Effects of Eimeria Challenge and Monensin Supplementation on Performance, Nutrient Digestibility, and Intestinal Health of Broilers

Abstract

This study aimed to evaluate the performance, nutrient digestibility, intestinal health, and duodenum gene expression of broilers challenged with Eimeria spp. supplemented with or without monensin sodium. A total of 144 male chicks were used, distributed in a completely randomized design with three treatments: unchallenged control (UN), challenged control (CC), and CC + 100 mg/kg of monensin sodium (MON). Six replicates of eight birds each were used. At 14 days of age, the challenged groups were inoculated with a mixture of Eimeria oocysts, 12,500 E. maxima, 62,500 E. acervulina, and 12,500 E. tenella oocysts/chick. Coccidial challenge impaired growth performance and nutrient digestibility and induced intestinal damage, as evidenced by reduced body weight gain and feed intake (p < 0.001), lower apparent digestibility coefficients (p < 0.001), and altered intestinal morphometry and ISI score in the jejunum and cecum (p < 0.001). Monensin supplementation partially alleviated these negative effects, improving performance and nutrient digestibility (p < 0.001) and delaying oocyst excretion (p = 0.006) when compared with the CC group. However, the duodenal expression of tight junction-related genes, as well as intestinal integrity and health parameters, remained impaired despite monensin supplementation. It is concluded that monensin preserves nutrient digestibility and attenuates performance loss in broilers challenged with Eimeria spp. but not reduced intestinal damage.

1. Introduction

Coccidiosis is caused by the protozoa Eimeria spp., which can infect chickens and cause disease. This leads to poor feed conversion and reduces overall performance, negatively impacting production economics, even in the absence of clinical symptoms [1]. Furthermore, the disease contributes to increased intestinal damage, immunosuppression, and poor nutrient absorption, and promotes dysbiosis [2]. Clinical signs of coccidiosis include diarrhea, loose and mucoid feces (with or without blood), stunted growth, impaired feed conversion, and increased mortality [3]. In addition to impacting performance, coccidiosis compromises nutrient absorption and causes histological alterations in the intestine, such as reduced villus height, increased crypt depth, atrophy, and inflammation, resulting in decreased absorptive surface area [4,5,6]. Histopathological damage resulting from coccidiosis can be assessed using the “I See Inside” index (ISI) [7], which quantifies the structural and functional alterations in an organ [8,9].

Recent studies have also explored changes in intestinal gene expression associated with Eimeria challenge [10,11]. Genes associated with intestinal barrier integrity, such as Zonula Occludens-A (ZO-A), Zonula Occludens-B (ZO-B), Junctional Adhesion Molecule (JAM), Occludin, and Mucin 2 (MUC2), play a key role in maintaining epithelial junctions and protecting the mucosa. Additionally, transporters such as Glucose transporter (GLUT2) and Sugar transporter 1 (SGLT1) regulate glucose and energy absorption and are often modulated under conditions of enteric stress, such as those caused by Eimeria infections. Together, these genes provide insights into the physiological responses of broiler chickens and the possible mechanisms of action of anticoccidials and alternatives to antibiotics [5,12]. Monensin sodium (MON) is the first ionophore commercially available for coccidiosis control and has been used in the industry since 1971 [13,14]. Its efficacy is demonstrated by an improved feed conversion ratio (FCR), weight gain, and reduced mortality in broiler chickens challenged with Eimeria [15,16,17]. Thus, in Eimeria challenge models, MON has been widely utilized as a reference control for evaluating alternative antimicrobial additives [18,19,20].

Different challenge protocols with Eimeria have been published in the literature, with those using multi-species Eimeria approach being the most effective for observing the effects of coccidiosis [21]. Previous studies have assessed the optimal dosage of each species for the Eimeria challenge, demonstrating that medium-to-low doses are comparable to subclinical coccidiosis infection [11]. These effects are typically demonstrated through comprehensive measurements, including performance, intestinal morphology, expression of intestinal integrity genes, intestinal permeability, and the ileal digestibility of macrominerals and energy [11,21,22].

Deepening the understanding of MON’s efficacy in a subclinical Eimeria challenge scenario yields valuable data to support the search for alternatives to conventional anticoccidials. Thus, this study aimed to investigate the performance, nutrient digestibility, expression of intestinal integrity and nutrient absorption genes, and intestinal morphometry and histopathological score of broilers challenged with a mixed Eimeria species, treated or untreated with monensin sodium.

2. Materials and Methods

The experiment was conducted at the Poultry Experimental Unit, ESALQ, University of São Paulo, Piracicaba, SP, Brazil. All procedures were previously approved by the Ethics Committee for the Use of Animals (CEUA) of ESALQ/USP under protocol number 6907010725 (approved on 9 August 2025), in accordance with Brazilian legislation and CONCEA guidelines.

2.1. Experimental Design

One hundred and forty-four one-day-old male broiler chicks of the Cobb 500 strain were acquired from a commercial hatchery (Incubatório Zanchetta, Bofete, SP, Brazil) and distributed in a randomized block design across three treatments, with six replicates of eight broilers each. The treatments were as follows: Unchallenged Control (UN), Challenged Control (CC), and CC + 100 mg/kg of monensin sodium (MON).

The broiler chickens were allocated in metabolic cages upon arrival (one day of age), where the required temperature was maintained using electrical heating elements. Each experimental cage was equipped with a stainless-steel trough feeder and trough drinker. The cages were arranged in six-tier metal batteries, with the tier (floor) considered the block in the experimental design.

