosa among chronically infected Danish cystic fibrosis patients. J. Cyst. Fibros. 2008, 7, 391–397. [Google Scholar] [CrossRef] [PubMed]
  36. Nation, R.L.; Li, J. Colistin in the 21st century. Curr. Opin. Infect. Dis. 2009, 22, 535–543. [Google Scholar] [CrossRef]
  37. Vuotto, C.; Longo, F.; Balice, M.P.; Donelli, G.; Varaldo, P.E. Antibiotic resistance related to biofilm formation in Klebsiella pneumoniae. Pathogens 2014, 3, 743–758. [Google Scholar] [CrossRef]
  38. Strommenger, B.; Kettlitz, C.; Werner, G.; Witte, W. Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. J. Clin. Microbiol. 2003, 41, 4089–4094. [Google Scholar] [CrossRef] [PubMed]
  39. Liu, Y.Y.; Wang, Y.; Walsh, T.R.; Yi, L.X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef]
  40. Hujier, N.S.A. Detection of Methicillin-Resistant Staphylococcus aureus in Nosocomial Infections in Gaza Strip. Master’s Thesis, The Islamic University—Gaza, Gaza, Palestine, 2006. Available online: https://library.iugaza.edu.ps/thesis/71122.pdf (accessed on 3 February 2021).
  41. Dutka-Malen, S.; Evers, S.; Courvalin, P. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. J. Clin. Microbiol. 1995, 33, 24–27. [Google Scholar] [CrossRef] [PubMed]
  42. El Ashkar, S.; Osman, M.; Rafei, R.; Mallat, H.; Achkar, M.; Dabboussi, F.; Hamze, M. Molecular detection of genes responsible for macrolide resistance among Streptococcus pneumoniae isolated in North Lebanon. J. Infect. Public Health 2017, 10, 745–748. [Google Scholar] [CrossRef]
  43. Avrain, L.; Garvey, M.; Mesaros, N.; Glupczynski, Y.; Mingeot-Leclercq, M.-P.; Piddock, L.J.V.; Tulkens, P.M.; Vanhoof, R.; Van Bambeke, F. Selection of quinolone resistance in Streptococcus pneumoniae exposed in vitro to subinhibitory drug concentrations. J. Antimicrob. Chemother. 2007, 60, 965–972. [Google Scholar] [CrossRef][Green Version]
  44. Del Grosso, M.; Camilli, R.; Barbabella, G.; Northwood, J.B.; Farrell, D.J.; Pantosti, A. Genetic resistance elements carrying mef subclasses other than mef(A) in Streptococcus pyogenes. Antimicrob. Agents Chemother. 2011, 55, 3226–3230. [Google Scholar] [CrossRef]
  45. Chaffanel, F.; Charron-Bourgoin, F.; Libante, V.; Leblond-Bourget, N.; Payot, S.; Schaffner, D.W. Resistance genes and genetic elements associated with antibiotic resistance in clinical and commensal isolates of Streptococcus salivarius. Appl. Environ. Microbiol. 2015, 81, 4155–4163. [Google Scholar] [CrossRef]
  46. Guo, Y.; Deng, X.; Liang, Y.; Zhang, L.; Zhao, G.P.; Zhou, Y. The draft genomes and investigation of serotype distribution, antimicrobial resistance of group B Streptococcus strains isolated from urine in Suzhou, China. Ann. Clin. Microbiol. Antimicrob. 2018, 17, 28. [Google Scholar] [CrossRef]
  47. Moghadampour, M.; Rezaei, A.; Faghri, J. The emergence of blaOXA-48 and blaNDM among ESBL-producing Klebsiella pneumoniae in clinical isolates of a tertiary hospital in Iran. Acta Microbiol. Immunol. Hung. 2018, 65, 335–344. [Google Scholar] [CrossRef]
  48. Geyer, C.N.; Hanson, N.D. Rapid PCR amplification protocols decrease the turn-around time for detection of antibiotic resistance genes in Gram-negative pathogens. Diagn. Microbiol. Infect. Dis. 2013, 77, 113–117. [Google Scholar] [CrossRef] [PubMed]
  49. Gales, A.C.; Menezes, L.C.; Silbert, S.; Sader, H.S. Dissemination in distinct Brazilian regions of an epidemic carbapenem-resistant Pseudomonas aeruginosa producing SPM metallo-β-lactamase. J. Antimicrob. Chemother. 2003, 52, 699–702. [Google Scholar] [CrossRef] [PubMed]
