Mirtrons in Human Cancers
Simple Summary
Abstract
1. Introduction
2. Generation of Canonical miRNAs and Mirtrons
3. Evolutionary Conservation of Mirtrons
4. Gene Ontology Analyses and Potential Implications of Mirtrons in Human Cancers
- Regulation of Oncogenes and Tumor Suppressors
- Influence on Cancer Cell Metabolism
- Promotion of Cell Migration and Metastasis
- Resistance to Therapy
- Immune Evasion
- Epigenetic Regulation
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Lee, R.C.; Feinbaum, R.L.; Ambros, V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993, 75, 843–854. [Google Scholar] [CrossRef] [PubMed]
- Wightman, B.; Ha, I.; Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 1993, 75, 855–862. [Google Scholar] [CrossRef] [PubMed]
- Gebert, L.F.R.; MacRae, I.J. Regulation of microRNA function in animals. Nat. Rev. Mol. Cell Biol. 2019, 20, 21–37. [Google Scholar] [CrossRef] [PubMed]
- Trabucchi, M.; Mategot, R. Subcellular Heterogeneity of the microRNA Machinery. Trends Genet. 2019, 35, 15–28. [Google Scholar] [CrossRef]
- Winter, J.; Jung, S.; Keller, S.; Gregory, R.I.; Diederichs, S. Many roads to maturity: microRNA biogenesis pathways and their regulation. Nat. Cell Biol. 2009, 11, 228–234. [Google Scholar] [CrossRef]
- Miyoshi, K.; Miyoshi, T.; Siomi, H. Many ways to generate microRNA-like small RNAs: Non-canonical pathways for microRNA production. Mol. Genet. Genom. 2010, 284, 95–103. [Google Scholar] [CrossRef]
- Maji, R.K.; Leisegang, M.S.; Boon, R.A.; Schulz, M.H. Revealing microRNA regulation in single cells. Trends Genet 2025, S0168-9525(24)00317-2. [Google Scholar] [CrossRef]
- Curtis, H.J.; Sibley, C.R.; Wood, M.J. Mirtrons, an emerging class of atypical miRNA. Wiley Interdiscip. Rev. RNA 2012, 3, 617–632. [Google Scholar] [CrossRef]
- Westholm, J.O.; Lai, E.C. Mirtrons: microRNA biogenesis via splicing. Biochimie 2011, 93, 1897–1904. [Google Scholar] [CrossRef] [PubMed]
- Butkytė, S.; Čiupas, L.; Jakubauskienė, E.; Vilys, L.; Mocevicius, P.; Kanopka, A.; Vilkaitis, G. Splicing-dependent expression of microRNAs of mirtron origin in human digestive and excretory system cancer cells. Clin. Epigenetics 2016, 8, 33. [Google Scholar] [CrossRef]
- Rainer, J.; Ploner, C.; Jesacher, S.; Ploner, A.; Eduardoff, M.; Mansha, M.; Wasim, M.; Panzer-Grümayer, R.; Trajanoski, Z.; Niederegger, H.; et al. Glucocorticoid-regulated microRNAs and mirtrons in acute lymphoblastic leukemia. Leukemia 2009, 23, 746–752. [Google Scholar] [CrossRef]
- Dudziec, E.; Miah, S.; Choudhry, H.M.; Owen, H.C.; Blizard, S.; Glover, M.; Hamdy, F.C.; Catto, J.W. Hypermethylation of CpG islands and shores around specific microRNAs and mirtrons is associated with the phenotype and presence of bladder cancer. Clin. Cancer Res. 2011, 17, 1287–1296. [Google Scholar] [CrossRef]
- Xia, J.; Joyce, C.E.; Bowcock, A.M.; Zhang, W. Noncanonical microRNAs and endogenous siRNAs in normal and psoriatic human skin. Hum. Mol. Genet. 2013, 22, 737–748. [Google Scholar] [CrossRef]