At 14 days of age, the broiler chickens received a single oral dose of either 1 mL of distilled H₂O (UN broilers) or 1 mL of a solution containing 62,500 sporulated oocysts of Eimeria acervulina, 12,500 sporulated oocysts of Eimeria maxima, and 12,500 sporulated oocysts of Eimeria tenella (CC and MON broilers). This dosage was selected based on previous studies that successfully induced pathogen-induced anorexia equivalent to subclinical coccidiosis [11,23]. Eimeria species were acquired from a commercial laboratory (CAPEV, Amparo, SP, Brazil).

Broilers received a diet formulated based on corn and soybean meal (

Table 1. Ingredient and analyzed chemical composition of the experimental diets.

Ingredients	%
Corn	57.36
Soybean meal	36.91
Corn oil	1.88
Dicalcium phosphate	1.781
Limestone	0.787
Salt	0.456
DL—Methionine	0.322
L—Lysine	0.194
L—Threonine	0.085
Choline chloride	0.065
Vitamin supplement 1	0.120
Mineral supplement 2	0.050
Total, kg	100.00
Calculated composition
Dry matter,%	88.86
Organic matter,%	85.70
Crude protein,%	22.60
Metabolizable energy, kcal/kg	3000
Ethereal extract,%	5.25
Arginine	1.287
Lysine	1.217
Methionine	0.615
Methionine + Cysteine	0.905
Threonine	0.770
Tryptophan	0.239
Valine	0.870

¹ DSM Nutritional Products, Composition per kg of diet: Vit. A—13,500 UI; Vit. D3—3750 UI; Vit. E—30 UI; Vit. K3—3.75 mg; Vit. B1—3 mg; Vit. B2—9 mg; Vit. B6—4.5 mg; Vit. B12—22.5 μg; Nicotinic acid—52.5 mg; Pantothenic acid—27 mg; Biotin—0.15 mg; Folic acid—2.25 mg; Selenium—0.375 mg. ² DSM Nutritional Products, Composition per kg of diet: Manganese—96 mg; Iron—60 mg; Zinc—60 mg; Copper—12 mg; Cobalt—1.2 mg; Iodine—1.2 mg.

) according to the requirements described in the Brazilian Tables for Poultry and Swine [24], covering a single phase (1–28 days of age). The diets were provided in mash form without the inclusion of antimicrobial growth-promoters (AGPs). Monensin sodium was included in the diet of broiler chickens in the MON treatment from the first day of age. Food and water were provided ad libitum throughout the experimental period.

2.2. Performance and Nutrient Digestibility

To evaluate broiler performance, feed intake (FI), weight gain (WG), and feed conversion ratio (FCR) were determined. Mortality was computed to correct for FCR. Broiler chickens were weighed at 7, 14, 21 (7 days post-infection, dpi), and 28 (14 dpi) days of age to determine the average weight gain. Following the challenge, the diets were weighed daily to determine the daily feed consumption. FCR was calculated as the ratio between feed intake and weight gain.

Apparent nutrient digestibility was determined using the total excreta collection method from day 18 to day 21 of age. Birds were housed in individual metabolism cages that allowed for complete and quantitative recovery of excreta, preventing contamination with feed residues or other extraneous materials. Feed intake was recorded for each experimental unit during the collection period, and all excreta voided were quantitatively collected at approximately 12 h intervals to ensure accurate mass balance. Immediately after each collection, excreta were placed in labeled plastic bags and stored at −18 °C to prevent nutrient losses and microbial degradation. After the collection period, the excreta were thawed and homogenized, and a 300 g aliquot was sent to the laboratory for chemical analyses of Dry Matter (DM), Crude Protein (CP), Gross Energy (GE), and ash.

Excreta pre-drying was performed in a forced-air oven at 55 °C for 72 h (MA035, Marconi, Piracicaba, SP, Brazil). Subsequently, both excreta and diets were ground in a Willey-type knife mill to 1 mm (MA680, Marconi, Piracicaba, SP, Brazil). The DM content was determined by drying the samples in an oven for 24 h at 105 °C (method 930.15; [25]). CP was determined using the Dumas method (method 990.03; [25]), with a correction factor of 6.25. Ash was determined by burning porcelain crucibles in a muffle furnace for 4 h after reaching 580 °C (method 942.05; [25]). GE was determined using a Parr calorimeter (Model 1381, Parr Instrument Company, Moline, IL, USA) using benzoic acid (Parr Instrument Company, Moline, IL, USA) as a standard.

Based on the analysis results of the experimental diets and the excreta from each experimental unit, the Apparent Total Tract Digestibility (ATTD) coefficients of DM, GE, ash and CP were calculated. Apparent Metabolizable Energy (AME) and Nitrogen-Corrected Apparent Metabolizable Energy (AMEn) values were also determined using the following equations:

$$\mathrm{A}\mathrm{T}\mathrm{T}\mathrm{D}\mathrm{ }= {\displaystyle \frac{\mathrm{n}\mathrm{u}\mathrm{t}\mathrm{r}\mathrm{i}\mathrm{e}\mathrm{n}\mathrm{t} \mathrm{i}\mathrm{n}\mathrm{t}\mathrm{a}\mathrm{k}\mathrm{e} \left(\mathrm{g}\right)- \mathrm{n}\mathrm{u}\mathrm{t}\mathrm{r}\mathrm{i}\mathrm{e}\mathrm{n}\mathrm{t} \mathrm{e}\mathrm{x}\mathrm{c}\mathrm{r}\mathrm{e}\mathrm{t}\mathrm{i}\mathrm{o}\mathrm{n} \left(\mathrm{g}\right)}{\mathrm{n}\mathrm{u}\mathrm{t}\mathrm{r}\mathrm{i}\mathrm{e}\mathrm{n}\mathrm{t} \mathrm{i}\mathrm{n}\mathrm{t}\mathrm{a}\mathrm{k}\mathrm{e} \left(\mathrm{g}\right)}}\times 100$$