  50. Moosavian, M.; Rahimzadeh, M. Molecular detection of metallo-β-lactamase genes, blaIMP-1, blaVIM-2 and blaSPM-1 in imipenem resistant Pseudomonas aeruginosa isolated from clinical specimens in teaching hospitals of Ahvaz, Iran. Iran. J. Microbiol. 2015, 7, 2–6. [Google Scholar]
  51. Manchanda, V.; Gupta, S.; Chopra, R.; Verma, N.; Kaur, I.; Rai, S.; Rautela, R.; Rawat, D.; Singh, N.; Bhalla, P. Development of TaqMan real-time polymerase chain reaction for the detection of the newly emerging form of carbapenem resistance gene in clinical isolates of Escherichia coli, Klebsiella pneumoniae, and Acinetobacter baumannii. Indian J. Med. Microbiol. 2011, 29, 249–253. [Google Scholar] [CrossRef]
  52. Bogaerts, P.; de Castro, R.R.; de Mendonça, R.; Huang, T.D.; Denis, O.; Glupczynski, Y. Validation of carbapenemase and extended-spectrum β-lactamase multiplex endpoint PCR assays according to ISO 15189. J. Antimicrob. Chemother. 2013, 68, 1576–1582. [Google Scholar] [CrossRef]
  53. Stepanović, S.; Vuković, D.; Dakić, I.; Savić, B.; Švabić-Vlahović, M. A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J. Microbiol. Methods 2000, 40, 175–179. [Google Scholar] [CrossRef]
  54. Surgical Site Infections-Infectious Disease Advisor. Available online: https://www.infectiousdiseaseadvisor.com/home/decision-support-in-medicine/hospital-infection-control/surgical-site-infections/ (accessed on 15 February 2021).
  55. View of Surgical Site Infections and Antimicrobial Resistance Pattern. Available online: https://jnhrc.com.np/index.php/jnhrc/article/view/1048/626 (accessed on 15 February 2021).
  56. Pal, S.; Sayana, A.; Joshi, A.; Juyal, D. Staphylococcus aureus: A predominant cause of surgical site infections in a rural healthcare setup of Uttarakhand. J. Fam. Med. Prim. Care 2019, 8, 3600–3606. [Google Scholar]
  57. Kime, L.; Randall, C.P.; Banda, F.I.; Coll, F.; Wright, J.; Richardson, J.; Empel, J.; Parkhill, J.; O’Neill, A.J. Transient silencing of antibiotic resistance by mutation represents a significant potential source of unanticipated therapeutic failure. mBio 2019, 10, e01755-19. [Google Scholar] [CrossRef]
  58. Hope, D.; Ampaire, L.; Oyet, C.; Muwanguzi, E.; Twizerimana, H.; Apecu, R.O. Antimicrobial resistance in pathogenic aerobic bacteria causing surgical site infections in Mbarara regional referral hospital, Southwestern Uganda. Sci. Rep. 2019, 9, 17299. [Google Scholar] [CrossRef]
  59. Lubega, A.; Joel, B.; Justina Lucy, N. Incidence and etiology of surgical site infections among emergency postoperative patients in Mbarara regional referral hospital, South Western Uganda. Surg. Res. Pract. 2017, 2017, 6365172. [Google Scholar] [CrossRef]
  60. Ali, K.M.; Al-Jaff, B.M.A. Source and antibiotic susceptibility of Gram-negative bacteria causing superficial incisional surgical site infections. Int. J. Surg. Open 2021, 30, 100318. [Google Scholar] [CrossRef]
  61. Cortés, G.; Borrell, N.; De Astorza, B.; Gómez, C.; Sauleda, J.; Albertí, S. Molecular analysis of the contribution of the capsular polysaccharide and the lipopolysaccharide O side chain to the virulence of Klebsiella pneumoniae in a murine model of pneumonia. Infect. Immun. 2002, 70, 2583–2590. [Google Scholar] [CrossRef]