- Zhao, M.; Hou, Y.; Du, Y.E.; Yang, L.; Qin, Y.; Peng, M.; Liu, S.; Wan, X.; Qiao, Y.; Zeng, H.; et al. Drosha-independent miR-6778-5p strengthens gastric cancer stem cell stemness via regulation of cytosolic one-carbon folate metabolism. Cancer Lett. 2020, 478, 8–21. [Google Scholar] [CrossRef] [PubMed]
- Clement, J.Q.; Qian, L.; Kaplinsky, N.; Wilkinson, M.F. The stability and fate of a spliced intron from vertebrate cells. RNA 1999, 5, 206–220. [Google Scholar] [CrossRef] [PubMed]
- Hesselberth, J.R. Lives that introns lead after splicing. Wiley Interdiscip. Rev. RNA 2013, 4, 677–691. [Google Scholar] [CrossRef] [PubMed]
- Wen, J.; Ladewig, E.; Shenker, S.; Mohammed, J.; Lai, E.C. Analysis of Nearly One Thousand Mammalian Mirtrons Reveals Novel Features of Dicer Substrates. PLoS Comput. Biol. 2015, 11, e1004441. [Google Scholar] [CrossRef] [PubMed]
- Sakai, E.; Miura, Y.; Suzuki-Kouyama, E.; Oka, K.; Tachibana, M.; Kawabata, K.; Sakurai, F.; Mizuguchi, H. A mammalian mirtron miR-1224 promotes tube-formation of human primary endothelial cells by targeting anti-angiogenic factor epsin2. Sci. Rep. 2017, 7, 5541. [Google Scholar] [CrossRef]
- Jones, D.; Li, Y.; He, Y.; Xu, Z.; Chen, H.; Min, W. Mirtron microRNA-1236 inhibits VEGFR-3 signaling during inflammatory lymphangiogenesis. Arterioscler. Thromb. Vasc. Biol. 2012, 32, 633–642. [Google Scholar] [CrossRef] [PubMed]
- Han, J.; Lee, Y.; Yeom, K.H.; Kim, Y.K.; Jin, H.; Kim, V.N. The Drosha-DGCR8 complex in primary microRNA processing. Genes Dev. 2004, 18, 3016–3027. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Iida, J.; Shiimori, M.; Okamura, K. Exportin-5 binding precedes 5′- and 3′-end processing of tRNA precursors in Drosophila. J. Biol. Chem. 2024, 300, 107632. [Google Scholar] [CrossRef]
- Hutvágner, G.; Zamore, P.D. A microRNA in a multiple-turnover RNAi enzyme complex. Science 2002, 297, 2056–2060. [Google Scholar] [CrossRef] [PubMed]
- Flynt, A.S.; Greimann, J.C.; Chung, W.J.; Lima, C.D.; Lai, E.C. MicroRNA biogenesis via splicing and exosome-mediated trimming in Drosophila. Mol. Cell 2010, 38, 900–907. [Google Scholar] [CrossRef] [PubMed]
- Farrell, R.; Pascuzzi, N.; Chen, Y.L.; Kim, M.; Torres, M.; Gollahon, L.; Chen, K.E. Prolactin Drives Iron Release from Macrophages and Uptake in Mammary Cancer Cells through CD44. Int. J. Mol. Sci. 2024, 25, 8941. [Google Scholar] [CrossRef] [PubMed]
- Ruby, J.G.; Jan, C.H.; Bartel, D.P. Intronic microRNA precursors that bypass Drosha processing. Nature 2007, 448, 83–86. [Google Scholar] [CrossRef] [PubMed]
- Okamura, K.; Hagen, J.W.; Duan, H.; Tyler, D.M.; Lai, E.C. The mirtron pathway generates microRNA-class regulatory RNAs in Drosophila. Cell 2007, 130, 89–100. [Google Scholar] [CrossRef] [PubMed]