$$\mathrm{A}\mathrm{M}\mathrm{E} (\mathrm{k}\mathrm{c}\mathrm{a}\mathrm{l}/\mathrm{k}\mathrm{g}) = {\displaystyle \frac{(\mathrm{G}\mathrm{E}\mathrm{i}\mathrm{n}\mathrm{t}\mathrm{a}\mathrm{k}\mathrm{e} (\mathrm{k}\mathrm{c}\mathrm{a}\mathrm{l}) - \mathrm{G}\mathrm{E} \mathrm{e}\mathrm{x}\mathrm{c}\mathrm{r}\mathrm{e}\mathrm{t}\mathrm{i}\mathrm{o}\mathrm{n} (\mathrm{k}\mathrm{c}\mathrm{a}\mathrm{l}\left)\right)}{\mathrm{D}\mathrm{M}\mathrm{i}\mathrm{n}\mathrm{t}\mathrm{a}\mathrm{k}\mathrm{e} \left(\mathrm{k}\mathrm{g}\right)}}$$

$$\mathrm{A}\mathrm{M}\mathrm{E}\mathrm{n} \left({\displaystyle \frac{\mathrm{k}\mathrm{c}\mathrm{a}\mathrm{l}}{\mathrm{k}\mathrm{g}}}\right)= {\displaystyle \frac{\left(\left(\mathrm{G}\mathrm{E}\mathrm{i}\mathrm{n}\mathrm{t}\mathrm{a}\mathrm{k}\mathrm{e} \left(\mathrm{k}\mathrm{c}\mathrm{a}\mathrm{l}\right)- \mathrm{G}\mathrm{E} \mathrm{e}\mathrm{x}\mathrm{c}\mathrm{r}\mathrm{e}\mathrm{t}\mathrm{i}\mathrm{o}\mathrm{n} \left(\mathrm{k}\mathrm{c}\mathrm{a}\mathrm{l}\right)\right)- 8.22\times \mathrm{N}\mathrm{B}\right)}{\mathrm{D}\mathrm{M}\mathrm{i}\mathrm{n}\mathrm{t}\mathrm{a}\mathrm{k}\mathrm{e} \left(\mathrm{k}\mathrm{g}\right)}}$$

where NB represents nitrogen balance = nitrogen intake (g) − nitrogen excretion (g).

2.3. Oocysts Counting

Approximately 40 g of excreta sample was randomly collected from metabolic cage at d 14 (0 dpi, before the challenge), 18 (4 dpi), 21 (7 dpi), and 28 (14 dpi) days of age. Each cage sample was placed in a separate airtight plastic bag, homogenized thoroughly, and refrigerated. On the same day, 5 g of homogenized samples was diluted in 50 mL of saturated sodium chloride solution. The solution was thoroughly mixed and then allowed to stand for 5 min to enable oocyst flotation. Oocyst counts were determined using McMaster chambers [26] and expressed as the number of oocysts per gram of excreta.

2.4. Histopathological Scoring and Intestinal Morphometry

At 21 days of age (7 dpi), one bird per replicate was euthanized by cervical dislocation, totaling six broiler chickens (n = 6) per treatment group. Microscopic alterations were evaluated using the “I See Inside” (ISI) methodology according to Kraieski [8]. For this purpose, samples of the duodenum, jejunum, ceca, and liver were collected and fixed in Davidson’s solution. Subsequently, the samples were dehydrated, infiltrated, and embedded in paraffin following common histological routines. Blocks were sectioned and stained with hematoxylin and eosin (H&E) plus Alcian Blue for intestinal goblet cell staining [27].

The same histological slides were used for morphometric measurements of the duodenum and jejunum. For this purpose, a trinocular light microscope (model DI-115T, Digilab, Piracicaba, SP, Brazil), coupled with a digital camera (model Newvalue, Digilab, Piracicaba, SP, Brazil), was used. Integral and well-oriented villi were selected, and from each section, 10 villi and 10 crypts were measured. The measurements were taken with the aid of ImageView^® software (version 1.1), and included villus height and width, crypt depth and width, and the villus height-to-crypt depth ratio (Vh:Cd). To calculate the absorption surface area, the method of [28] was applied.

2.5. RNA Extraction

For RNA extraction, duodenal tissue samples (n = 6 per treatment group) were collected from the same broilers, who were euthanized for histomorphological analysis at 21 days of age (7 dpi). This time point was intentionally selected because it represents a critical phase of Eimeria infection, commonly associated with peak intestinal lesions and host inflammatory responses in broiler chickens. Tissue fragments were immediately preserved in 500 μL of RNAlater™ (Thermo Fisher Scientific, Carlsbad, CA, USA) and stored at −80 °C until RNA extraction. Samples were thawed slowly, washed twice with DEPC-treated water, and incubated with 500 μL of TRIzol reagent (Thermo Fisher Scientific, Carlsbad, CA, USA). Next, the microtubes were immersed in liquid nitrogen, and the duodenal tissue was mechanically lysed using an L-BEADER 6 tissue disruptor (Loccus Biotecnologia, Cotia, SP, Brazil). Samples were homogenized for three 30 s cycles, to prevent RNA degradation, using three stainless steel micro-beads. The lysed tissue was then subjected to RNA extraction using the PureLink RNA Mini Kit (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA), following the manufacturer’s instructions. The purity and concentration of DNA and RNA were measured using a NanoDrop™ 2000 spectrophotometer (Applied Biosystems, Thermo Fisher Scientific, Carlsbad, CA, USA).