  62. Neut, D.; Hendriks, J.G.E.; van Horn, J.R.; van der Mei, H.C.; Busscher, H.J. Pseudomonas aeruginosa biofilm formation and slime excretion on antibiotic-loaded bone cement. Acta Orthop. 2005, 76, 109–114. [Google Scholar] [CrossRef] [PubMed]
  63. Prasad, S.V.; Ballal, M.; Shivananda, P.G. Slime production a virulence marker in Pseudomonas aeruginosa strains isolated from clinical and environmental specimens: A comparative study of two methods. Indian J. Pathol. Microbiol. 2009, 52, 191–193. [Google Scholar] [PubMed]
  64. Kuang, Z.; Hao, Y.; Walling, B.E.; Jeffries, J.L.; Ohman, D.E.; Lau, G.W. Pseudomonas aeruginosa elastase provides an escape from phagocytosis by degrading the pulmonary surfactant protein-A. PLoS ONE 2011, 6, e27091. [Google Scholar] [CrossRef] [PubMed]
  65. Kiratisin, P.; Apisarnthanarak, A.; Laesripa, C.; Saifon, P. Molecular characterization and epidemiology of extended-spectrum-β- lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates causing health care-associated infection in Thailand, where the CTX-M family is endemic. Antimicrob. Agents Chemother. 2008, 52, 2818–2824. [Google Scholar] [CrossRef]
  66. Mahdi Yahya Mohsen, S.; Hamzah, H.A.; Muhammad Imad Al-Deen, M.; Baharudin, R. Antimicrobial susceptibility of Klebsiella pneumoniae and Escherichia coli with extended-spectrum β-lactamase associated genes in hospital Tengku Ampuan Afzan, Kuantan, Pahang. Malaysian J. Med. Sci. 2016, 23, 14–20. [Google Scholar]
  67. Apisarnthanarak, A.; Kiratisin, P.; Mundy, L.M. Clinical and molecular epidemiology of healthcare-associated infections due to extended-spectrum β -lactamase (ESBL)–producing strains of Escherichia coli and Klebsiella pneumoniae that harbor multiple ESBL genes. Infect. Control Hosp. Epidemiol. 2008, 29, 1026–1034. [Google Scholar] [CrossRef]
  68. Microbial Growth-Biology LibreTexts. Available online: https://bio.libretexts.org/Bookshelves/Microbiology/Book%3A_Microbiology_(Bruslind)/09%3A_Microbial_Growth (accessed on 15 February 2021).
  69. Weisblum, B. Erythromycin resistance by ribosome modification. Antimicrob. Agents Chemother. 1995, 39, 577–585. [Google Scholar] [CrossRef]
  70. Zmantar, T.; Kouidhi, B.; Miladi, H.; Bakhrouf, A. Detection of macrolide and disinfectant resistance genes in clinical Staphylococcus aureus and coagulase-negative staphylococci. BMC Res. Notes 2011, 4, 453. [Google Scholar] [CrossRef]
  71. Zmantar, T.; Kouidhi, B.; Hentati, H.; Bakhrouf, A. Detection of disinfectant and antibiotic resistance genes in Staphylococcus aureus isolated from the oral cavity of Tunisian children. Ann. Microbiol. 2012, 62, 123–128. [Google Scholar] [CrossRef]
  72. Eady, E.A.; Ross, J.I.; Tipper, J.L.; Walters, C.E.; Cove, J.H.; Noble, W.C. Distribution of genes encoding erythromycin ribosomal methylases and an erythromycin efflux pump in epidemiologically distinct groups of staphylococci. J. Antimicrob. Chemother. 1993, 31, 211–217. [Google Scholar] [CrossRef]
  73. Manyahi, J.; Matee, M.I.; Majigo, M.; Moyo, S.; Mshana, S.E.; Lyamuya, E.F. Predominance of multi-drug resistant bacterial pathogens causing surgical site infections in Muhimbili national hospital, Tanzania. BMC Res. Notes 2014, 7, 500. [Google Scholar] [CrossRef] [PubMed]
  74. Tavajjohi, Z.; Moniri, R.; Khorshidi, A. Detection and characterization of multidrug resistance and extended-spectrum-beta-lactamase-producing (ESBL S) Pseudomonas aeruginosa isolates in teaching hospital. African J. Microbiol. Res. 2011, 5, 3223–3228. [Google Scholar]
