A Study on the Function of Arginine in the Growth, Immunity, Antioxidant Activity, and Oxygen Carrying-Capacity of Juvenile Gibel Carp (Carassius auratus gibelio)
Abstract
1. Introduction
2. Materials and Methods
2.1. Diets
2.2. Feeding Procedure
2.3. Sampling and Preservation
2.4. Analytical Methods
2.5. RNA Extraction and Real-Time PCR Analysis
2.6. Statistical Analysis
3. Results
3.1. Growth Performance and Whole-Body Composition
3.2. Plasma Biochemical Parameters
3.3. Liver Antioxidant Parameters
3.4. Inflammatory Factor Gene Expression
3.5. Antioxidant-Related Gene Expression
3.6. HIF-1 Pathway-Associated Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Badoni, P.; Nazir, I.; Aier, M.; Maity, P.B.; Samanta, S.; Das, A. Significant Role of Fish Nutrients with Special Emphasis to Essential Fatty Acid in Human Nutrition. Int. J. Curr. Microbiol. Appl. Sci. 2021, 10, 2034–2046. [Google Scholar]
- Ellison, A.R.; Webster TM, U.; Rodriguez-Barreto, D.; de Leaniz, C.G.; Consuegra, S.; Orozco-terWengel, P.; Cable, J. Comparative transcriptomics reveal conserved impacts of rearing density on immune response of two important aquaculture species. Fish Shellfish Immunol. 2020, 104, 192–201. [Google Scholar] [CrossRef]
- He, Z.; Cheng, X.; Kyzas, G.Z.; Fu, J. Pharmaceuticals pollution of aquaculture and its management in China. J. Mol. Liq. 2016, 223, 781–789. [Google Scholar] [CrossRef]
- Shao, Y.; Wang, Y.; Yuan, Y.; Xie, Y. A systematic review on antibiotics misuse in livestock and aquaculture and regulation implications in China. Sci. Total Environ. 2021, 798, 149205. [Google Scholar] [CrossRef] [PubMed]
- Pohlenz, C.; Gatlin, D.M. Interrelationships between Fish Nutrition and Health. Aquaculture 2014, 431, 111–117. [Google Scholar] [CrossRef]
- Liang, H.; Ren, M.; Habte-Tsion, H.M.; Ge, X.P.; Xie, J.; Mi, H.; Xi, B.; Miao, L.; Liu, B.; Zhou, Q.; et al. Dietary arginine affects growth performance, plasma amino acid contents and gene expressions of the TOR signaling pathway in juvenile blunt snout bream, Megalobrama amblycephala. Aquaculture 2016, 461, 1–8. [Google Scholar] [CrossRef]
- Giri, S.S.; Sen, S.S.; Chi, C.; Kim, H.J.; Yun, S.; Park, S.C.; Sukumaran, V. Effect of dietary leucine on the growth parameters and expression of antioxidant, immune, and inflammatory genes in the head kidney of Labeo rohita fingerlings. Vet. Immunol. Immunopathol. 2015, 167, 36–43. [Google Scholar] [CrossRef]
- National Research Council (NRC). Nutrient Requirement of Fish and Shrimp; National Academy Press: Washington, DC, USA, 2011. [Google Scholar]
- Luo, Z.; Liu, Y.J.; Mai, K.S.; Tian, L.X. Advance in researches on arginine requirement for fish: A review. Fish 2004, 28, 450–459. [Google Scholar]
- Wu, G.; Bazer, F.W.; Davis, T.A.; Kim, S.W.; Li, P.; Rhoads, J.M.; Satterfield, M.C.; Smith, S.B.; Spencer, T.E.; Yin, Y. Arginine metabolism and nutrition in growth, health and disease. Amino Acids 2009, 37, 153–168. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Wu, J.; Wang, C.A.; Li, J.; Zhao, Z.; Luo, L.; Xue, D.; Xu, Q. Dietary arginine requirement of juvenile hybrid sturgeon (Acipenser schrenckii ♀ × Acipenser baerii ♂). Aquac. Res. 2017, 48, 5193–5201. [Google Scholar] [CrossRef]
- Tesser, M.B.; Terjesen, B.F.; Zhang, Y.; Portella, M.C.; Dabrowski, K. Free-and peptide-based dietary arginine supplementation for the South American fish pacu (Piaractus mesopotamicus). Aquac. Nutr. 2005, 11, 443–453. [Google Scholar] [CrossRef]
- Chen, H.Y.; Leu, Y.T.; Roelants, I. Effective supplementation of arginine in the diets of juvenile marine shrimp, Penaeus monodon. Aquaculture 1992, 108, 87–95. [Google Scholar] [CrossRef]