2.6. cDNA Synthesis and Gene Expression Analysis

A total of 500 ng of RNA was subjected to reverse transcription using the High-Capacity RNA-to-cDNA Kit (Thermo Fisher Scientific, Carlsbad, CA, USA), following the manufacturer’s instructions. The reaction mixture contained 1 μL de 20× Enzyme Mix (including MuLV reverse transcriptase and RNase inhibitor), 4 μL de 2× RT Buffer Mix (including dNTPs, random octamers, and oligo dT-16), and 1 μg of total RNA (4 μL of RNA sample), in a final volume of 20 μL. Reactions were conducted in a Veriti^® Thermal Cycler (Thermo Fisher Scientific, Carlsbad, CA, USA) under the following conditions: 37 °C for 60 min, followed by 95 °C for 5 min.

qPCR assays were used to evaluate the expression of molecular markers related to intestinal health and transporters in broilers (Table 2). qPCR reactions were performed in a StepOnePlus™ Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Carlsbad, CA, USA), in a final volume of 12 μL, containing 1× FastStart SYBR^® Green Master Mix (Applied Biosystems^®, Thermo Fisher Scientific, Carlsbad, CA, USA), 400 nM, and 150 ng/μL (3 μL). The thermal cycling conditions were as follows: 95 °C for 20 s, following 40 cycles of 95 °C for 3 s and 60 °C for 30 s, with a dissociation curve analysis. The threshold line was standardized to the same baseline value across all qPCR.

Relative gene expression levels in the negative control group compared to the groups CC and MON in 7 dpi were normalized using the geometric mean of the Cq values of HPRT and RPLO (Table 2). The expression stability of the reference genes HPRT and RPLO was evaluated using the geNorm algorithm [29]. Genes with M ≤ 1,0 and CV < 40% were considered sufficiently stable according to the MIQE guidelines [30]. Gene expression was calculated using the 2^−(ΔΔCq) method [31].

Table 2. Primer sequences used in qPCR assays for the analysis of gene expressions of molecular markers associated with intestinal health and nutrient transport in broiler duodenal samples.

Gene	Sequence	Reference	Accession Number/GenBank
Hypoxanthine Phophoribosyl-Transferase	F: CCCAAACATTATGCAGACGA	[32]	AJ132697
	R: TGTCCTGTCCATGATGAGC
Ribosomal protein lateral stalk subunit P0	F: TTGTTCATCACCACAAGATT	[33]	NM_204987
	R: CCCATTGTCTCCGGTCTTAA
Zonula Occludens-A	F: CCGCAGTCGTTCACGATCT R: GGAGAATGTCTGAATGGTCTGA	[34]	XM_04689952
Zonula Occludens-B	F: GCCCAGCAGATGGATTACTT R: TGGCCACTTTTCCACTTTTC	[34]	AC192784
Junctional Adhesion Molecule	F: AGACAGGAACAGGCAGTGCT R: TCCAATCCCATTTGAGGCTA	[34]	NM_001397141
Occludin	F: ACGGCAAAGCCAACATCTAC R: ATCCGCCACGTTCTTCAC	[34]	NM_205128
Mucin 2	F: AGGAATGGGCTGCAAGAGAC R: GTGACATCAGGGCACACAGA	[35]	XM 001234581.3
Glucose transporter 2	F: GAAGGTGGAGGAGGCCAAA R: TTTCATCGGGTCACAGTTTCC	[36]	NM_207178.1
Sugar transporter 1	F: TCAGGTCTACCTGTCAATCC R: GAGAATGAAAGATCCCACAA	[37]	NM_001293240.1

F: Forward; R: Reverse.

Table 2. Primer sequences used in qPCR assays for the analysis of gene expressions of molecular markers associated with intestinal health and nutrient transport in broiler duodenal samples.

Gene	Sequence	Reference	Accession Number/GenBank
Hypoxanthine Phophoribosyl-Transferase	F: CCCAAACATTATGCAGACGA	[32]	AJ132697
	R: TGTCCTGTCCATGATGAGC
Ribosomal protein lateral stalk subunit P0	F: TTGTTCATCACCACAAGATT	[33]	NM_204987
	R: CCCATTGTCTCCGGTCTTAA
Zonula Occludens-A	F: CCGCAGTCGTTCACGATCT R: GGAGAATGTCTGAATGGTCTGA	[34]	XM_04689952
Zonula Occludens-B	F: GCCCAGCAGATGGATTACTT R: TGGCCACTTTTCCACTTTTC	[34]	AC192784
Junctional Adhesion Molecule	F: AGACAGGAACAGGCAGTGCT R: TCCAATCCCATTTGAGGCTA	[34]	NM_001397141
Occludin	F: ACGGCAAAGCCAACATCTAC R: ATCCGCCACGTTCTTCAC	[34]	NM_205128
Mucin 2	F: AGGAATGGGCTGCAAGAGAC R: GTGACATCAGGGCACACAGA	[35]	XM 001234581.3
Glucose transporter 2	F: GAAGGTGGAGGAGGCCAAA R: TTTCATCGGGTCACAGTTTCC	[36]	NM_207178.1
Sugar transporter 1	F: TCAGGTCTACCTGTCAATCC R: GAGAATGAAAGATCCCACAA	[37]	NM_001293240.1

F: Forward; R: Reverse.