- Yi, R.; Qin, Y.; Macara, I.G.; Cullen, B.R. Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev. 2003, 17, 3011–3016. [Google Scholar] [CrossRef]
- Zhang, H.; Kolb, F.A.; Brondani, V.; Billy, E.; Filipowicz, W. Human Dicer preferentially cleaves dsRNAs at their termini without a requirement for ATP. EMBO J. 2002, 21, 5875–5885. [Google Scholar] [CrossRef] [PubMed]
- Da Fonseca, B.H.R.; Domingues, D.S.; Paschoal, A.R. mirtronDB: A mirtron knowledge base. Bioinformatics 2019, 35, 3873–3874. [Google Scholar] [CrossRef]
- Hubé, F.; Ulveling, D.; Sureau, A.; Forveille, S.; Francastel, C. Short intron-derived ncRNAs. Nucleic Acids Res. 2017, 45, 4768–4781. [Google Scholar] [CrossRef]
- Hansen, T.B.; Venø, M.T.; Jensen, T.I.; Schaefer, A.; Damgaard, C.K.; Kjems, J. Argonaute-associated short introns are a novel class of gene regulators. Nat. Commun. 2016, 7, 11538. [Google Scholar] [CrossRef] [PubMed]
- Patel, R.; Galagali, H.; Kim, J.K.; Frand, A.R. Feedback between a retinoid-related nuclear receptor and the let-7 microRNAs controls the pace and number of molting cycles in C. elegans. eLife 2022, 11, e80010. [Google Scholar] [CrossRef]
- Garcia-Rodriguez, P.; Hidalgo, L.; Rodriguez-Milla, M.A.; Somovilla-Crespo, B.; Garcia-Castro, J. LIN28 upregulation in primary human T cells impaired CAR T antitumoral activity. Front. Immunol. 2024, 15, 1462796. [Google Scholar] [CrossRef]
- Pasquinelli, A.E.; Reinhart, B.J.; Slack, F.; Martindale, M.Q.; Kuroda, M.I.; Maller, B.; Hayward, D.C.; Ball, E.E.; Degnan, B.; Müller, P.; et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature 2000, 408, 86–89. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Ji, L.; Jing, X.; Zhao, P.; Xia, Q. MicroRNA let-7 targets BmCDK1 to regulate cell proliferation and endomitosis of silk gland in the silkworm, Bombyx mori. Insect Sci. 2024, 31, 1026–1040. [Google Scholar] [CrossRef] [PubMed]
- Shi, L.; Ying, H.; Dai, Y.; Rong, Y.; Chen, J.; Zhou, F.; Wang, S.; Xu, S.; Tong, X.; Zhang, S. Upregulated let-7 expression in the follicular fluid of patients with endometriomas leads to dysfunction of granulosa cells through targeting of IGF1R. Hum. Reprod. 2024, 40, 119–137. [Google Scholar] [CrossRef]
- Erice, P.A.; Huang, X.; Seasock, M.J.; Robertson, M.J.; Tung, H.Y.; Perez-Negron, M.A.; Lotlikar, S.L.; Corry, D.B.; Kheradmand, F.; Rodriguez, A. Downregulation of Mirlet7 miRNA family promotes Tc17 differentiation and emphysema via de-repression of RORγt. eLife 2024, 13, RP92879. [Google Scholar] [CrossRef] [PubMed]
- Ha, M.; Pang, M.; Agarwal, V.; Chen, Z.J. Interspecies regulation of microRNAs and their targets. Biochim. Biophys. Acta 2008, 1779, 735–742. [Google Scholar] [CrossRef]
- Steeman, T.J.; Rubiolo, J.A.; Sánchez, L.E.; Calcaterra, N.B.; Weiner, A.M.J. Conservation of Zebrafish MicroRNA-145 and Its Role during Neural Crest Cell Development. Genes 2021, 12, 1023. [Google Scholar] [CrossRef]