  75. Motbainor, H.; Bereded, F.; Mulu, W. Multi-drug resistance of blood stream, urinary tract and surgical site nosocomial infections of Acinetobacter baumannii and Pseudomonas aeruginosa among patients hospitalized at Felegehiwot referral hospital, Northwest Ethiopia: A cross-sectional study. BMC Infect. Dis. 2020, 20, 92. [Google Scholar] [CrossRef]
  76. Zhu, Y.; Chen, J.; Shen, H.; Chen, Z.; Yang, Q.W.; Zhu, J.; Li, X.; Yang, Q.; Zhao, F.; Ji, J.; et al. Emergence and rising of ceftazidime-avibactam resistant KPC-producing Pseudomonas aeruginosa in China: A molecular epidemiology study. medRxiv 2020, 1–43. [Google Scholar] [CrossRef]
  77. Barsoumian, A.E.; Mende, K.; Sanchez, C.J.; Beckius, M.L.; Wenke, J.C.; Murray, C.K.; Akers, K.S. Clinical infectious outcomes associated with biofilm-related bacterial infections: A retrospective chart review. BMC Infect. Dis. 2015, 15, 223. [Google Scholar] [CrossRef] [PubMed]
  78. Russotto, V.; Cortegiani, A.; Raineri, S.M.; Giarratano, A. Bacterial contamination of inanimate surfaces and equipment in the intensive care unit. J. Intensive Care 2015, 3, 54. [Google Scholar] [CrossRef] [PubMed]
  79. Chaoui, L.; Mhand, R.; Mellouki, F.; Rhallabi, N. Contamination of the surfaces of a health care environment by multidrug-resistant (MDR) bacteria. Int. J. Microbiol. 2019, 2019, 3236526. [Google Scholar] [CrossRef]
  80. Nadell, C.D.; Xavier, J.B.; Foster, K.R. The sociobiology of biofilms. FEMS Microbiol. Rev. 2009, 33, 206–224. [Google Scholar] [CrossRef] [PubMed]
  81. Savage, V.J.; Chopra, I.; O’neill, A.J. Staphylococcus aureus biofilms promote horizontal transfer of antibiotic resistance. Antimicrob. Agents Chemother. 2013, 57, 1968–1970. [Google Scholar] [CrossRef]
  82. Madsen, J.S.; Burmølle, M.; Hansen, L.H.; Sørensen, S.J. The interconnection between biofilm formation and horizontal gene transfer. FEMS Immunol. Med. Microbiol. 2012, 65, 183–195. [Google Scholar] [CrossRef] [PubMed]
Table 1. PCR primers and programme specifications for the targeted genes in the respective bacteria [38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53].
Table 1. PCR primers and programme specifications for the targeted genes in the respective bacteria [38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53].
IsolatesGenesPrimers (5’−3’)PCR Products (Base Pair)PCR Programme Specifications
Initial DenaturationDenaturationAnnealingExtensionFinal Extension
S. aureus
Streptococcus spp.
ermAAAG CGG TAA ACC CCT CTG A;
TTC GCA AAT CCC TTC TCA AC
190 bp94 °C, 3 min35 cycles of 94 °C, 30 s55 °C, 45 s72 °C, 45 s72 °C, 10 min
S. aureus
Streptococcus spp.
ermBCTATCTGATTGTTGAAGAAGGATT;
GTTTACTCTTGGTTTAGGATGAAA
142 bp94 °C, 3 min35 cycles of 94 °C, 30 s55 °C, 45 s72 °C, 45 s72 °C, 10 min
S. aureus
Streptococcus spp.
ermCAAT CGT CAA TTC CTG CAT GT;
TAA TCG TGG AAT ACG GGT TTG
299 bp94 °C, 3 min35 cycles of 94 °C, 30 s55 °C, 45 s72 °C, 45 s72 °C, 10 min
S. aureus
Streptococcus spp.
tetKGTA GCG ACA ATA GGT AAT AGT;
GTA GTG ACA ATA AAC CTC CTA
360 bp94 °C, 3 min35 cycles of 94 °C, 30 s55 °C, 45 s72 °C, 45 s72 °C, 10 min
S. aureus
Streptococcus spp.
tetMAGT GGA GCG ATT ACA GAA;
CAT ATG TCC TGG CGT GTC TA
158 bp94 °C, 3 min35 cycles of 94 °C, 30 s55 °C, 45 s72 °C, 45 s72 °C, 10 min
S. aureus
Streptococcus spp.
msrAGAA GCA CTT GAG CGT TCT;
CCT TGT ATC GTG TGA TGT
287 bp95 °C, 2 min30 cycles of 94 °C, 30 s50 °C, 30 s72 °C, 30 s72 °C, 4 min
S. aureus
Streptococcus spp.