2.7. Statistical Analyses

All data were initially assessed using the Shapiro–Wilk normality test. Data for performance, nutrient digestibility, and intestinal morphometry were submitted to analysis of variance (ANOVA) using R software (version 4.5.1). A 5% probability level was adopted (p < 0.05), and when significant, group means were compared using Tukey’s test. Oocyst count data were log-transformed prior to being submitted to ANOVA. The ISI index data were analyzed using the Kruskal–Wallis test followed by Dunn’s post hoc test (p < 0.05). For gene expression data, delta Cq values were analyzed. Variables that followed a normal distribution were analyzed using ANOVA and Tukey’s test. For variables in which delta Cq values did not exhibit a normal distribution, the Kruskal–Wallis test was applied, followed by Dunn’s test.

3. Results

3.1. Body Weight Gain, Feed Intake, Feed Conversion Ratio and Body Weight

The performance parameters evaluated are presented in

Table 3. Performance parameter in broilers challenged with Eimeria spp.

Variables	Treatments			SEM	p-Value
	UN	CC	MON
0 to 7 days
BWG, g	147	149	153	1.863	0.616
FI, g	146	150	160	2.547	0.078
FCR	0.992	1.006	1.047	0.012	0.136
BW, g	185	187	191	1.843	0.352
0 to 14 days
BWG, g	490 ab	474 b	526 a	8.143	<0.001
FI, g	632	618	662	9.204	0.123
FCR	1.291	1.306	1.259	0.013	0.314
BW, g	528 ab	512 b	564 a	8.128	0.024
0 to 21 days
BWG, g	1017 a	767 c	866 b	25.995	<0.001
FI, g	1225 a	1021 c	1101 b	22.830	<0.001
FCR	1.205 a	1.333 b	1.273 ab	0.018	0.010
BW, g	1073 a	839 b	896 b	26.010	<0.001
0 to 28 days
BWG, g	1818 a	1484 c	1590 b	36.237	<0.001
FI, g	2312 a	2016 b	2102 b	35.957	<0.001
FCR	1.275 a	1.359 b	1.322 b	0.010	<0.001
BW, g	1856 a	1522 c	1628 b	36.249	<0.001

UN: unchallenged; CC: Eimeria spp.-challenged at 14 days old; MON: CC + monensin (n = 6). BWG: body weight gain; FI: feed intake; FCR: feed conversion ratio; BW: body weight; SEM: standard error of the mean. Values within a row with different superscripts differ by Tukey test at p < 0.05.

. For the first week of the experiment, no significant differences were observed among the treatments for body weight gain (BWG), feed intake (FI), feed conversion ratio (FCR), or body weight (BW) (p > 0.05).

At 14 days of age, broilers in the MON treatment exhibited higher BWG (526 g) compared to the CC group (474 g), while the UN group (490 g) presented an intermediate value (p < 0.001). A similar pattern was observed for BW, where the MON group showed the highest value (564 g) relative to the CC group (512 g), with the UN group being intermediate (528 g); (p = 0.024). For feed intake (FI) and feed conversion ratio (FCR), no significant difference was found among treatments during this period (p > 0.05).

For the 21-day period (7 days post-infection, or 7 dpi), BWG was superior in the UN group (1017 g) compared to the MON (866 g) and CC (767 g) groups, which also showed distinct values from each other (p < 0.001). The same pattern was observed for FI, being highest in UN (1225 g), followed by MON (1101 g) and lowest in CC (1021 g) (p < 0.001). The FCR was better in the UN group (1.205) relative to CC (1.333), while MON (1.273) presented an intermediate result (p = 0.010). For BW, the highest value was observed in UN (1073 g), followed by MON (896 g) and CC (839 g) (p < 0.001).

At 28 days of age (14 dpi), the pattern persisted for BWG, which was highest in the UN broiler chickens (1818 g), followed by MON (1590 g), while CC presented the lowest value (1484 g) (p < 0.001). CC broiler chickens (2016 g) recovered their FI in the final week, equating to broiler chickens that received MON (2102 g), but the highest consumption was observed with UN broiler chickens (2312 g). The same pattern was repeated for FCR, which was better in UN broiler chickens (1.275) than in MON (1.322) and CC (1.359; p < 0.001). Finally, body weight (BW) was significantly superior in UN (1856 g), followed by MON (1628 g), and lowest in CC (1522 g; p < 0.001). The mortality observed was recorded and presented in Table S1.

Daily feed intake post-challenge is presented in Figure 1. Up to 3 days post-infection (dpi), no differences were observed among the treatments (p > 0.05). However, on 4 dpi, a decrease in feed intake was observed in the CC treatment relative to UN and MON. On 5 dpi, a significant reduction in FI was verified in CC group followed by MON when compared to those in the UN group (p < 0.05). From 6 dpi to 11 dpi, CC and MON feed intake were equal, but lower than UN (p > 0.05). After 11 dpi, challenged broilers (MON and CC) were able to recover their feed intake, becoming statistically equal to the UN control.

3.2. Nutrient Digestibility and Metabolizable Energy

Lower coefficients of digestibility for DM, OM, MM, CP, GE, AME, and AMEn, were observed in the CC group when compared to the UN and MON groups (

Table 4. Apparent total tract nutrient digestibility (ATTD), apparent metabolizable energy (AME) and AME corrected (AMEn) in broilers (18 to 20 days old), challenged or not with Emeria ssp., with the addition of monensin.

Parameters	Treatment			SEM	p-Value
	UM	CC	MON
ATTD
DM, %	71.58 a	62.87 b	70.06 a	1.093	<0.001
OM, %	75.97 a	68.63 b	74.69 a	0.931	<0.001
Ash, %	46.11 a	32.35 b	43.02 a	1.653	<0.001
CP, %	69.02 a	59.85 b	66.48 a	1.136	<0.001
GE, %	77.57 a	70.11 b	76.44 a	0.962	<0.001
AME, kcal	3896 a	3521 b	3839 a	48.33	<0.001
AMEn, kcal	3654 a	3312 b	3606 a	44.55	0.001

UN: unchallenged; CC: Eimeria-challenged at 14 days old; MON: CC + monensin (n = 6). DM: dy matter; OM: organic matter; CP: crude protein; GE: gross energy; SEM: standard error of the mean. Values within a row with different superscripts differ by Tukey test at p < 0.05.

) (p < 0.001). No differences were found between UN and MON for any of the apparent total tract digestibility (ATTD), AME, and AMEn variables (p > 0.05).

3.3. Oocysts Shedding

At 14 days of age (0 dpi), before the challenge, the presence of oocysts was not detected in any of the treatments (Figure 2), and counts remained at zero for the UN broiler chickens across the subsequent evaluation days. On 4 dpi, an increase in oocyst shedding was observed, with the CC treatment showing a higher mean count than the MON treatment (p = 0.006). By 7 dpi, both curves (CC and MON) reached the peak of excretion and showed similar means between them. By 14 dpi, counts were reduced in both treatments when compared to the CC peak at 4 dpi. In summary, the excretion dynamic was concentrated between 4 dpi and 7 dpi, with a subsequent decline until 14 dpi, when a recovery trend characterized by reduced counts was observed.

3.4. Intestinal Morphometry of the Duodenum and Jejunum

In the duodenum, the highest villus height values were observed in the MON group, with intermediate values in CC, and the lowest in UN. Crypt depth was greater in CC and MON compared to UN (

Table 5. Intestinal morphometry of the duodenum and jejunum of broilers at 21 days of age (7 days postinfection).

Parameters	Treatment			SEM	p-Value
	UN	CC	MON
Duodenum
Villus height, μm	904 b	1035 ab	1077 a	28.47	0.017
Villus width, μm	213	205	218	6.81	0.697
Crypt depth, μm	111 b	160 a	165 a	7.62	0.001
Crypt width, μm	79.6	78.5	75.7	1.71	0.470
Vh:Cd	8.25	6.63	6.59	0.328	0.066
Absorptive surface, μm2	9.54	11.16	11.35	0.368	0.065
Jejunum
Villus height, μm	682 a	522 b	582 ab	22.59	0.016
Villus width, μm	192	214	216	5.983	0.261
Crypt depth, μm	112 b	153 a	154 a	6.602	0.013
Crypt width, μm	77.41	82.84	83.51	2.381	0.587
Vh:Cd	6.14 a	3.45 b	3.84 b	0.316	<0.01
Absorptive surface, μm2	7.72 a	5.65 b	6.11 b	0.279	0.002

UN: unchallenged; CC: Eimeria-challenged at 14 days old; MON: CC + monensin (n = 6). Vh:Cd: villus height crypt depth ratio. SEM: standard error of the mean. Values within a row with different superscripts differ by Tukey test at p < 0.05.

) (p = 0.001). No differences were observed for villus width, crypt width, or the villus-to-crypt depth ratio (Vh:Cd) (p > 0.05).

In the jejunum, villus height was greatest in the UN group, lowest in CC, and intermediate in MON (p = 0.016). Crypt depth was higher in CC and MON when compared to UN (p = 0.013), which was reflected in the Vh:Cd ratio, being greater in UN compared to the other treatments (p < 0.001). There were no effects for villus width or crypt width (p > 0.05).

3.5. Intestinal Health Index (“I See Inside”)

In the duodenum, the total ISI score was highest in the MON-supplemented broiler chickens (13.28) and lowest in UN (7.35), while CC (9.97) presented intermediate values (

Table 6. I See Inside intestinal health score of the duodenum, jejunum and cecum of broilers at 21 days of age (7 days postinfection).

Parameters	Treatment			SEM	p-Value
	UN	CC	MON
Duodenum
Lamina propria thickness	1.22 b	2.05 a	1.98 a	0.121	0.001
Epithelial thickness	1.13	1.02	1.05	0.051	0.404
Enterocytes’ proliferation	1.03	0.83	0.91	0.053	0.056
Inflammatory cell infiltration in the epithelium	0.53 b	0.77 a	0.79 a	0.057	0.009
Inflammatory cell infiltration in the lamina propria	1.22 b	2.10 a	2.02 a	0.128	<0.001
Goblet cells’ proliferation	1.90 a	1.33 b	1.12 b	0.140	0.007
Congestion	0.33	0.38	0.40	0.074	0.915
Presence of oocysts	0.00 c	1.50 b	5.01 a	0.609	<0.001
Total	7.35 b	9.98 ab	13.28 a	0.825	0.004
Jejunum
Lamina propria thickness	1.23 b	2.32 a	2.04 a	0.136	<0.001
Epithelial thickness	1.08 a	0.88 b	0.93 ab	0.029	0.012
Enterocytes’ proliferation	0.90	0.84	0.90	0.025	0.507
Inflammatory cell infiltration in the epithelium	0.59	0.55	0.61	0.054	0.909
Inflammatory cell infiltration in the lamina propria	1.25 b	2.12 a	1.90 a	0.118	0.003
Goblet cells’ proliferation	2.02 a	0.35 c	0.82 b	0.184	<0.001
Congestion	0.37	1.12	0.54	0.134	0.092
Presence of oocysts	0.00 b	4.53 a	5.73 a	0.640	<0.001
Total	7.43 b	12.70 a	13.47 a	0.755	<0.001
Cecum
Enterocytes’ proliferation	0.43 b	0.40 b	0.92 a	0.072	0.006
Inflammatory cell infiltration in the epithelium	0.03 b	0.47 a	0.32 a	0.056	0.004
Inflammatory cell infiltration in the lamina propria	1.80 b	2.70 a	2.64 a	0.129	0.003
Congestion	0.10	0.50	0.68	0.098	0.081
Presence of oocysts	0.00 b	8.85 a	6.78 a	1.059	<0.001
Total	2.37 b	12.92 a	11.34 a	1.273	<0.001

UN: unchallenged; CC: Eimeria-challenged at 14 days old; MON: CC + monensin (n = 6). SEM: standard error of the mean. Values within a row with different superscripts differ by Dunn test at p < 0.05.

) (p < 0.01). Lamina propria thickness was greater in the CC and MON groups, while UN presented the lowest value (p = 0.001). Epithelial thickness, enterocyte proliferation, and congestion did not vary significantly (p > 0.05). Regarding inflammatory infiltration in both the epithelium and the lamina propria, CC and MON presented higher scores relative to UN (p < 0.01). The goblet cell count was superior (p = 0.007) in UN, while CC and MON showed lower values. Oocyst presence was highest in the MON group, intermediate in the CC group, and absent in UN (p < 0.001).

In the jejunum, the total ISI score was similar between the CC (12.70) and MON (13.47) groups, with the lowest values observed in UN broilers (p < 0.01). The lamina propria was thicker in the CC and MON groups compared to UN (p < 0.001). However, the epithelial thickness was greater in UN, while CC presented the lowest value (p = 0.012). Inflammatory infiltration in the lamina propria was more intense in the CC and MON groups than in UN (p = 0.003). The UN group, in turn, exhibited a greater number of goblet cells, contrasting with the other groups (p < 0.001). The presence of oocysts was again more pronounced in MON and CC, while UN showed no occurrence.

In the ceca, the same scoring pattern as observed in the jejunum was obtained, with MON and CC broiler chickens being similar, and UN broiler chickens presenting lower values. Enterocyte proliferation was significantly higher in the MON group, while CC and UN presented similar values (p = 0.006). Inflammatory infiltration in the epithelium was more pronounced in CC and MON, contrasting with UN, which presented a very low score (p = 0.004). For inflammatory infiltration in the lamina propria, CC and MON presented higher values compared to UN (p = 0.003). Congestion showed no significant difference among the groups (p = 0.081). Oocyst presence was markedly higher in CC and MON, whereas UN showed no occurrence (p < 0.001). The total score reflected these results, being highest in CC and MON, while UN exhibited a significantly lower value (p < 0.001).

3.6. Gene Expression in Duodenum

The gene ZO-A gene was 3-fold less expressed (p < 0.01) in MON group samples, and 1-fold less expressed (p = 0.02) in the CC group (Figure 3), relative to the UN group. Similarly, ZO-B was 2-fold less expressed in the MON group (p = 0.001); however, there was no significant difference between the CC and UN groups (p > 0.05). For the JAM gene, there was also no significant difference in expression in the CC group (p > 0.05) compared to the UN group, and only the MON group was 2-fold less expressed than the UN group (p = 0.05). Meanwhile, the expression of the Occludin gene was 2-fold lower for both the CC group (p = 0.02) and the MON group (p = 0.01) compared to the UN group.

For MUC2 (Figure 4), expression in the CC group was 3-fold (p < 0.01) less expressed than the UN group. The same occurred with samples from the MON group, which were also 3-fold less expressed (p < 0.001) compared to the UN group. Regarding glucose transporters, a decrease in the expression of both genes was verified for both treatments. GLUT2 and SGLT1 presented 7-fold lower expression for the CC group (p < 0.001; p = 0.03) and 6-fold lower expression for the MON group (p = 0.003; p = 0.02), relative to the UN group.

4. Discussion

The medium-to-low doses of Eimeria spp. challenge used in this trial effectively compromised the performance of the broiler chickens, while the inclusion of 100 mg/kg of monensin sodium mitigated performance losses at 7 and 14 days post-infection (dpi). The reduced weight gain in broiler infected with Eimeria spp. is associated with decreased feed intake caused by this pathogen [21]. The cumulative and daily feed intake data support this assumption, clearly showing that MON inclusion delayed the drop in feed consumption until 6 dpi, when it finally equaled the challenged control (CC) group (Figure 1). It is noteworthy that even before the challenge, MON demonstrated its efficacy in improving the broilers’ body weight gain (BWG). It is difficult to explain why the unchallenged (UN) group had an intermediate BWG, as they should have shown the same response as the CC animals before the challenge.

Observing the post-challenge daily feed intake curve confirms that the acute effect of the infection occurred between 4 and 5 dpi, with the CC group showing the sharpest drop in consumption (5 dpi). Furthermore, the recovery of feed intake to the same levels as the UN broiler chickens only occurred from 11 dpi onward, with no compensatory feed intake observed up to 14 dpi. The same pattern was observed in an experiment in which laying hens were subjected to a mixed challenge with Eimeria spp. Feed intake in the challenged groups began to decrease from 4 days post-infection (DPI), with the most pronounced drop occurring at 7 DPI, and no recovery was observed by 15 DPI [38]. Demonstrating that this transient reduced feed intake is a classic behavior in Eimeria spp. enteric infections and has been described as part of the host response to intestinal damage and inflammation [23,39].