- Cheng, Z.; Gatlin, D.M., III.; Buentello, A. Dietary supplementation of arginine and/or glutamine influences growth performance, immune responses and intestinal morphology of hybrid striped bass (Morone chrysops × Morone saxatilis). Aquaculture 2012, 362, 39–43. [Google Scholar] [CrossRef]
- Dawood, M.A.O. Nutritional immunity of fish intestines: Important insights for sustainable aquaculture. Rev. Aquac. 2021, 13, 642–663. [Google Scholar] [CrossRef]
- Oehme, M.; Grammes, F.; Takle, H.; Zambonino-Infante, J.L.; Refstie, S.; Thomassen, M.S.; Rørvik, K.-A.; Terjesen, B.F. Dietary supplementation of glutamate and arginine to Atlantic salmon (Salmo salar L.) increases growth during the first autumn in sea. Aquaculture 2010, 310, 156–163. [Google Scholar] [CrossRef]
- Habte-Tsion, H.M.; Ren, M.; Liu, B.; Ge, X.; Xie, J.; Chen, R. Threonine modulates immune response, antioxidant status and gene expressions of antioxidant enzymes and antioxidantimmune-cytokine-related signaling molecules in juvenile blunt snout bream (Megalobrama amblycephala). Fish Shellfish Immunol. 2016, 51, 189–199. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.B.; Feng, L.; Jiang, W.D.; Liu, Y.; Wu, P.; Jiang, J.; Kuang, S.-Y.; Tang, L.; Zhang, Y.-A.; Zhou, X.Q. The impaired intestinal mucosal immune system by valine deficiency for young grass carp (Ctenopharyngodon idella) is associated with decreasing immune status and regulating tight junction proteins transcript abundance in the intestine. Fish Shellfish Immunol. 2014, 40, 197–207. [Google Scholar] [CrossRef] [PubMed]
- Wen, H.; Feng, L.; Jiang, W.; Liu, Y.; Jiang, J.; Li, S.; Tang, L.; Zhang, Y.; Kuang, S.; Zhou, X. Dietary tryptophan modulates intestinal immune response, barrier function, antioxidant status and gene expression of TOR and Nrf2 in young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2014, 40, 275–287. [Google Scholar] [CrossRef]
- Liang, H.; Ji, K.; Ge, X.; Ren, M.; Liu, B.; Xi, B.; Pan, L. Effects of dietary arginine on antioxidant status and immunity involved in AMPK-NO signaling pathway in juvenile blunt snout bream. Fish Shellfish Immunol. 2018, 78, 69–78. [Google Scholar] [CrossRef] [PubMed]
- Costas, B.; Conceição, L.E.; Dias, J.; Novoa, B.; Figueras, A.; Afonso, A. Dietary arginine and repeated handling increase disease resistance and modulate innate immune mechanisms of Senegalese sole (Solea senegalensis Kaup, 1858). Fish Shellfish Immunol. 2011, 31, 838–847. [Google Scholar] [CrossRef]
- Morris, S.M., Jr. Arginine: Master and commander in innate immune responses. Sci. Signal. 2010, 3, pe27. [Google Scholar] [CrossRef]
- Chen, Z.; Ceballos-Francisco, D.; Guardiola, F.A.; Huang, D.; Esteban, M.Á. The alleviation of skin wound-induced intestinal barrier dysfunction via modulation of TLR signaling using arginine in gilthead seabream (Sparus aurata L.). Fish Shellfish Immunol. 2020, 107, 519–528. [Google Scholar] [CrossRef]
- Zhao, S.; Chen, Z.; Zheng, J.; Dai, J.; Ou, W.; Xu, W.; Ai, Q.; Zhang, W.; Niu, J.; Zhang, Y. Citric acid mitigates soybean meal induced inflammatory response and tight junction disruption by altering TLR signal transduction in the intestine of turbot, Scophthalmus maximus L. Fish Shellfish Immunol. 2019, 92, 181–187. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Liu, Y.; Feng, L.; Jiang, W.D.; Kuang, S.Y.; Jiang, J.; Li, S.-H.; Tang, L.; Zhou, X.Q. Effects of dietary arginine supplementation on growth performance, flesh quality, muscle antioxidant capacity and antioxidant-related signaling molecule expression in young grass carp (Ctenopharyngodon idella). Food Chem. 2015, 167, 91–99. [Google Scholar] [CrossRef] [PubMed]