- Xin, M.; Small, E.M.; Sutherland, L.B.; Qi, X.; McAnally, J.; Plato, C.F.; Richardson, J.A.; Bassel-Duby, R.; Olson, E.N. MicroRNAs miR-143 and miR-145 modulate cytoskeletal dynamics and responsiveness of smooth muscle cells to injury. Genes Dev. 2009, 23, 2166–2178. [Google Scholar] [CrossRef] [PubMed]
- Khanal, S.; de Cruz, M.; Strickland, B.; Mansfield, K.; Lai, E.C.; Flynt, A. A tailed mirtron promotes longevity in Drosophila. Nucleic Acids Res. 2024, 52, 1080–1089. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.; Magen, A.; Ast, G. Different levels of alternative splicing among eukaryotes. Nucleic Acids Res. 2007, 35, 125–131. [Google Scholar] [CrossRef]
- Calarco, J.A.; Xing, Y.; Cáceres, M.; Calarco, J.P.; Xiao, X.; Pan, Q.; Lee, C.; Preuss, T.M.; Blencowe, B.J. Global analysis of alternative splicing differences between humans and chimpanzees. Genes Dev. 2007, 21, 2963–2975. [Google Scholar] [CrossRef]
- Dexian, W.; Fan, Z.; Min, L.; Zhimin, F.; Jiulong, M.; Jiahua, J.; Sennan, Q.; Peng, H.; Wenqing, Z.; Kaiqi, F.; et al. CircDUSP16 mediates the effect of triple-negative breast cancer in pirarubicin via the miR-1224-3p/TFDP2 axis. Biochem. Pharmacol. 2024, 232, 116719. [Google Scholar] [CrossRef]
- Huo, Y.; Yuan, D.; Liu, H.; Song, Y. Fusion circRNA F-circEA1 facilitates EML4-ALK1 positive lung adenocarcinoma progression through the miR-4673/SMAD4/ADAR1 axis. Cell. Signal. 2024, 127, 111571. [Google Scholar] [CrossRef]
- He, H.; Chen, Y.; Liang, H.; Che, W.; Chen, H.; Peng, F.; Wu, B. Circular RNA circCHSY1 silencing inhibits the malignant progression of esophageal squamous cell carcinoma. Discov. Oncol. 2024, 15, 84. [Google Scholar] [CrossRef]
- Zhang, Y.; Dai, J.; Deng, H.; Wan, H.; Liu, M.; Wang, J.; Li, S.; Li, X.; Tang, H. miR-1228 promotes the proliferation and metastasis of hepatoma cells through a p53 forward feedback loop. Br. J. Cancer 2015, 112, 365–374. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Lin, S.; Mo, Z.; Jiang, J.; Tang, H.; Wu, C.; Song, J. CircRNA_100395 inhibits cell proliferation and metastasis in ovarian cancer via regulating miR-1228/p53/epithelial-mesenchymal transition (EMT) axis. J. Cancer 2020, 11, 599–609. [Google Scholar] [CrossRef]
- Zhang, Z.; Liu, X.; Chu, C.; Zhang, Y.; Li, W.; Yu, X.; Han, Q.; Sun, H.; Zhu, X.; Chen, L.; et al. MIR937 amplification potentiates ovarian cancer progression by attenuating FBXO16 inhibition on ULK1-mediated autophagy. Cell Death Dis. 2024, 15, 735. [Google Scholar] [CrossRef] [PubMed]
- Ma, Z.; Chen, G.; Chen, Y.; Guo, Z.; Chai, H.; Tang, Y.; Zheng, L.; Wei, K.; Pan, C.; Xia, Y.; et al. MiR-937-3p promotes metastasis and angiogenesis and is activated by MYC in lung adenocarcinoma. Cancer Cell Int. 2022, 22, 31. [Google Scholar] [CrossRef]
- Liu, J. Circ_0000442 functions as a tumor repressor in breast cancer by impacting miR-1229-3p and upregulating ZBTB1. Mamm. Genome 2022, 33, 543–554. [Google Scholar] [CrossRef] [PubMed]
- Hui, W.; Ma, X.; Zan, Y.; Song, L.; Zhang, S.; Dong, L. MicroRNA-1292-5p inhibits cell growth, migration and invasion of gastric carcinoma by targeting DEK. Am. J. Cancer Res. 2018, 8, 1228–1238. [Google Scholar] [PubMed]
- Zhang, P.; Yang, Y.; Qian, K.; Li, L.; Zhang, C.; Fu, X.; Zhang, X.; Chen, H.; Liu, Q.; Cao, S.; et al. A novel tumor suppressor ZBTB1 regulates tamoxifen resistance and aerobic glycolysis through suppressing. J. Biol. Chem. 2020, 295, 14140–14152. [Google Scholar] [CrossRef]
- Dekhne, A.S.; Hou, Z.; Gangjee, A.; Matherly, L.H. Therapeutic Targeting of Mitochondrial One-Carbon Metabolism in Cancer. Mol. Cancer Ther. 2020, 19, 2245–2255. [Google Scholar] [CrossRef] [PubMed]
- Mukherjee, A.; Bilecz, A.J.; Lengyel, E. The adipocyte microenvironment and cancer. Cancer Metastasis Rev. 2022, 41, 575–587. [Google Scholar] [CrossRef]
- Chen, T.; Yan, D.; Cheng, X.; Ji, X.; Bian, J.; Yin, W. miR-1224-5p Enhances Hepatic Lipogenesis by Targeting Adenosine Monophosphate-Activated Protein Kinase α1 in Male Mice. Endocrinology 2018, 159, 2008–2021. [Google Scholar] [CrossRef] [PubMed]
- Luo, Z.; Zang, M.; Guo, W. AMPK as a metabolic tumor suppressor: Control of metabolism and cell growth. Future Oncol. 2010, 6, 457–470. [Google Scholar] [CrossRef]
- Choi, J.Y.; Seok, H.J.; Lee, D.H.; Kwon, J.; Shin, U.S.; Shin, I.; Bae, I.H. miR-1226-5p is involved in radioresistance of colorectal cancer by activating M2 macrophages through suppressing IRF1. J. Transl Med. 2024, 22, 980. [Google Scholar] [CrossRef]
- Moro, J.; Grinpelc, A.; Farré, P.L.; Duca, R.B.; Lacunza, E.; Graña, K.D.; Scalise, G.D.; Dalton, G.N.; Massillo, C.; Piccioni, F.; et al. miR-877-5p as a Potential Link between Triple-Negative Breast Cancer Development and Metabolic Syndrome. Int. J. Mol. Sci. 2023, 24, 16758. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Wang, F.; Wu, H.; Chen, X.; Zhang, Y.; Lin, J.; Cai, Y.; Xiang, J.; He, N.; Hu, Z.; et al. Thymoquinone Suppresses the Proliferation, Migration and Invasiveness through Regulating ROS, Autophagic Flux and miR-877-5p in Human Bladder Carcinoma Cells. Int. J. Biol. Sci. 2021, 17, 3456–3475. [Google Scholar] [CrossRef]
- Wang, W.; Yi, J.; Dong, D.; Mao, W.; Wang, X.; Yan, Z. miRNA-877-5p inhibits malignant progression of prostate cancer by directly targeting SSFA2. Eur. J. Histochem. 2021, 65, 3243. [Google Scholar] [CrossRef] [PubMed]
- Mu, X.; Yu, C.; Zhao, Y.; Hu, X.; Wang, H.; He, Y.; Wu, H. Exosomal miR-1228-5p down-regulates DUSP22 to promotes cell proliferation and migration in small cell lung cancer. Life Sci. 2024, 351, 122787. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Q.; Zeng, H.; Ye, P.; Shi, Y.; Guo, J.; Long, X. Differential microRNA profiles between fulvestrant-resistant and tamoxifen-resistant human breast cancer cells. Anticancer Drugs 2018, 29, 539–548. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.W.; Baek, M.; Jung, S.; Jang, S.; Lee, H.; Yang, S.H.; Kwak, B.S.; Kim, S.J. ELOVL2-AS1 suppresses tamoxifen resistance by sponging miR-1233-3p in breast cancer. Epigenetics 2023, 18, 2276384. [Google Scholar] [CrossRef]
- Torrisi, R.; Vaira, V.; Giordano, L.; Fernandes, B.; Saltalamacchia, G.; Palumbo, R.; Carnaghi, C.; Basilico, V.; Gentile, F.; Masci, G.; et al. Identification of a Panel of miRNAs Associated with Resistance to Palbociclib and Endocrine Therapy. Int. J. Mol. Sci. 2024, 25, 1498. [Google Scholar] [CrossRef] [PubMed]
- Schamberger, A.; Sarkadi, B.; Orban, T.I. Human mirtrons can express functional microRNAs simultaneously from both arms in a flanking exon-independent manner. RNA Biol. 2012, 9, 1177–1185. [Google Scholar] [CrossRef] [PubMed]
- Vasudevan, S.; Tong, Y.; Steitz, J.A. Switching from repression to activation: microRNAs can up-regulate translation. Science 2007, 318, 1931–1934. [Google Scholar] [CrossRef]
- Ørom, U.A.; Nielsen, F.C.; Lund, A.H. MicroRNA-10a binds the 5′UTR of ribosomal protein mRNAs and enhances their translation. Mol. Cell 2008, 30, 460–471. [Google Scholar] [CrossRef]
- Schult, P.; Roth, H.; Adams, R.L.; Mas, C.; Imbert, L.; Orlik, C.; Ruggieri, A.; Pyle, A.M.; Lohmann, V. microRNA-122 amplifies hepatitis C virus translation by shaping the structure of the internal ribosomal entry site. Nat. Commun. 2018, 9, 2613. [Google Scholar] [CrossRef]
- Henke, J.I.; Goergen, D.; Zheng, J.; Song, Y.; Schüttler, C.G.; Fehr, C.; Jünemann, C.; Niepmann, M. microRNA-122 stimulates translation of hepatitis C virus RNA. EMBO J. 2008, 27, 3300–3310. [Google Scholar] [CrossRef]
- Zhang, Y.; Pan, Q.; Shao, Z. Extracellular vesicles derived from cancer-associated fibroblasts carry tumor-promotive microRNA-1228-3p to enhance the resistance of hepatocellular carcinoma cells to sorafenib. Hum. Cell 2023, 36, 296–311. [Google Scholar] [CrossRef] [PubMed]
- Lee, T.Y.; Tseng, C.J.; Wang, J.W.; Wu, C.P.; Chung, C.Y.; Tseng, T.T.; Lee, S.C. Anti-microRNA-1976 as a Novel Approach to Enhance Chemosensitivity in XAF1+ pancreatic and liver cancer. Biomedicines 2023, 11, 1136. [Google Scholar] [CrossRef] [PubMed]
- Tan, S.; Yu, H.; Zhang, Z.; Liu, Y.; Lou, G. Hypoxic tumour-derived exosomal miR-1225-5p regulates M2 macrophage polarisation via toll-like receptor 2 to promote ovarian cancer progress. Autoimmunity 2023, 56, 2281226. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.H.; Wang, L.Y.; Zhang, C.; Zhang, P.; Wang, C.H.; Cheng, S. MiR-1225-5p acts as tumor suppressor in glioblastoma via targeting. Open Med. 2020, 15, 872–881. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Zhang, F.; Li, H. miR-1225-5p inhibits non-small cell lung cancer cell proliferation, migration and invasion, and may be a prognostic biomarker. Exp. Ther. Med. 2020, 20, 172. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Li, X.; Zhang, C.; Zhang, H.; Huang, Y. LINC00973 is involved in cancer immune suppression through positive regulation of Siglec-15 in clear-cell renal cell carcinoma. Cancer Sci. 2020, 111, 3693–3704. [Google Scholar] [CrossRef] [PubMed]
- Young, J.I.; Hong, E.P.; Castle, J.C.; Crespo-Barreto, J.; Bowman, A.B.; Rose, M.F.; Kang, D.; Richman, R.; Johnson, J.M.; Berget, S.; et al. Regulation of RNA splicing by the methylation-dependent transcriptional repressor methyl-CpG binding protein 2. Proc. Natl. Acad. Sci. USA 2005, 102, 17551–17558. [Google Scholar] [CrossRef] [PubMed]
- Wang, H. The RNA m6A writer RBM15 contributes to the progression of esophageal squamous cell carcinoma by regulating miR-3605-5p/KRT4 pathway. Heliyon 2024, 10, e24459. [Google Scholar] [CrossRef]
Size of Intron | # of Mouse Mirtrons (489) | # of Human Mirtrons (479) |
---|---|---|
<100 bp | 125 | 115 |
101–150 bp | 52 | 49 |
151–250 bp | 33 | 53 |
251–500 bp | 60 | 57 |
501–1000 bp | 70 | 68 |
1001–2500 bp | 92 | 71 |
2501–5000 bp | 27 | 47 |
5001–10,000 bp | 19 | 13 |
10,001–50,000 bp | 9 | 6 |
>50,000 bp | 2 | 0 |
Locus | Sequence | Gene Symbol |
---|---|---|
hsa-mir-1224 | GTGAGGACTCGGGAGGTGGAGGGT | VWA5B2 |
hsa-mir-1229 | GTGGGTAGGGTTTGGGGGAGAGCG | MGAT4B |
hsa-mir-3064 | TCTGGCTGTTGTGGTGTGCAA | DDX5 |
hsa-mir-6745-3p | TGGGTGGAAGAAGGTCTGGTT | PACSIN3 |
hsa-mir-6751 | TTGGGGGTGAGGTTGGTGTCTGG | SYVN1 |
hsa-mir-6767 | TCGCAGACAGGGACACATGGAGA | CCNF |
hsa-mir-6777 | ACGGGGAGTCAGGCAGTGGTGGA | SREBF1 |
hsa-mir-877 | GTAGAGGAGATGGCGCAGGGGACA | ABCF1 |
hsa-mirtron-1610-5p | CCAGGGTGGGATGAGGCTTGGGA | FCHO1 |
hsa-mirtron-1259-3p | TAAGCTCCCTGCCTCCTGTAG | CAD |
hsa-mirtron-1488-3p | TGACCACCGTGCCTCTCCCAG | TRIOBP |
hsa-mirtron-1568-5p | GTGTGGAGGGAATGGGGGCTATGT | PKN3 |
hsa-mirtron-1559-3p | CTGAGCCCTGTCCTCCCGCAG | GOLGA2 |
Locus | Sequence | Gene Symbol |
---|---|---|
mmu-mir-1224 | GTGAGGACTGGGGAGGTGGA | Vwa5b2 |
uc007iry.12 | TGTGTGGGCTGGGCTTTTGG | Mgat4b |
mmu-mir-3064 | TCTGGCTGTTGTGGTGTGCAA | Ddx5 |
uc008kvn.5 | TGCGGGCCTGAGTGGAAGGCAGT | Pacsin3 |
mmu-mir-6988 | TGGGGTGGAGAGCTGAGGCCCAG | Syvn1 |
mmu-mir-5134 | TTGGCAGAAAGGGCAGCTGTGA | Ccnf |
mmu-mir-6921 | TGAGGGGCATGAGGTAGGAAGC | Srebf1 |
mmu-mir-877 | GTAGAGGAGATGGCGCAGGGGACA | Abcf1 |
uc009met.10 | TGGGAACAGGAACAGCCTGTGG | Fcho1 |
uc008wwz.19 | ACTGACCCTCCTGTCCCTGCAG | Cad |
mmu-mir-6956 | TGACCGGCCTATCCTCTCAG | Triobp |
uc008jba.8 | GTGAGGAGAGGGCTGGGCTGA | Pkn3 |
uc008jev.23 | CACCTGCCTGCCGTCTCCACAG | Golga2 |
N | High Level GO Category | Genes |
---|---|---|
11 | GO:0006950 response to stress | SCRIB LRP1 RPS6KA1 ABCF1 |
11 | GO:0009893 positive regulation of metabolic process | RPS6KA1 ABCF1 SCRIB LRP1 |
4 | GO:0009056 catabolic process | LRP1 SHMT1 PISD |
4 | GO:0009653 anatomical structure morphogenesis | SCRIB RPS6KA1 LRP1 |
4 | GO:0042221 response to chemical | SHMT1 SCRIB LRP1 |
4 | GO:0044085 cellular component biogenesis | SHMT1 NOP56 DHX30 |
4 | GO:0065009 regulation of molecular function | LRP1 RPS6KA1 SCRIB |
3 | GO:0008283 cell population proliferation | SCRIB RPS6KA1 |
3 | GO:0009719 response to endogenous stimulus | SHMT1 LRP1 |
2 | GO:0002376 immune system process | SCRIB LRP1 |
2 | GO:0040007 growth | RPS6KA1 |
2 | GO:0040011 locomotion | SCRIB LRP1 |
2 | GO:0016049 cell growth | RPS6KA1 |
2 | GO:0023051 regulation of signaling | SCRIB LRP1 |
2 | GO:0032879 regulation of localization | SCRIB LRP1 |
2 | GO:0033036 macromolecule localization | SCRIB LRP1 |
2 | GO:0040008 regulation of growth | RPS6KA1 |
2 | GO:0048870 cell motility | SCRIB LRP1 |
2 | GO:0050793 regulation of developmental process | RPS6KA1 |
2 | GO:0051094 positive regulation of developmental process | RPS6KA1 |
2 | GO:0051234 establishment of localization | LRP1 SCRIB |
2 | GO:0051239 regulation of multicellular organismal process | SCRIB LRP1 |
2 | GO:0051240 positive regulation of multicellular organismal process | SCRIB LRP1 |
2 | GO:0051641 cellular localization | SCRIB LRP1 |
2 | GO:0051674 localization of cell | SCRIB LRP1 |
1 | GO:0000003 reproduction | PHC2 |
1 | GO:0022414 reproductive process | PHC2 |
1 | GO:0002252 immune effector process | LRP1 |
1 | GO:0002682 regulation of immune system process | SCRIB |
1 | GO:0002683 negative regulation of immune system process | SCRIB |
1 | GO:0003006 developmental process involved in reproduction | PHC2 |
1 | GO:0003008 system process | LRP1 |
1 | GO:0006955 immune response | LRP1 |
1 | GO:0007155 cell adhesion | SCRIB |
1 | GO:0009605 response to external stimulus | SCRIB |
1 | GO:0016080 synaptic vesicle targeting | SCRIB |
1 | GO:0019953 sexual reproduction | PHC2 |
1 | GO:0023057 negative regulation of signaling | LRP1 |
1 | GO:0030155 regulation of cell adhesion | SCRIB |
1 | GO:0032504 multicellular organism reproduction | PHC2 |
1 | GO:0040012 regulation of locomotion | LRP1 |
1 | GO:0040013 negative regulation of locomotion | LRP1 |
1 | GO:0042330 taxis | SCRIB |
1 | GO:0045321 leukocyte activation | SCRIB |
1 | GO:0048583 regulation of response to stimulus | LRP1 |
1 | GO:0048609 multicellular organismal reproductive process | PHC2 |
1 | GO:0048646 anatomical structure formation involved in morphogenesis | SCRIB |
1 | GO:0065008 regulation of biological quality | SCRIB |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Y.-L.; Pascuzzi, N.; Ruiz, A.; Chen, K.-H.E. Mirtrons in Human Cancers. Onco 2025, 5, 7. https://doi.org/10.3390/onco5010007
Chen Y-L, Pascuzzi N, Ruiz A, Chen K-HE. Mirtrons in Human Cancers. Onco. 2025; 5(1):7. https://doi.org/10.3390/onco5010007
Chicago/Turabian StyleChen, Yi-Ling, Nicholas Pascuzzi, Alejandro Ruiz, and Kuan-Hui Ethan Chen. 2025. "Mirtrons in Human Cancers" Onco 5, no. 1: 7. https://doi.org/10.3390/onco5010007
APA StyleChen, Y.-L., Pascuzzi, N., Ruiz, A., & Chen, K.-H. E. (2025). Mirtrons in Human Cancers. Onco, 5(1), 7. https://doi.org/10.3390/onco5010007