This feeding behavior coincides with the peak of oocyst shedding, indicating an interaction between the host response and the progression of infection. The dynamics of oocyst excretion showed a peak in shedding from 4 to 7 dpi in CC birds, which is the expected pattern for challenge models with Eimeria spp. However, the MON group showed a peak in excretion at 7 dpi and maintained counts like the CC group at 14 dpi, corroborating the lesion scores previously described. After the peak, excretion tends to decrease due to the development of immunity and self-limitation of the parasite cycle [40,41]. Previous reports indicate that ionophores control parasitic multiplication and lesion severity but do not necessarily suppress oocyst shedding completely [15,42].

The epithelial damage caused by the challenge with Eimeria spp. can be confirmed by the histopathological scores measured by the I See Inside (ISI) methodology. In this study, the UN group had the lowest total ISI score in the jejunum and ceca. It is interesting to note a lower oocyst count in the duodenum of CC broiler chickens when compared to MON broiler chickens. This may be due to the coccidiostatic effect of monensin, which delayed the peak of infection, as demonstrated by the daily feed intake, and the single-time-point evaluation (7 dpi). E. acervulina peaks 5 days post-infection [43] and is site-specific to the proximal small intestine (duodenum and upper jejunum) [44], while E. tenella is site-specific to the ceca, and E. maxima to the duodenum, jejunum, and ileum, both peaking at 7 dpi. Similarly, higher rates of oocysts in the epithelium in treatments with anticoccidials [45].

The ISI results are consistent with the findings from the intestinal morphometric analysis (villus height, crypt depth, and villus-to-crypt ratio), indicating that both methods agreed on identifying the degree of intestinal compromise in the challenged groups. Eimeria infection caused a reduction in the villus-to-crypt ratio and an increase in crypt depth, reflecting intense epithelial regeneration and loss of absorptive areas. This occurs due to the affinity of Eimeria spp. for the lateral and apical areas of the intestinal villi, so that any damage to the villi resulting from infection will be reflected in the villus-to-crypt ratio, and the increase in crypt depth due suggests an inflammatory process [7].

Consequently, the changes observed in villi and crypts may affect the expression of genes associated with tight epithelial junctions, which are essential for maintaining the intestinal epithelial barrier and defending against various pathogens [46]. The expression of genes in 7 dpi, the ZO-A and Occludin genes in CC and MON, corroborating the hypothesis of damage to the epithelial tight junctions and increased mucosal permeability, reported by Souza [22]. However, for ZO-B and JAM, no significant difference was observed between the Challenged Control (CC) and the Unchallenged (UN) groups, whereas the Monensin (MON) group showed significantly lower expression. This apparent discrepancy can be explained by the chronology of the infection. Since monensin acts by slowing down the parasitic cycle, the peak of oocyst presence and epithelial interaction in the MON group was delayed. Consequently, at the specific sampling time (7 dpi), the MON group exhibited a higher local count of oocysts in the duodenum (corroborated by ISI findings), which correlates with the acute downregulation of these tight junction genes. Conversely, the CC group, which experienced the peak of infection earlier (4–5 dpi), may have already entered the recovery phase by 7 dpi, allowing ZO-2 and JAM expression levels to return to near-basal levels [10].

In addition, the expression of the MUC-2 gene was reduced in the duodenum of challenged of in CC and MON group, which can be explained by the lower proliferation of goblet cells in the duodenum observed with ISI. The primary function of goblet cells is to secrete mucins and create a protective mucus layer. Reducing mucus in the gut compromises the bird’s primary defense barrier, increasing susceptibility to pathogen colonization, infection, and inflammation [47].

Furthermore, a decrease in the expression of glucose transporter genes (SGLT-1 and GLUT-2) was observed in all challenged groups compared to the unchallenged control. However, regarding nutrient utilization, broilers supplemented with monensin (MON) maintained AME and AMEn values similar to the unchallenged group, contrasting with the significant reduction observed in the challenged control (CC). This suggests that monensin mitigated the impact of the challenge on energy retention, even in the presence of reduced transporter gene expression. Recent studies confirm that Eimeria spp. challenge directly compromises intestinal integrity and energy metabolism, resulting in poorer feed conversion and reduced weight gain [48,49,50].

However, these morphometric, histopathological, and gene expression data do not fully align with the digestibility and performance data that were found. Monensin supplementation was able to maintain nutrient digestibility at levels like those of non-challenged broiler chickens. These impacts on digestibility help explain the mitigation of worsening body weight gain and feed conversion ratio, showing that the reduced drop in feed intake was not the only factor in monensin’s action.

Collectively, the results reinforce that Eimeria challenge compromises multiple aspects of intestinal physiology, such as morphology, gene expression, and nutrient digestibility. Although monensin does not completely eliminate the deleterious effects of the challenge on performance, it maintains nutrient digestibility. This improvement does not appear to be related to monensin’s ability to protect the intestinal epithelium from lesions caused by the protozoan, as demonstrated by histological findings and tight junction gene expression.

5. Conclusions

The deleterious effects of medium-to-low doses of mixed Eimeria challenge on performance are linked to both reduced feed intake and intestinal compromise. Monensin supplementation proved effective in mitigating these losses, not by preventing tissue injury, but by ensuring that nutrient digestibility remained unaffected. Thus, the efficacy of monensin in this model relies on its ability to sustain energy and nutrient availability, countering the metabolic costs of the infection.