K. pneumoniae
A. baumannii
P. aeruginosa
mcr-1CGGTCAGTCCGTTTGTTC;
CTTGGTCGGTCTGTAGGG
309 bp94 °C, 15 min25 cycles of 94 °C, 30 s58 °C, 90 s72 °C, 1 min72 °C, 10 min
S. aureusaacA-aphDTAA TCC AAG AGC AAT AAG GGC;
GCC ACA CTA TCA TAA CCA CTA
227 bp94 °C, 3 min35 cycles of 94 °C, 30 s55 °C, 45 s72 °C, 45 s7 2 °C, 10 min
S. aureusmecAAAAATCGATGGTAAAGGTTGGC;
AGTTCTGCAGTACCGGAT TTGC
533 bp95 °C, 1 min35 cycles of 95 °C, 1 min54 °C, 1 min72 °C, 1 min72 °C, 5 min
S. aureusvanAGGGAAAACGACAATTGC;
GTACAATGCGGCCGTTA
732 bp94 °C, 2 min30 cycles of 94 °C, 1 min54 °C, 1 min72 °C, 1 min72 °C, 10 min
S. aureusvanBATGGGAAGCCGATAGTC;
GATTTCGTTCCTCGACC
635 bp94 °C, 2 min30 cycles of 94 °C, 1 min54 °C, 1 min72 °C, 1 min72 °C, 10 min
S. aureus
Streptococcus spp.
mef(A)AGT ATC ATT AAT CAC TAG TGC;
TTC TTC TGG TAC AAA AGT GG
348 bp95 °C, 5 min35 cycles of 95 °C, 30 s54 °C, 30 s72 °C, 1 min72 °C, 5 min
S. aureus
Streptococcus spp.
mef(E)AGT ATC ATT AAT CAC TAG TGC;
TTC TTC TGG TAC AAA AGT GG
1218 bp94 °C, 5 min35 cycles of 94 °C, 30 s50 °C, 30 s72 °C, 90 s72 °C, 5 min
A. baumannii
Streptococcus spp.
pmrATCCAGTATGGGCTTTTCCAG;
CCAATCCAAAGAGGAAACGA
178 bp95 °C, 9 min40 cycles of 95 °C, 15 s53.7 °C, 1 min72 °C, 1 min72 °C, 5 min
Streptococcus spp.catQTAGAAAGCCATACTTTGAGC;
CATGATGCACCTGTACAGAC
536 bp95 °C, 2 min35 cycles of 95 °C, 30 s50 °C, 30 s72 °C, 30 s72 °C, 5 min
Streptococcus spp.InuBCCTACCTATTGTTTGTGGAA;
ATAACGTTACTCTCCTATTC
944 bp94 °C, 5 min35 cycles of 94 °C, 45 s54 °C, 45 s72 °C, 1 min72 °C, 5 min
K. pneumoniae
A. baumannii
blaCTX-MTTTGCGATGTGCAGTACCAGTAA;
CGATATCGTTGGTGGTGCCATA
544 bp95 °C, 5 min35 cycles of 95 °C, 30 s51 °C, 45 s72 °C, 1 min72 °C, 10 min
K. pneumoniae
A. baumannii
blaSHVATGCGTTATATTCGCCTGTG;
TGCTTTGTTATTCGGGCCAA
753 bp95 °C, 5 min35 cycles of 95 °C, 30 s60 °C, 45 s72 °C, 1 min72 °C, 10 min
K. pneumoniae
A. baumannii
blaKPC-2GTATCGCCGTCTAGTTCTG;
CCTTGAATGAGCTGCACAGTGG
209 bp95 °C, 3 min40 cycles of 95 °C, 5 s50 °C, 30 s72 °C, 1 min72 °C, 5 min
K. pneumoniae
A. baumannii
blaGESGTTTTGCAATGTGCTCAACG;
TGCCATAGCAATAGGCGTAG
371 bp95 °C, 5 min35 cycles of 95 °C, 30 s53 °C, 45 s72 °C, 1 min72 °C, 10 min
K. pneumoniae
A. baumannii
blaIMPGTTTATGTTCATACATCG;
GGTTTAACAAAACAACCAC
440 bp95 °C, 5 min35 cycles of 95 °C, 30 s45 °C, 45 s72 °C, 1 min72 °C, 10 min
K. pneumoniae