- Wu, P.; Chen, L.; Cheng, J.; Pan, Y.; Guo, X.; Chu, W.; Zhang, J.; Liu, X. MiRNAs-modulation of Nrf2 signaling networks in regulation oxidative stress of Chinese perch skeletal muscle after fasting treatment. Mar. Biotechnol. 2020, 22, 620–630. [Google Scholar] [CrossRef]
- Wang, B.; Feng, L.; Chen, G.F.; Jiang, W.D.; Liu, Y.; Kuang, S.Y.; Jiang, J.; Tang, L.; Wu, P.; Zhou, X.Q. Jian carp (Cyprinus carpio var. Jian) intestinal immune responses, antioxidant status and tight junction protein mRNA expression are modulated via Nrf2 and PKC in response to dietary arginine deficiency. Fish Shellfish Immunol. 2016, 51, 116–124. [Google Scholar] [CrossRef]
- Liang, H.; Mokrani, A.; Ji, K.; Ge, X.; Ren, M.; Pan, L.; Sun, A. Effects of dietary arginine on intestinal antioxidant status and immunity involved in Nrf2 and NF-κB signaling pathway in juvenile blunt snout bream, Megalobrama amblycephala. Fish Shellfish Immunol. 2018, 82, 243–249. [Google Scholar] [CrossRef]
- Chen, B.X.; Yi, S.K.; Wang, W.F.; He, Y.; Huang, Y.; Gao, Z.X.; Liu, H.; Wang, W.-M.; Wang, H.L. Transcriptome comparison reveals insights into muscle response to hypoxia in blunt snout bream (Megalobrama amblycephala). Gene 2017, 624, 6–13. [Google Scholar] [CrossRef] [PubMed]
- Semenza, G.L. HIF-1 and mechanisms of hypoxia sensing. Curr. Opin. Cell Biol. 2001, 13, 167–171. [Google Scholar] [CrossRef] [PubMed]
- Semenza, G.L. Physiology meets biophysics: Visualizing the interaction of hypoxia-inducible factor 1α with p300 and CBP. Proc. Natl. Acad. Sci. USA 2002, 99, 11570–11572. [Google Scholar] [CrossRef] [PubMed]
- Gong, D.; Wang, X.; Liu, Z.; Liang, J.; Yang, J.; Hu, F.; Wang, S.; Tang, C.; Zhang, C.; Tao, M. Comparative analysis of liver transcriptomes associated with hypoxia tolerance in the gynogenetic blunt snout bream. Aquaculture 2020, 523, 735163. [Google Scholar] [CrossRef]
- Yi, D.; Gu, L.F.; Ding, B.; Li, M.; Hou, Y.; Wang, L.; Gong, J. Effects of dietary silymarin supplementation on growth performance and oxidative status in Carassius auratus gibelio. J. Anim. Vet. Adv. 2012, 11, 3399–3404. [Google Scholar]
- Cui, H.; Wang, Z.; Liu, J.; Wang, Y.; Wang, Z.; Fu, J.; Zhang, M. Effects of a highly purified fucoidan from Undaria pinnatifida on growth performance and intestine health status of gibel carp Carassius auratus gibelio. Aquac. Nutr. 2020, 26, 47–59. [Google Scholar] [CrossRef]
- Liu, W.; Wu, J.P.; Li, Z.; Duan, Z.Y.; Wen, H. Effects of dietary coated protease on growth performance, feed utilization, nutrient apparent digestibility, intestinal and hepatopancreas structure in juvenile Gibel carp (Carassius auratus gibelio). Aquac. Nutr. 2018, 24, 47–55. [Google Scholar] [CrossRef]
- Tu, Y.; Xie, S.; Han, D.; Yang, Y.; Jin, J.; Zhu, X. Dietary arginine requirement for gibel carp (Carassis auratus gibelio var. CAS III) reduces with fish size from 50 g to 150 g associated with modulation of genes involved in TOR signaling pathway. Aquaculture 2015, 449, 37–47. [Google Scholar] [CrossRef]
- Li, M.; Liang, H.; Xie, J.; Chao, W.; Zou, F.; Ge, X.; Ren, M. Diet supplemented with a novel Clostridium autoethanogenum protein have a positive effect on the growth performance, antioxidant status and immunity in juvenile Jian carp (Cyprinus carpio var. Jian). Aquac. Rep. 2021, 19, 100572. [Google Scholar] [CrossRef]
- Liang, H.; Xu, P.; Xu, G.; Zhang, L.; Huang, D.; Ren, M.; Zhang, L. Histidine deficiency inhibits intestinal antioxidant capacity and induces intestinal endoplasmic-reticulum stress, inflammatory response, apoptosis, and necroptosis in Largemouth Bass (Micropterus salmoides). Antioxidants 2022, 11, 2399. [Google Scholar] [CrossRef] [PubMed]
- Zhao, F.; Xu, P.; Xu, G.; Huang, D.; Zhang, L.; Ren, M.; Liang, H. Dietary valine affects growth performance, intestinal immune and antioxidant capacity in juvenile largemouth bass (Micropterus salmoides). Anim. Feed. Sci. Technol. 2023, 295, 115541. [Google Scholar] [CrossRef]
- Khieokhajonkhet, A.; Suwannalers, P.; Aeksiri, N.; Ratanasut, K.; Chitmanat, C.; Inyawilert, W.; Phromkunthong, W.; Kaneko, G. Effects of dietary red pepper extracts on growth, hematology, pigmentation, disease resistance, and growth- and immune-related gene expressions of goldfish (Carassius auratus). Anim. Feed. Sci. Technol. 2023, 301, 115658. [Google Scholar] [CrossRef]
- Yang, K.; Qi, X.; He, M.; Song, K.; Luo, F.; Qu, X.; Wang, G.; Ling, F. Dietary supplementation of salidroside increases immune response and disease resistance of crucian carp (Carassius auratus) against Aeromonas hydrophila. Fish Shellfish Immunol. 2020, 106, 1–7. [Google Scholar] [CrossRef]
- Gu, Y.; Chen, K.; Xi, B.; Xie, J.; Bing, X. Protective effects of paeonol against lipopolysaccharide-induced liver oxidative stress and inflammation in gibel carp (Carassius auratus gibelio). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2022, 257, 109339. [Google Scholar]
- Sun, L.; Wang, Q.; Wang, R.; Sun, K.; Li, S.; Lin, G.; Lei, P.; Xu, H. Effect of dietary poly-γ-glutamic acid on growth, digestive enzyme activity, antioxidant capacity, and TOR pathway gene expression of gibel carp (Carassius auratus gibelio). Aquac. Rep. 2022, 27, 101412. [Google Scholar] [CrossRef]
- Farhat; Khan, M.A. Response of fingerling stinging catfish, Heteropneustes fossilis (Bloch) to varying levels of dietary l-leucine in relation to growth, feed conversion, protein utilization, leucine retention and blood parameters. Aquac. Nutr. 2013, 20, 291–302. [Google Scholar]
- Fournier, V.; Gouillou-Coustans, M.F.; Metailler, R.; Vachot, C.; Moriceau, J.; Le Delliou, H.; Huelvan, C.; Desbruyeres, E.; Kaushik, S.J. Excess dietary arginine affects urea excretion but does not improve N utilisation in rainbow trout Oncorhynchus mykiss and turbot Psetta maxima. Aquaculture 2003, 217, 559–576. [Google Scholar]
- Griffin, M.E.; Wilson, K.A.; Brown, P.B. Dietary arginine requirement of juvenile hybrid striped bass. J. Nutr. 1994, 124, 888–893. [Google Scholar] [PubMed]
- Yu, Y.; Huang, D.; Zhang, L.; Chen, X.; Wang, Y.; Zhang, L.; Ren, M.; Liang, H. Dietary arginine levels affect growth performance, intestinal antioxidant capacity and immune responses in largemouth bass (Micropterus salmoides). Aquac. Rep. 2023, 32, 101703. [Google Scholar]
- Pohlenz, C.; Buentello, A.; le J Helland, S.; Gatlin, D.M., III. Effects of dietary arginine supplementation on growth, protein optimization and innate immune response of channel catfish Ictalurus punctatus (Rafinesque 1818). Aquac. Res. 2014, 45, 491–500. [Google Scholar]
- Prabu, E.; Felix, N.; Uma, A. Dietary arginine requirement in diets of GIFT strain of Nile tilapia, Oreochromis niloticus: Effects on growth performance, whole-body composition, growth-related gene expression and haemato-biochemical responses. Aquac. Res. 2021, 52, 4816–4828. [Google Scholar] [CrossRef]
- Mommsen, T.P. Paradigms of growth in fish. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2001, 129, 207–219. [Google Scholar] [CrossRef]
- Lin, H.Z.; Tan, X.; Zhou, C.P.; Niu, J.; Xia, D.M.; Huang, Z.; Wang, J.; Wang, Y. Effect of dietary arginine levels on the growth performance, feed utilization, non-specific immune response and disease resistance of juvenile golden pompano Trachinotus ovatus. Aquaculture 2015, 437, 382–389. [Google Scholar]
- Yue, Y.R.; Zou, Z.Y.; Zhu, J.L.; Li, D.Y.; Xiao, W.; Han, J.; Yang, H. Effects of dietary arginine on growth performance, feed utilization, haematological parameters and non-specific immune responses of juvenile Nile tilapia (Oreochromis niloticus L.). Aquac. Res. 2015, 46, 1801–1809. [Google Scholar]
- Gu, D.; Zhao, J.; Limbu, S.M.; Liang, Y.; Deng, J.; Bi, B.; Kong, L.; Yan, H.; Wang, X.; Rong, H. Arginine supplementation in plant-rich diets affects growth, feed utilization, body composition, blood biochemical indices and gene expressions of the target of rapamycin signaling pathway in juvenile Asian red-tailed catfish (Hemibagrus wyckoiides). J. World Aquac. Soc. 2022, 53, 133–150. [Google Scholar] [CrossRef]
- Qiang, J.; Tao, Y.F.; Bao, J.W.; Chen, D.J.; Li, H.X.; He, J.; Xu, P. High Fat Diet-Induced miR-122 Regulates Lipid Metabolism and Fat Deposition in Genetically Improved Farmed Tilapia (GIFT, Oreochromis niloticus) Liver. Front. Physiol. 2018, 9, 1422. [Google Scholar]
- Deng, J.; Bi, B.; Kang, B.; Kong, L.; Wang, Q.; Zhang, X. Improving the growth performance and cholesterol metabolism of rainbow trout (Oncorhynchus mykiss) fed soyabean meal-based diets using dietary cholesterol supplementation. Br. J. Nutr. 2013, 110, 29–39. [Google Scholar]
- Lin, Y.; Dengu, J.M.; Miao, L.H.; Simon, B.; Pan, W.J.; Liu, B.; Ge, X.P. Effects of dietary supplementary leucine in a wheat meal-rich diet on the growth performance and immunity of juvenile gibel carp (Carassius auratus gibelio var. CAS III). Aquac. Res. 2021, 52, 1501–1512. [Google Scholar]
- Yi, C.; Liang, H.; Xu, G.; Zhu, J.; Wang, Y.; Li, S.; Ren, M.; Chen, X. Appropriate Dietary Phenylalanine Improved Growth, Protein Metabolism and Lipid Metabolism, and Glycolysis in Largemouth Bass (Micropterus salmoides). Fish Physiol. Biochem. 2022, 50, 349–365. [Google Scholar] [PubMed]
- Kumar, S.; Sahu, N.P.; Pal, A.K.; Sagar, V.; Sinha, A.K.; Baruah, K. Modulation of Key Metabolic Enzyme of Labeo Rohita (Hamilton) Juvenile: Effect of Dietary Starch Type, Protein Level and Exogenous α-Amylase in the Diet. Fish Physiol. Biochem. 2009, 35, 301–315. [Google Scholar] [PubMed]
- Vomund, S.; Schäfer, A.; Parnham, M.J.; Brüne, B.; Von Knethen, A. Nrf2, the master regulator of anti-oxidative responses. Int. J. Mol. Sci. 2017, 18, 2772. [Google Scholar] [CrossRef] [PubMed]
- Timme-Laragy, A.R.; Karchner, S.I.; Franks, D.G.; Jenny, M.J.; Harbeitner, R.C.; Goldstone, J.V.; McArthur, A.G.; Hahn, M.E. Nrf2b, novel zebrafish paralog of oxidant-responsive transcription factor NF-E2-related factor 2 (NRF2). J. Biol. Chem. 2012, 287, 4609–4627. [Google Scholar] [CrossRef]
- Safari, R.; Imanpour, M.R.; Hoseinifar, S.H.; Faheem, M.; Dadar, M.; Van Doan, H. Effects of dietary Lactobacillus casei on the immune, growth, antioxidant, and reproductive performances in male zebrafish (Danio rerio). Aquac. Rep. 2022, 25, 101176. [Google Scholar] [CrossRef]
- Wang, L.; Li, J.; Zhao, Z.; Luo, L.; Du, X.; Xu, Q. Effect of N-carbamoylglutamate supplementation on the growth performance, antioxidant status and immune response of mirror carp (Cyprinus carpio) fed an arginine-deficient diet. Fish Shellfish Immunol. 2019, 84, 280–289. [Google Scholar] [CrossRef] [PubMed]
- Wu, M.; Wu, X.; Lu, S.; Gao, Y.; Yao, W.; Li, X.; Dong, Y.; Jin, Z. Dietary arginine affects growth, gut morphology, oxidation resistance and immunity of hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) juveniles. Br. J. Nutr. 2018, 120, 269–282. [Google Scholar] [CrossRef]
- Zhou, Q.; Jin, M.; Elmada, Z.C.; Liang, X.; Mai, K. Growth, immune response and resistance to Aeromonas hydrophila of juvenile yellow catfish, Pelteobagrus fulvidraco, fed diets with different arginine levels. Aquaculture 2015, 437, 84–91. [Google Scholar] [CrossRef]
- Breuillard, C.; Cynober, L.; Moinard, C. Citrulline and nitrogen homeostasis: An overview. Amino Acids 2015, 47, 685–691. [Google Scholar] [CrossRef]
- Bogdan, C. Nitric oxide synthase in innate and adaptive immunity: An update. Trends Immunol. 2015, 36, 161–178. [Google Scholar] [CrossRef]
- Sikalidis, A.K. Amino acids and immune response: A role for cysteine, glutamine, phenylalanine, tryptophan and arginine in T-cell function and cancer? Pathol. Oncol. Res. 2015, 21, 9–17. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Yin, Y.L.; Li, D.; Kim, S.W.; Wu, G. Amino acids and immune function. Br. J. Nutr. 2007, 98, 237–252. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Z.Y.; Buentello, A.; Gatlin, D.M. Effects of dietary arginine and glutamine on growth performance, immune responses and intestinal structure of red drum, Sciaenops ocellatus. Aquaculture 2011, 319, 247–252. [Google Scholar] [CrossRef]
- Costas, B.; Rego, P.C.N.P.; Conceicao, L.E.C.; Dias, J.; Afonso, A. Dietary arginine supplementation decreases plasma cortisol levels and modulates immune mechanisms in chronically stressed turbot (Scophthalmus maximus). Aquac. Nutr. 2013, 19, 25–38. [Google Scholar] [CrossRef]
- Chen, G.; Liu, Y.; Jiang, J.; Jiang, W.; Kuang, S.; Tang, L.; Tang, L.; Tang, W.; Zhang, Y.-A.; Zhou, X.; et al. Effect of dietary arginine on the immune response and gene expression in head kidney and spleen following infection of Jian carp with Aeromonas hydrophila. Fish Shellfish Immunol. 2015, 44, 195–202. [Google Scholar] [CrossRef] [PubMed]
- Hoseini, S.M.; Vatnikov, Y.A.; Kulikov, E.V.; Petrov, A.K.; Hoseinifar, S.H.; Van Doan, H. Effects of dietary arginine supplementation on ureagenesis and amino acid metabolism in common carp (Cyprinus carpio) exposed to ambient ammonia. Aquaculture 2019, 511, 734209. [Google Scholar] [CrossRef]
- Wanner, R.M.; Spielmann, P.; Stroka, D.M.; Camenisch, G.; Wenger, R.H. Epolones induce erythropoietin expression via hypoxia-inducible factor-1α activation. Blood 2000, 96, 1558–1565. [Google Scholar] [CrossRef]
- Shweiki, D.; Itin, A.; Soffer, D.; Keshet, E. Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature 1992, 359, 843–845. [Google Scholar] [CrossRef] [PubMed]
- Lee, P.; Jiang, B.; Chin, B.Y.; Iyer, N.; Alam, J.; Semenza, G.; Choi, A. Hypoxia-inducible Factor-1 Mediates Transcriptional Activation of the Heme Oxygenase-1 Gene in Response to Hypoxia. J. Biol. Chem. 1997, 272, 5375–5381. [Google Scholar] [CrossRef]
- Tacchini, L.; Bianchi, L.; Bernelli-Zazzera, A.; Cairo, G. Transferrin receptor induction by hypoxia. HIF-1-mediated transcription-al activation and cell-specific post-transcriptional regulation. J. Biol. Chem. 1999, 274, 24142–24146. [Google Scholar] [CrossRef] [PubMed]
- Wiśniewska, A.; Płoszczyca, K.; Czuba, M. Changes in erythropoietin and vascular endothelial growth factor following the use of different altitude training concepts. J. Sports Med. Phys. Fit. 2020, 60, 677–684. [Google Scholar] [CrossRef] [PubMed]
- Pichavant, K.; Person-Le-Ruyet, J.; Bayon, N.L.; Severe, A.; Roux, A.L.; Boeuf, G. Comparative effects of long-term hypoxia on growth, feeding and oxygen consumption in juvenile turbot and European sea bass. J. Fish Biol. 2001, 59, 875–883. [Google Scholar]
- Hochachka, P.W. Oxygen—A key regulatory metabolite in metabolic defense against hypoxia. Am. Zool. 1997, 37, 595–603. [Google Scholar] [CrossRef]
- Gong, W.; Hao, B.; Mansy, S.S.; Gonzalez, G.; Gilles-Gonzalez, M.A.; Chan, M.K. Structure of a biological oxygen sensor: A new mechanism for heme-driven signal transduction. Proc. Natl. Acad. Sci. USA 1998, 95, 15177–15182. [Google Scholar] [CrossRef]
- Bunn, H.F.; Gu, J.; Huang, L.E.; Park, J.W.; Zhu, H. Erythropoietin: A model system for studying oxygen-dependent gene regulation. J. Exp. Biol. 1998, 201, 1197–1201. [Google Scholar] [CrossRef]
- Bergamini, C.M.; Gambetti, S.; Dondi, A.; Cervellati, C. Oxygen, reactive oxygen species and tissue damage. Curr. Pharm. Des. 2004, 10, 1611–1626. [Google Scholar] [CrossRef] [PubMed]
Ingredients | Diet 1 | Diet 2 | Diet 3 | Diet 4 | Diet 5 |
---|---|---|---|---|---|
Fish meal | 14 | 14 | 14 | 14 | 14 |
Chicken meal | 4 | 4 | 4 | 4 | 4 |
Soybean meal | 22 | 22 | 22 | 22 | 22 |
Cotton meal | 5 | 5 | 5 | 5 | 5 |
Rapeseed meal | 22 | 22 | 22 | 22 | 22 |
Wheat meal | 14.15 | 14.15 | 14.15 | 14.15 | 14.15 |
Rice bran | 10 | 10 | 10 | 10 | 10 |
Soybean oil | 4 | 4 | 4 | 4 | 4 |
Monocalcium phosphate | 2 | 2 | 2 | 2 | 2 |
F11V Vitamin Premix for Carnivorous Fish | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 |
F29M Trace element premix for omnivorous fish | 2 | 2 | 2 | 2 | 2 |
L-lysine (98.5%) | 0.3 | 0.3 | 0.3 | 0.3 | 0.3 |
L-methionine | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 |
Vc Phospholipid | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 |
Choline Chloride (60%) | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 |
L-Glycine | 0.8 | 0.6 | 0.4 | 0.2 | 0 |
L-Arg | 0 | 0.2 | 0.4 | 0.6 | 0.8 |
Analyzed proximate composition | |||||
Crude protein (%) | 38.45 | 38.71 | 38.78 | 38.78 | 38.46 |
Crude lipid (%) | 6.25 | 6.18 | 6.62 | 6.46 | 6.22 |
Gross energy (MJ/Kg) | 15.81 | 15.76 | 15.83 | 15.80 | 15.77 |
Items | Methods | Assay Kits/Testing Equipment |
---|---|---|
Composition of diets/ingredients/Fish | ||
Moisture | Drying method | Electric blast drying oven (Shanghai Yiheng Scientific Instrument Co., Ltd., Shanghai, China) |
Protein | Kjeldahl | Auto kieldahl apparatus: Hanon K1100 (Jinan Hanon Instruments Co., Ltd., Jinan, China) |
Lipid | Soxhlet | Auto fat analysis: Hanon SOX606 (Jinan Hanon Instruments Co., Ltd., Jinan, China) |
Ash | Combustion | Muffle: XL-2A (Hangzhou Zhuochi Instrument Co., Ltd., Hangzhou, China) |
Plasma parameters | ||
Albumin (ALB) Total cholesterol (TC) Triglyceride (TG) | International Federation of Clinical Chemistry recommended | Assay kits purchased from Mindray Medical International Ltd. (Shenzhen, China); Mindray BS-400 automatic biochemical analyzer (Mindray Medical International Ltd., Shenzhen, China). |
Alanine transaminase (ALT) Aspartic transaminase (AST) | ||
Superoxide dismutase (SOD) Malondialdehyde (MDA) Catalase (CAT) | Liver antioxidant capacity WST-1 method TBA method Ammonium molybdenum acid method | Assay kits purchased from Jian Cheng Bioengineering Institute (Nanjing, China), Spectrophotometer (Thermo Fisher Multiskan GO, Shanghai, China). |
Genes | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Accession Number/Reference |
---|---|---|---|
il-10 | AGTGAGACTGAAGGAGCTCCG | TGGCAGAATGGTGTCCAAGTA | [40] |
tgf-β | GTTGGCGTAATAACCAGAAGG | AACAGAACAAGTTTGTACCGATAAG | [41] |
il-1β | GCGCTGCTCAACTTCATCTTG | GTGACACATTAAGCGGCTTCA C | [41] |
il-8 | ATTGGTGAAGGAATGAGTCT | CCACAGATGACCTTGACAT | KC184490.1 |
tnf-α | CATTCCTACGGATGGCATTTACTT | CCTCAGGAATGTCAGTCTTGCAT | [41] |
nf-κb | GCTCTGACTGCGGTCTTATAC | GCGCTTCATCGAGGATAGTT | [42] |
gpx | GAAGTGAACGGTGTGAACGC | GATCCCCCATCAAGGACACG | DQ983598.1 |
cat | TGAAGTTCTACACCGATGAG | CTGAGAGTGGACGAAGGA | XM_026238665.1 |
sod | TCGGAGACCTTGGTAATGT | CGCCTTCTCATGGATCAC | JQ776518.1 |
κeap1 | CTCCGCTGAATGCTACAA | GGTCATAACACTCCACACT | XM_026245355.1 |
Nrf2 | TACCAAAGACAAGCAGAAGAAACG | GCCTCGTTGAGCTGGTGTTTGG | [43] |
hif-1α | CTGCCGATCAGTCTGTCTCC | TTTGTGGAGTCTGGACCACG | DQ306727.1 |
vegf | ATCGAGCACACGTACATCCC | CCTTTGGCCTGCATTCACAC | NM_131408.3 |
epo | CGAAGTGTCAGCATACCGGA | GCAGATGACGCACTTTTCCC | KC460317.1 |
β-actin | TCCATTGTTGGACGACCCAG | TGGGCCTCATCTCCCACATA | LC382464.1 |
Arg Addition Levels (%) | 1 IBW(g) | 2 FBW(g) | 3 WGR (%) | 4 SGR(%/day) | 5 FCR |
---|---|---|---|---|---|
0 | 27.45 ± 0.08 | 80.13 ± 1.56 | 191.93 ± 0.06 | 1.15 ± 0.02 a | 1.24 ± 0.04 b |
0.2 | 27.52 ± 0.06 | 82.83 ± 0.44 | 201.00 ± 0.02 | 1.18 ± 0.01 ab | 1.18 ± 0.01 ab |
0.4 | 27.53 ± 0.03 | 84.81 ± 1.41 | 208.03 ± 0.05 | 1.21 ± 0.02 b | 1.17 ± 0.02 ab |
0.6 | 27.50 ± 0.06 | 84.50 ± 0.47 | 207.27 ± 0.02 | 1.21 ± 0.01 b | 1.15 ± 0.00 a |
0.8 | 27.47 ± 0.06 | 84.05 ± 1.07 | 206.00 ± 0.03 | 1.20 ± 0.01 ab | 1.15 ± 0.01 a |
p-value | |||||
Linear trend | 0.926 | 0.022 | 0.019 | 0.025 | 0.008 |
Quadratic trend | 0.487 | 0.010 | 0.011 | 0.017 | 0.012 |
Arg Addition Levels (%) | Moisture (%) | Lipid (%) | Ash (%) | Protein (%) |
---|---|---|---|---|
0 | 73.86 ± 0.45 | 3.59 ± 0.32 | 5.42 ± 0.33 | 15.78 ± 0.53 |
0.2 | 73.70 ± 0.85 | 3.73 ± 0.82 | 5.67 ± 0.15 | 16.01 ± 0.11 |
0.4 | 74.54 ± 0.77 | 3.74 ± 0.68 | 4.68 ± 0.36 | 15.68 ± 0.3 |
0.6 | 73.01 ± 0.53 | 3.79 ± 0.42 | 5.07 ± 0.54 | 16.29 ± 0.22 |
0.8 | 75.52 ± 0.15 | 2.29 ± 0.37 | 5.15 ± 0.18 | 16.25 ± 0.26 |
p-value | ||||
Linear trend | 0.263 | 0.177 | 0.399 | 0.220 |
Quadratic trend | 0.299 | 0.123 | 0.484 | 0.456 |
Arg Addition Levels (%) | ALB (g/L) | ALT (U/L) | AST (U/L) | TC (mmol/L) | TG (mmol/L) |
---|---|---|---|---|---|
0 | 8.59 ± 0.24 | 0.76 ± 0.1 ab | 166.3 ± 9.45 | 6.86 ± 0.58 | 1.33 ± 0.06 |
0.2 | 8.77 ± 0.42 | 0.44 ± 0.11 a | 169.44 ± 10.09 | 7.00 ± 0.35 | 1.29 ± 0.10 |
0.4 | 8.86 ± 0.41 | 1.12 ± 0.22 bc | 185.37 ± 13.85 | 7.10 ± 0.43 | 1.41 ± 0.13 |
0.6 | 8.19 ± 0.35 | 1.47 ± 0.18 c | 166.32 ± 9.78 | 6.21 ± 0.37 | 1.23 ± 0.09 |
0.8 | 7.96 ± 0.49 | 1.53 ± 0.23 c | 171.88 ± 9.49 | 6.20 ± 0.49 | 1.25 ± 0.10 |
p-value | |||||
Linear trend | 0.137 | 0.000 | 0.811 | 0.143 | 0.477 |
Quadratic trend | 0.184 | 0.000 | 0.730 | 0.258 | 0.694 |
Arg Addition Levels (%) | CAT (U/mgprot) | SOD (U/mgprot) | MDA (nmol/mgprot) |
---|---|---|---|
0 | 7.45 ± 2.37 a | 28.08 ± 0.65 | 6.00 ± 0.17 |
0.2 | 18.25 ± 2.09 bc | 26.90 ± 0.85 | 5.89 ± 0.64 |
0.4 | 23.15 ± 2.04 c | 26.81 ± 0.83 | 6.17 ± 0.66 |
0.6 | 18.42 ± 2.43 bc | 26.79 ± 0.64 | 5.99 ± 1.02 |
0.8 | 13.10 ± 1.75 ab | 26.25 ± 1.25 | 7.04 ± 1.02 |
p-value | |||
Linear trend | 0.373 | 0.165 | 0.123 |
Quadratic trend | 0.000 | 0.354 | 0.314 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Zhang, L.; Ren, M.; Liang, H.; Mi, H.; Huang, D. A Study on the Function of Arginine in the Growth, Immunity, Antioxidant Activity, and Oxygen Carrying-Capacity of Juvenile Gibel Carp (Carassius auratus gibelio). BioTech 2024, 13, 56. https://doi.org/10.3390/biotech13040056
Li Y, Zhang L, Ren M, Liang H, Mi H, Huang D. A Study on the Function of Arginine in the Growth, Immunity, Antioxidant Activity, and Oxygen Carrying-Capacity of Juvenile Gibel Carp (Carassius auratus gibelio). BioTech. 2024; 13(4):56. https://doi.org/10.3390/biotech13040056
Chicago/Turabian StyleLi, Yuqun, Lu Zhang, Mingchun Ren, Hualiang Liang, Haifeng Mi, and Dongyu Huang. 2024. "A Study on the Function of Arginine in the Growth, Immunity, Antioxidant Activity, and Oxygen Carrying-Capacity of Juvenile Gibel Carp (Carassius auratus gibelio)" BioTech 13, no. 4: 56. https://doi.org/10.3390/biotech13040056
APA StyleLi, Y., Zhang, L., Ren, M., Liang, H., Mi, H., & Huang, D. (2024). A Study on the Function of Arginine in the Growth, Immunity, Antioxidant Activity, and Oxygen Carrying-Capacity of Juvenile Gibel Carp (Carassius auratus gibelio). BioTech, 13(4), 56. https://doi.org/10.3390/biotech13040056