A. baumannii
blaVIMTTTGGTCGCATATCGCAACG;
CCATTCAGCCAGATCGGCAT
500 bp95 °C, 5 min35 cycles of 95 °C, 30 s66 °C, 45 s72 °C, 1 min72 °C, 10 min
K. pneumoniae
A. baumannii
blaSPM-1CCTACAATCTAACGGCGACC;
TCGCCGTGTCCAGGTATAAC
674 bp95 °C, 5 min30 cycles of 95 °C, 1 min40 °C, 1 min68 °C, 1 min68 °C,5 min
K. pneumoniae
A. baumannii
blaNDM-1GGGCAGTCGCTTCCAACGGT;
GTAGTGCTCAGTGTCGGCAT
475 bp94 °C, 3 min40 cycles of 94v, 30 s60 °C, 30 s72 °C, 30 s72 °C, 3 min
K. pneumoniae
A. baumannii
blaOXA-23CCCCGAGTCAGATTGTTCAAGG;
TAC GTCGCGCAAGTTCCTGA
330 bp95 °C, 15 min30 cycles of 94 °C, 30 s57 °C, 90 s72 °C, 90 s72 °C, 10 min
K. pneumoniae
A. baumannii
blaOXA-24CACCTATGGTAATGCTCTTGC;
CAACCTACCTGTGGAGTAACAC
501 bp95 °C, 3 min40 cycles of 95 °C, 5 s50 °C, 30 s72 °C, 1 min72 °C, 5 min
K. pneumoniae
A. baumannii
blaOXA-58GGGGCTTGTGCTGAGCATAGT;
CCACTTGCCCATCTGCCTTT
688 bp95 °C, 15 min30 cycles of 94 °C, 30 s57 °C, 90 s72 °C, 90 s72 °C, 10 min
Table 2. Distribution of isolated bacteria across various infected body sites.
Table 2. Distribution of isolated bacteria across various infected body sites.
BloodPus/WoundTrachealTissueBronchialUrineSputum
S. aureus18921000
K. pneumoniae35540101
A. baumannii5010010
P. aeruginosa28202100
Streptococcus spp.11000000
Table 3. Antibiotic resistance genes detected in clinical isolates.
Table 3. Antibiotic resistance genes detected in clinical isolates.
S. AureusK. PneumoniaeA. BaumanniiP. AeruginosaStreptococcus spp.
(n = 30)(n = 46)(n = 7)(n = 33)(n = 11)
Number (%)Number (%)Number (%)Number (%)Number (%)
ermA12 (40)---0 (0)
ermB1 (3.3)---5 (45.5)
ermC26 (86.7)---0 (0)
tetK0 (0)---1 (9.1)
tetM21 (70)---9 (81.8)
msrA0 (0)---0 (0)
mcr-10 (0)1 (2.17)0 (0)0 (0)0 (0)
aacA-aphD19 (63.3)----
mecA20 (66.7)----
vanA0 (0)----
vanB0 (0)----
mef(A)0 (0)---1 (9.1)
mef(E)0 (0)---0 (0)
pmrA--2 (28.6)-8 (72.7)
catQ----0 (0)
InuB----0 (0)
blaCTX-M-46 (100)3 (42.9)33 (100)-
blaSHV-46 (100)6 (85.7)31 (93.9)-
blaKPC-2-0 (0)1 (16.7)7 (21.2)-
blaGES-37 (80.4)2 (28.6)33 (100)-
blaIMP-0 (0)1 (16.7)0 (0)-
blaVIM-7 (15.2)1 (16.7)0 (0)-
blaSPM-1-0 (0)0 (0)2 (6.1)-
blaNDM-1-9 (19.6)3 (42.9)1 (3.0)-
blaOXA-23-5 (10.9)5 (71.4)220 (66.7)-
blaOXA-24-0 (0)0 (0)0 (0)-
blaOXA-58-3 (6.5)0 (0)0 (0)-
Table 4. Susceptible profiles of isolates to β-lactam and non-β-lactam antibiotics.
Table 4. Susceptible profiles of isolates to β-lactam and non-β-lactam antibiotics.
DrugS. aureusK. pneumoniaeA. baumanniP. aeruginosaStreptococcus spp.
(n = 30)(n = 46)(n = 7)(n = 33)(n = 11)
Number (%)Number (%)Number (%)Number (%)Number (%)
Amikacin-46 (100)-32 (97)-
Tobramycin-26 (56.5)4 (57.1)32 (97)-
Gentamicin29 (96.7)----
Benzylpenicillin5 (16.7)---3 (27.3)
Oxacillin19 (63.3)----
Ampicillin----3 (27.3)
Ampicillin/sulbactam-14 (30.4)4 (57.1)--
Piperacillin/tazobactam-25 (54.3)4 (57.1)22 (66.7)-
Ertapenem-43 (93.5)---
Imipenem-44 (95.7)4 (57.1)24 (72.7)-
Meropenem-44 (95.7)4 (57.1)24 (72.7)-
Cefotetan----1 (9.1)
Cefazolin-15 (32.6)0 (0)0 (0)-
Ceftazidime-16 (34.8)4 (57.1)24 (72.7)-
Ceftriaxone-17 (37.0)--1 (9.1)
Cefepime-19 (41.3)4 (57.1)24 (72.7)-
Chloramphenicol----1 (9.1)
Levofloxacin19 (63.3)17(37.0)4 (57.1)24 (72.7)3 (27.3)
Teicoplanin----1 (9.1)
Vancomycin30 (100)---3 (27.3)
Tigecycline30 (100)---3 (27.3)
Clindamycin21 (70)---2 (18.2)
Erythromycin20 (66.7)---1 (9.1)
Nitrofurantoin30 (100)9 (19.6)--2 (18.2)
Linezolid30 (100)---3 (27.3)
Ciprofloxacin19 (63.3)17 (37.0)4 (57.1)26 (78.8)-
Moxifloxacin19 (63.3)---3 (27.3)
Rifampicin29 (96.7)----
Quinupristin/Dalfoprostin30 (100)---2 (6.1)
Trimethoprim/Sulfamethoxazole29 (96.7)19 (41.3)5 (71.4)--
Tetracycline26 (86)---2 (18.2)
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Yong, Y.K.; Wen, N.C.M.; Yeo, G.E.C.; Chew, Z.X.; Chan, L.L.; Md Zain, N.Z.; Chellappan, D.K.; Liew, Y.K. Characterisation of Bacterial Isolates from Infected Post-Operative Patients in a Malaysian Tertiary Heart Care Centre. Int. J. Environ. Res. Public Health 2021, 18, 9828. https://doi.org/10.3390/ijerph18189828

AMA Style

Yong YK, Wen NCM, Yeo GEC, Chew ZX, Chan LL, Md Zain NZ, Chellappan DK, Liew YK. Characterisation of Bacterial Isolates from Infected Post-Operative Patients in a Malaysian Tertiary Heart Care Centre. International Journal of Environmental Research and Public Health. 2021; 18(18):9828. https://doi.org/10.3390/ijerph18189828

Chicago/Turabian Style

Yong, Yi Keng, Nicole Ce Mun Wen, Genieve Ee Chia Yeo, Zhi Xin Chew, Li Li Chan, Noor Zaitulakma Md Zain, Dinesh Kumar Chellappan, and Yun Khoon Liew. 2021. "Characterisation of Bacterial Isolates from Infected Post-Operative Patients in a Malaysian Tertiary Heart Care Centre" International Journal of Environmental Research and Public Health 18, no. 18: 9828. https://doi.org/10.3390/ijerph18189828

APA Style

Yong, Y. K., Wen, N. C. M., Yeo, G. E. C., Chew, Z. X., Chan, L. L., Md Zain, N. Z., Chellappan, D. K., & Liew, Y. K. (2021). Characterisation of Bacterial Isolates from Infected Post-Operative Patients in a Malaysian Tertiary Heart Care Centre. International Journal of Environmental Research and Public Health, 18(18), 9828. https://doi.org/10.3390/ijerph18189828

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop