Next Article in Journal
Characterization and Comparison of Lipids in Yak Colostrum, Buffalo Colostrum, and Cow Colostrum Based on UHPLC-QTOF-MS Lipidomics
Previous Article in Journal
Enrichment in Bioactive, Techno-Functional and Health Benefits of Yogurt Fortified with Cranberry (Cornus mas L.)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Dairy
Volume 6
Issue 2
10.3390/dairy6020013
dairy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Presence of Aminoglycoside and β-Lactam-Resistant Pseudomonas aeruginosa in Raw Milk of Cows

by
Yining Meng
1,
Wen Zhu
1,
Shitong Han
1,
Hui Jiang
1,
Jie Chen
1,
Zhou Zhou
1,
Xiaoli Hao
1,
Tianle Xu
2,3,
Aijian Qin
1,2,
Zhangping Yang
2,3,
Shaobin Shang
1,2 and
Yi Yang
1,2,*
1
Jiangsu Co-Innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, College of Veterinary Medicine, Yangzhou University, Yangzhou 225009, China
2
International Corporation Laboratory of Agriculture and Agricultural Products Safety, Yangzhou University, Yangzhou 225009, China
3
College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, China
*
Author to whom correspondence should be addressed.
Dairy 2025, 6(2), 13; https://doi.org/10.3390/dairy6020013
Submission received: 24 November 2024 / Revised: 15 March 2025 / Accepted: 20 March 2025 / Published: 25 March 2025
(This article belongs to the Section Dairy Animal Health)
Versions Notes

Abstract

:
Pseudomonas aeruginosa is a ubiquitous environmental bacterium that causes a variety of infections in humans and animals. Although antibiotic resistance in livestock has been extensively documented, continuous surveillance remains crucial for tracking emerging resistance trends and assessing control measures. During 2017 and 2018, 234 strains of P. aeruginosa were identified from 1063 strains of pathogenic and nonpathogenic bacteria isolated from raw milk of healthy and mastitis cows. In this study, 132 convenience P. aeruginosa isolates were recovered and tested for antimicrobial susceptibility and the presence of antimicrobial resistance genes and virulence factors. Antimicrobial susceptibility testing revealed that these P. aeruginosa isolates were resistant to three (gentamicin, tobramycin, and ceftazidime) out of eight antibiotics. Real-time PCR targeting 21 antibiotic resistance genes indicated that aminoglycoside modifying enzyme (AME) gene ant(3″)-I was most frequently identified in both antimicrobial-resistant and -susceptible P. aeruginosa isolates, followed by aac(6′)-II and aac(6′)-Ib. The β-lactamase encoding gene, blaPDC, was mainly identified in susceptible P. aeruginosa isolates. Virulence factors screening revealed the presence of exoS, exoT, exoU, pyo, aprA, toxA, plcH, algD, lasB, lasI, lasR, rh1L, and rh1R in resistant isolates, with the detection rates ranging from 16.7% to 88.9%. Additionally, next-generation sequencing was conducted on three resistant isolates to validate these findings. This study showed the antibiotic resistance of P. aeruginosa in raw milk samples from large-scale dairy farms in Jiangsu and Shandong provinces, China.

1. Introduction

Pseudomonas aeruginosa, a Gram-negative opportunistic pathogen in the Pseudomonas genus, is commonly found in soil, water, plants, and sometimes animals, including humans. A species of considerable medical importance, P. aeruginosa, has recently been designated as an antibiotic-resistant “priority pathogen” by the World Health Organization (WHO) [1]. In dairy environments, other Pseudomonas species, like Pseudomonas fluorescens and Pseudomonas putida, are common spoilage microorganisms found in raw milk. These bacteria produce heat-stable enzymes that degrade milk proteins and fats, reducing quality and shelf life [2]. Although P. aeruginosa is less frequently identified as a spoilage bacterium or a primary pathogen in bovine mastitis, its presence in dairy environments raises significant concerns due to its potential role in harboring and disseminating antibiotic resistance genes.
Mastitis is the most common disease of dairy cattle and has been well-recognized to detrimentally affect animal health and well-being, as well as the profitability of dairy farms [3]. In the treatment of bovine mastitis, antibiotics are frequently administered without reference to bacterial isolation and susceptibility antibiotic testing. Instead, veterinarians make subjective judgments based on their experience [4]. This practice results in the inappropriate use of antibiotics, which has led to a series of antibiotic resistance problems [5]. Intramammary bacterial infections are proposed to be the major cause of bovine mastitis [6]. To date, more than 150 pathogenic bacteria have been identified to be associated with clinical mastitis (CM) or subclinical mastitis (SCM) in cows [7], of which a wide range of them were environmental pathogens, including but not limited to coliforms species, i.e., Streptococcus spp. and Pseudomonas spp. [8,9,10]. P. aeruginosa, one of the Gram-negative environmental pathogens in dairy farms, usually infects and colonizes the mammary tissues through the end of the nipples [11,12]. In 2018, a P. aeruginosa-induced mastitis occurred in an Austrian dairy herd, subsequent antimicrobial resistance testing revealed that all isolates were susceptible to 10 kinds of antibiotics, including piperacillin-Tazobactam, imipenem and cefepime [13], while Egyptian isolates showed higher resistance to multiple antibiotics, including imipenem and cefepime, and reported the presence of mcr-3 and mcr-7 in cow milk [14]. In a study examining SCM milk samples from different dairy farms in West Bengal, 5.4% cases of SCM cases were associated with P. aeruginosa infections, and these bacteria were identified to contain pathogenic genes such as toxA (63.2%) and exoS (36.8%) [15].
Worldwide, P. aeruginosa is known to cause mastitis in dairy cattle and to be a major multidrug-resistant (MDR) bacteria that causes infections in humans. Its increasing antibiotic resistance emphasizes the need for continuous monitoring to reduce the risk of resistance spread. Recently, bacteria recovered from nasal swabs collected from apparently healthy cattle in China showed that P. aeruginosa isolates had the highly resistance [16]. However, as an important agricultural product, there have been few reports regarding the presence of antibiotic-resistant P. aeruginosa in raw milk produced by healthy and CM cows, especially in China. Therefore, this study aimed to investigate the antimicrobial resistance and virulence profiles of P. aeruginosa isolates from cows’ raw milk in China.

2. Materials and Method

2.1. P. aeruginosa Strains

Convenience P. aeruginosa samples (n = 234) were isolated from raw milk of 57 CM and 800 apparently healthy cows in four large-scale (2200–4000 heads) and geographically dispersed farms (A, B, C, and D) between 2017 and 2018 for an epidemiological survey of multidrug-resistant Klebsiella pneumoniae [17]. The four farms were located in Sihong (A, 33.1–33.4° N, 117.6–118.5° E), Huaian (B, 30.5–35.2° N, 116.2–121.5° E), Rizhao (C, 35.0–36.0° N, 118.3–119.4° E), and Xuyu (D, 32.4–33.1° N, 118.1–118.5° E), respectively. Milk samples from cows with CM were collected from visibly affected quarters before the initiation of antibiotic treatment. One additional round of bacterial species identification was performed on these samples. Briefly, 100 µL of each milk sample was streaked onto blood agar and MacConkey agar plates (Oxoid, Basingstoke, UK) and incubated aerobically at 37 °C for 24–48 h. Samples were considered culture-positive if bacterial growth was observed. Based on colony morphology, a representative colony was streaked onto blood agar or MacConkey agar for further purification. If colonies of different morphologies appeared, an additional subculture was performed to ensure purity. A single colony was then selected and expanded in nutrient broth (Oxoid, UK) at 37 °C for 24–48 h before being preserved in 15% glycerol at −80 °C for long-term storage.

2.2. Diagnosis of Bovine CM

The preliminary diagnosis of CM primarily relies on a clinical examination of the health status of cows, including assessing for signs of fever, weakness, or loss of appetite. It also involves assessing the mammary gland for clinical signs of mastitis, such as swelling, increased warmth, and redness, as well as evaluating changes in milk appearance, including the presence of flakes or clots and a watery consistency [3,18]. To differentiate between subclinical mastitis (SCM) and non-mastitis cows, 20 mL of milk samples from each suspected cow were preserved with 0.015 g of potassium dichromate and sent to Jiangsu dairy herd improvement (DHI) center (Nanjing, China) for the determination of somatic cell count (SCC). A threshold of 200,000 cells/mL was used to determine the presence or absence of SCM in these cows [19].

2.3. Antimicrobial Susceptibility Testing

The antimicrobial susceptibility of these P. aeruginosa isolates was preliminarily detected using the Kirby–Bauer disc diffusion method with following antibiotics: 100 μg of piperacillin, 5 μg of ofloxacin, 30 μg of amikacin, 30 μg of ceftazidime, 10 μg of imipenem, 10 μg of gentamicin, 10 μg of tobramycin, and 5 μg of ciprofloxacin [20,21,22]. The tests were performed on Mueller–Hinton agar (MHA) with an inoculum equivalent to 0.5 McFarland standards. The zones of inhibition were measured by vernier caliper (0.01 millimetre), and the isolates were defined as susceptible, intermediate, or resistant according to Clinical Laboratory Standards Institute (CLSI) M100-Ed34 guidelines [23]. In addition, broth microdilution method was performed to determine the minimum inhibitory concentrations (MICs) of all the resistant and intermediate P. aeruginosa isolates according to the recommendations of CLSI M100-Ed34 [23]. Briefly, bacterial inoculum colonies of each P. aeruginosa isolate from an overnight culture on nutrient agar were used to prepare suspensions equivalent to a 0.5 McFarland standard. A series of antibiotic concentrations was prepared using a two-fold serial dilution method in nutrient broth within 96-well microtiter plates (Corning, NY, USA) to achieve appropriate concentration gradients. Each well was inoculated with the bacterial suspension at a final concentration equivalent to 0.5 McFarland standard. The microtiter plates were then incubated at 37 °C aerobically for 20–24 h and measured at 600 nm using an Infinite M200 PRO system (TECAN, Männedorf, Switzerland). All antimicrobial susceptibility tests were performed in triplicate with P. aeruginosa ATCC 27853 as a quality control.

2.4. Antibiotic Resistance Genes and Virulence Factors Analysis

Bacterial cultures were cultured overnight in nutrient broth at 37 °C before DNA extraction. Genomic DNA was extracted from 200 μL culture solution according to the manufacturer’s protocol using a high-purity PCR template preparation kit (Roche, Basel, Switzerland). Genomic identification of the 16S rDNA gene was performed using forward and reverse primers (Table 1). A total of 132 P. aeruginosa isolates were screened for genes encoding β-lactamase (blaAIM, blaPDC, blaCTX-M, blaGIM, blaIMP, blaKPC, blaNDM-1, blaOXA-51, blaSHV, blaSIM, blaSPM, blaTEM, blaVEB, blaVIM), aminoglycoside modifying enzyme (aac(3′)-I, aac(6′)-Ib, aac(6′)-II, ant(2″)-Ia, ant(3″)-I) and virulence factors (exoS, exoT, exoU, pyo, aprA, toxA, plcH, algD, lasB, lasI, lasR, rh1L, rh1R). Real-time PCR results were analyzed by electrophoresis in 1% agarose containing 0.5 μg/mL ethidium bromide, followed by examination under UV light. Finally, the real-time PCR products with different melting temperatures were sequenced in a commercial laboratory (Genscript, Nanjing, China).

2.5. Next-Generation Sequencing

Next-generation sequencing (NGS) was performed on three different drug-resistant P. aeruginosa strains (P2, P61, and P136) in three regions to determine their antimicrobial resistance characteristics. The genomic DNA was determined via short-read sequencing on the Illumina Hiseq 2500 platform. Short-read genome assembly was performed with SPAdes [36]. The antibiotic resistance genes and the virulence factors were analyzed using ResFinder (https://cge.food.dtu.dk/services/ResFinder/ (accessed on 5 September 2024)) and the Virulence Factors of Pathogenic Bacteria Database (VFDB: online BLAST output (https://mgc.ac.cn/ (accessed on 5 September 2024))).
Multilocus sequence typing (MLST) was performed using the whole genomes of the P. aeruginosa isolates. The nucleotide sequences of seven housekeeping genes (acsA, aroE, guaA, mutL, nuoD, ppsA, and trpE) were extracted, and the ST was determined via public databases for molecular typing and microbial genome diversity [37].

3. Results

3.1. The Isolation and Identification of P. aeruginosa in Cow’s Raw Milk

In this study, antibiotic resistance assay was performed on a total of 132 strains of P. aeruginosa (Figure S1). These strains were isolated from non-duplicate cows from three farms located in Jiangsu Province (Farm A: n = 14; Farm B: n = 80; Farm D: n = 19) and one farm in Shandong Province (Farm C: n = 19). Among the cows enrolled in the study, 10 of them were diagnosed with CM, while the remaining 122 cows were detected to be free of mastitis. It should be noted that all the 10 cows with CM were from Farm B.

3.2. Antimicrobial Resistance Phenotypes

Antimicrobial susceptibility tests were performed on the 132 P. aeruginosa isolates with four classes of antimicrobials (β-lactam, aminoglycoside, quinolone, and carbapenem). Both disk diffusion and broth microdilution assays showed that there were 18 isolates (13.64%, 18/132) recovered from the cows in three farms (A, B, and D) resistant to β-lactam or aminoglycoside antibiotics, with MICs of 8–32 μg/mL for gentamicin, 8–16 μg/mL for tobramycin, and 20–640 μg/mL for ceftazidime, respectively. Among them, 16 isolates of P. aeruginosa were resistant to aminoglycosides (12.12%, 16/132), including gentamicin (10.61%, 14/132) and tobramycin (6.06%, 8/132), while 2 isolates were resistant to ceftazidime (1.52%, 2/132). Although none of the isolates were resistant to both of the two classes of antimicrobials, six of them (P56, P57, P61, P78, P82, and P90) were resistant to gentamicin and tobramycin (Table 2 and Figure S2).

3.3. Antimicrobial Resistance Genotypes

In order to investigate the antimicrobial resistance genes related to aminoglycoside and β-lactam antibiotic resistance, real-time PCR were performed on these 132 P. aeruginosa isolates. Subsequently, the real-time PCR products with different melting temperatures were gel-purified and confirmed by sequencing. Overall, 60.61% (80/132) these P. aeruginosa isolates were detected to harbor at least one of the listed AME and β-lactamase encoding genes. Of these, a high proportion of 48.48% (64/132) of isolates were positive for AME genes, including 8.33% (11/132) for aac(6′)-Ib, 12.88% (17/132) for aac(6′)-II, and 38.64% (51/132) for ant(3″)-I. Moreover, 17.42% (23/132) of the isolates were positive for β-lactamase encoding genes, including 12.12% (16/132) for blaPDC, 3.03% (4/132) for blaNDM-1, and 3.03% (4/132) for blaOXA-51, respectively. The other listed antimicrobial resistance genes (aac(3′)-I, ant(2″)-Ia, blaAIM, blaCTX-M, blaGIM, blaIMP, blaKPC, blaSHV, blaSIM, blaSPM, blaTEM, blaVEB, and blaVIM) were not detectable in all the isolates. The AME genes aac(6′)-II and/or ant(3″)-I have been detected in 14 of 16 aminoglycoside-resistant isolates. In particular, it was observed that six isolates (P56, P57, P61, P78, P82, and P90) were resistant to both gentamicin and tobramycin. Further investigation revealed that these isolates harbored at least one of the two genes associated with resistance, and four isolates were positive for both genes (Table 2). However, it should be noted that at least one of these listed three AME and β-lactamase encoding genes could also be detected in 63 aminoglycoside and β-lactam-susceptible isolates, indicating that the presence of antimicrobial-resistant genes is not always associated with antibiotic-resistant phenotype (Table 3).

3.4. Virulence Factor Detection

Our study identified significant variations in the expression of specific virulence factors among antimicrobial-resistant P. aeruginosa isolates, enabling us to examine the relationship between antibiotic resistance and virulence factors. The transcriptional regulators LasR and RhlR were detected in 83.33% and 77.78% of the resistant strains, while the autoinducers LasI and RhlI were present in 88.89% and 77.78% of these strains, respectively. Additionally, the genes for LasB and AprA were found in 83.33% and 77.78% of the resistant strains. The most prevalent virulence factor, PlcH, was observed in 88.89% of the resistant strains. Notably, the virulence factors exoS and algD were found in 83.33% and 77.78% of the strains, respectively; while exoT and exoU were present in 66.67% and 33.33% of the resistant strains. ToxA was also detected in 50.00% of the resistant strains, highlighting a broad spectrum of virulence factors associated with antibiotic resistance in this pathogen (Table 4).

3.5. Analysis of Antimicrobial Resistance Genes and Virulence Factors Based on Next-Generation Sequencing

The NGS analysis was performed on one of the antimicrobial-resistant P. aeruginosa isolates in each farm. The results showed that all of the antimicrobial resistance genes and virulence factors previously detected by real-time PCR were also identified through NGS. In addition, NGS screened several other antimicrobial resistance genes and a significant number of additional virulence factors.
MLST analysis provided information on the isolates’ genetic history by classifying them into different sequence types (STs). P2, P61, and P136 belonged to ST319, ST1435, and ST1638, respectively, highlighting the genetic diversity of P. aeruginosa isolates from different farms (Table 5).
The NGS analysis identified numerous resistance genes across the three P. aeruginosa isolates, providing insights into their antimicrobial resistance profiles. It was observed that P2 harbored resistance genes for aminoglycosides (aph(3′)-I), β-lactamases (blaPDC and blaOXA-50), fosfomycin (fosA), and chloramphenicol (catB7), conferring resistance to antibiotics such as amoxicillin, fosfomycin, chloramphenicol, and ciprofloxacin. P61 contains β-lactamase genes (blaPDC and blaOXA-50), aminoglycoside resistance genes (ant(3″)-Ia, aac(6′)-IIa, and aph(3′)-IIb), and other resistance genes (fosA, catB7, crpP, sul1, tmexD2, toprJ1, tmexD3, and tmexC3). P136 was demonstrated to harbor resistance genes to aminoglycosides (aph(3′)-I), β-lactamases (blaOXA-50 and blaPDC), fosfomycin (fosA), and chloramphenicol (catB7).
Additionally, the NGS analysis revealed the presence of virulence genes in these three isolates, which are crucial for biofilm formation, immune evasion, and chronic infection. The identification of these virulence factors highlights the potential pathogenicity of these P. aeruginosa isolates in dairy cows. Specifically, P2 carried virulence factors such as exoT, associated with immune evasion and cytotoxicity; lasB, encoding elastase that degrades host tissues; and algD, which is involved in biofilm formation and enhances pathogenicity. Similarly, P61 contained virulence factors exoS and exoT, which play roles in immune evasion and cytotoxicity, while algD was essential for alginate production and biofilm formation. The virulence factors in P136 included exoS, exoT, and lasB, further supporting its potential for cytotoxicity and tissue degradation (Table 5).

4. Discussion

P. aeruginosa is a kind of widespread environmental bacteria and considered one of the major causes of opportunistic infections in humans. Due to its resistance to antibiotics and disinfectants effective on other environmental bacteria, P. aeruginosa infections have posed a significant public health concern [38]. A nationwide surveillance program, Surveillance by Etest and Agar Dilution of Nationwide Isolate Resistance (SEANIR), has indicated that hospital-acquired P. aeruginosa isolates collected from all infection types in human patients in 2008 have high resistances to imipenem (45.0%), meropenem (35.8%), piperacillin/tazobactam (36.6%), ceftazidime (31.8%), cefepime (33.0%), ciprofloxacin (34.6%), levofloxacin (37.2%), and amikacin (16.8%) [39]. However, isolates from hospital-acquired infections reportedly have a higher resistance than non-human isolates [40]. In this study, it was observed that all the isolates showed susceptibility to ciprofloxacin, ofloxacin, and imipenem, which can be attributed to the limited use of these antibiotics in livestock production in China. In particular, carbapenems are exclusively authorized for the treatment of hospital-acquired infections caused by multidrug-resistant Gram-negative bacteria in human medicine. However, in Egypt, a high prevalence level of carbapenem-resistant P. aeruginosa was identified in farm animals in 2019 [41]. Walsh et al. reported that chromosomal carbapenemase is naturally co-transcribed with other chromosomally located β-lactamases, which may partially explain this phenomenon [42]. At the same time, it is important to note that the ceftazidime MIC of one isolate was determined to be exceptionally high, reaching 640 μg/mL. Our findings align with reports from other regions. For instance, in Latin America, the sharp decrease in MDR P. aeruginosa infection was related to increased susceptibility to aminoglycosides and β-lactams [43]. In distinct Brazilian regions, P. aeruginosa isolates from patients may become resistant to carbapenem due to the SPM-1 [44,45]. In the Asia–Pacific region, the increasing prevalence of metallo-β-lactamases and carbapenemases in P. aeruginosa, especially in ST235 clones, may explain the increase in MDR P. aeruginosa from 2005 to 2008 [46,47,48]. These findings emphasize the need for the rigorous monitoring of antimicrobial resistance and prudent antibiotic use in both humans and animals to mitigate the risk of resistance development.
P. aeruginosa is frequently considered to be pathogenic for cattle. In most cases, bovine mastitis induced by P. aeruginosa infection typically presents as a mild condition and is commonly characterized by chronic or subclinical infections, and prolonged herd outbreaks rarely occur [49]. However, from 2007 to 2021, several outbreaks of mastitis caused by P. aeruginosa have been reported in dairy herds in Israel, Tanzania, Greece, and some other countries [10,12,50]. We observed that in the Israeli study, P. aeruginosa isolates were collected from both CM and SCM animals (sheep, goats, and cows), while the in Tanzanian study, P. aeruginosa isolates were all collected from SCM cows. In contrast, in this study, we did not collect samples from SCM cows. Among these 132 recovered P. aeruginosa isolates, 122 isolates were collected from 800 healthy cows (15.25%), and the remaining ten isolates were collected from 57 cows with CM (17.54%). It is important to note that the presence of P. aeruginosa in milk does not necessarily indicate a causal association with mastitis. As an environmental microorganism, P. aeruginosa can occasionally be present in raw milk as a contaminant rather than a mastitis-causing pathogen. Since P. aeruginosa has been identified as the most frequently isolated bacterium from raw cow milk in Jiangsu and Shandong provinces, the investigation of antibiotic resistance and virulence of these isolates is of considerable importance.
Notably, all antibiotic-resistant strains were originated from the healthy cows, highlighting the role of P. aeruginosa as an environmentally relevant microorganism capable of acting as a reservoir for antibiotic resistance. Among these 132 isolates of P. aeruginosa, the majority were identified to harbor 1–3 of the antibiotic resistance genes. However, we found that at least one antimicrobial-resistant gene was detected in 63 susceptible P. aeruginosa isolates; and surprisingly, seven isolates were even found to simultaneously harbor two resistant genes targeting a specific class of antibiotics. Although AME genes have been identified in most aminoglycoside-resistant isolates, they were unavailable to be detected in two isolates (P49 and P150) with the MIC of 32 μg/mL for gentamicin. These two isolates may contain other AME genes not included in this study. Among all the 132 P. aeruginosa isolates, the prevalence of AME genes was significantly higher than that of β-lactamase encoding genes, which is consistent with the results of the antimicrobial susceptibility test. This result may be attributed to the increased use of aminoglycoside antibiotics by the aforementioned farms in treating bovine mastitis. The prevalence of aminoglycoside-resistant P. aeruginosa identified in this study is significantly higher than that reported in previous studies involving animals, animal products, and even human patients [51,52,53]. Additionally, we noticed that a considerable percentage of aminoglycoside-susceptible P. aeruginosa isolates showed the presence of AME genes (43.10%, 50/116). However, the proportion was significantly lower among β-lactams-susceptible isolates (16.92%, 22/130). These results indicated a discrepancy between phenotypic susceptibility and the presence of antibiotic resistance genes in P. aeruginosa isolates.
To analyze the association between the antibiotic resistance genes and virulence factors, we found that quorum-sensing autoinducers LasI and RhlI were present in 88.9% and 77.8% of these resistant isolates, respectively, indicated the regulators LasI and RhlI likely contribute to both resistance and biofilm formation. Additionally, the enzymes alkaline protease (aprA) and elastase B (lasB) were found in 77.8% and 83.3% of resistant isolates, respectively, underscoring their roles in tissue invasion and the enhancement of resistance. Phospholipase C (plcH), the most prevalent enzyme, was identified in 88.9% of resistant isolates, suggesting a significant association with the development of antibiotic resistance. Nonetheless, pyocyanin (pyo) was found in just 16.7% of resistant strains, indicating that its role in resistance may be more limited or context-dependent. These findings suggest that resistance and virulence interact in a complex way to maintain the pathogen’s survival in the face of antibiotic pressure.
The NGS analysis was conducted on one antimicrobial-resistant P. aeruginosa isolate from each farm, revealing that most of these antimicrobial resistance genes and virulence factors, previously detected by real-time PCR, were also identified through NGS. However, discrepancies were noted, which can be attributed to the different detection capabilities of these methods. Real-time PCR specifically targets known genes, potentially overlooking variants or genes not expressed under the conditions tested. In contrast, NGS provides a comprehensive genomic analysis that uncovers additional virulence factors and resistance mechanisms. For example, the toxA gene has been detected by NGS but not identified by real-time PCR, possibly due to low gene expression or mutations in the primer-binding region. This finding suggests that NGS can identify potential resistance and/or virulence genes, which may not be detectable through real-time PCR screen. At the same time, one antibiotic resistance gene (aac(6′)-Ib) and three virulence factors (exoS, lasR, and rhlR) identified by real-time PCR were not detected by NGS, possibly due to insufficient sequencing depth. These findings underscore the complementary nature of real-time PCR and NGS, emphasizing the importance of employing both methods to obtain a more complete understanding of bacterial pathogenicity and resistance. The identified exoU+/exoS+ and exoU-/exoS+ strains are particularly noteworthy. The exoU gene encodes a phospholipase that contributes to acute cytotoxicity and rapid tissue damage, often linked to severe infections in both human and animal hosts [54]. ExoU+/exoS+ strains have the dual ability to induce acute and chronic infections, as evidenced by their co-occurrence with exoS, which encodes an ADP-ribosyltransferase associated with immune evasion and chronic infection. This dual virulence profile aligns with severe outbreaks of bovine mastitis caused by P. aeruginosa reported in other regions, where both infection types were observed [55].
By integrating real-time PCR and NGS, this study provides valuable insights into the resistance and virulence profiles of P. aeruginosa, demonstrating the necessity of using both methods to capture the full spectrum of bacterial traits. Furthermore, previous studies have shown that exoU-/exoS+ strains are more frequently associated with environmental isolates [56]. This supports the hypothesis that such strains may originate in agricultural environments, emphasizing the role of farm settings in driving the evolution of pathogenic P. aeruginosa.
While the findings from this study provided useful information on the antimicrobial resistance and virulence characteristics of P. aeruginosa in dairy cows, it should be noted that there are some certain limitations. Since we did not test all available β-lactam antibiotics commonly used in veterinary practice (procaine penicillin, ampicillin and amoxicillin), our results may not fully capture the resistance spectrum of these isolates. Additionally, the sampling locations were limited and not widely distributed. Different management practices in different farms, particularly the use of antibiotics, may lead to variations in resistance patterns. Caution should be exercised when generalizing these findings to other regions or farms with different practices. At the same time, further study is needed to investigate the antibiotic resistance and virulence factors of P. aeruginosa in cows’ raw milk, using a broader range of samples and antibiotics.

5. Conclusions

In summary, our study revealed that P. aeruginosa, isolated from cows’ raw milk in the Jiangsu and Shandong provinces, was classified as susceptible to quinolone and carbapenem antibiotics based on the applied susceptibility breakpoints. However, a notable resistance rate was observed against aminoglycoside antibiotics. At the same time, it is worth noting that a small number of isolates showed a high level of resistance to β-lactam antibiotic ceftazidime. In addition, antimicrobial resistance genes and virulence factors screening emphasizes the clinical challenges posed by aminoglycoside and/or β-lactam-resistant P. aeruginosa, highlighting the difficulties faced in effectively treating infections caused by these pathogens.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/dairy6020013/s1: Figure S1: Pseudomonas aeruginosa isolates were recovered using the three-zone streaking method on nutrient agar plates. The results of seven P. aeruginosa isolates and reference ATCC 27853 were shown in the figure.; Figure S2: The antimicrobial susceptibility of these Pseudomonas aeruginosa isolates was preliminarily detected using the Kirby-Bauer disc diffusion method. The results of gentamicin, tobramycin and ceftazidime- resistant P. aeruginosa isolates and reference ATCC 27853 were shown in the figure.

Author Contributions

Conceptualization, Y.Y.; data curation, Y.M.; formal analysis, Y.M.; Funding acquisition, Z.Y. and Y.Y.; investigation, Y.M., W.Z., S.H., H.J., J.C. and X.H.; methodology, Y.M., W.Z., S.H., H.J., J.C., X.H., T.X. and Y.Y.; resources, A.Q., Z.Y., S.S. and Y.Y.; software, Y.M. and Z.Z.; supervision, Y.Y.; writing—original draft, Y.M. and Y.Y.; writing—review and editing, Y.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the National Key Research and Development Program of China (2023YFD1800503 to YY), the National Natural Science Foundation of China (32373009 to YY), the Seed Industry Vitalization Program of Jiangsu Province (JBGS[2021]117 to YY and JBGS[2021]115 to ZY), the Basic Research Program of Jiangsu Province (BK20230071 to YY), the 111 Project (D18007 to YY), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (NA to YY). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding authors.

Acknowledgments

We thank Gang Chen at the University of Health and Rehabilitation Science for sharing with us the reference strain of P. aeruginosa ATCC 27853.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Langendonk, R.F.; Neill, D.R.; Fothergill, J.L. The Building Blocks of Antimicrobial Resistance in Pseudomonas aeruginosa: Implications for Current Resistance-Breaking Therapies. Front. Cell Infect. Microbiol. 2021, 11, 665759. [Google Scholar] [CrossRef] [PubMed]
  2. Cleto, S.; Matos, S.; Kluskens, L.; Vieira, M.J. Characterization of contaminants from a sanitized milk processing plant. PLoS ONE 2012, 7, e40189. [Google Scholar] [CrossRef]
  3. Ruegg, P.L. A 100-Year Review: Mastitis detection, management, and prevention. J. Dairy. Sci. 2017, 100, 10381–10397. [Google Scholar] [CrossRef] [PubMed]
  4. de Jong, E.; McCubbin, K.D.; Speksnijder, D.; Dufour, S.; Middleton, J.R.; Ruegg, P.L.; Lam, T.; Kelton, D.F.; McDougall, S.; Godden, S.M.; et al. Invited review: Selective treatment of clinical mastitis in dairy cattle. J. Dairy. Sci. 2023, 106, 3761–3778. [Google Scholar] [CrossRef]
  5. Poizat, A.; Bonnet-Beaugrand, F.; Rault, A.; Fourichon, C.; Bareille, N. Antibiotic use by farmers to control mastitis as influenced by health advice and dairy farming systems. Prev. Vet. Med. 2017, 146, 61–72. [Google Scholar] [CrossRef]
  6. Cheng, W.N.; Han, S.G. Bovine mastitis: Risk factors, therapeutic strategies, and alternative treatments—A review. Asian-Australas. J. Anim. Sci. 2020, 33, 1699–1713. [Google Scholar] [CrossRef]
  7. Frey, Y.; Rodriguez, J.P.; Thomann, A.; Schwendener, S.; Perreten, V. Genetic characterization of antimicrobial resistance in coagulase-negative staphylococci from bovine mastitis milk. J. Dairy. Sci. 2013, 96, 2247–2257. [Google Scholar] [CrossRef]
  8. Kawai, K.; Shinozuka, Y.; Uchida, I.; Hirose, K.; Mitamura, T.; Watanabe, A.; Kuruhara, K.; Yuasa, R.; Sato, R.; Onda, K.; et al. Control of Pseudomonas mastitis on a large dairy farm by using slightly acidic electrolyzed water. Anim. Sci. J. 2017, 88, 1601–1605. [Google Scholar] [CrossRef]
  9. Minst, K.; Märtlbauer, E.; Miller, T.; Meyer, C. Short communication: Streptococcus species isolated from mastitis milk samples in Germany and their resistance to antimicrobial agents. J. Dairy. Sci. 2012, 95, 6957–6962. [Google Scholar] [CrossRef]
  10. Suleiman, T.S.; Karimuribo, E.D.; Mdegela, R.H. Prevalence of bovine subclinical mastitis and antibiotic susceptibility patterns of major mastitis pathogens isolated in Unguja island of Zanzibar, Tanzania. Trop. Anim. Health Prod. 2018, 50, 259–266. [Google Scholar] [CrossRef]
  11. Scaccabarozzi, L.; Leoni, L.; Ballarini, A.; Barberio, A.; Locatelli, C.; Casula, A.; Bronzo, V.; Pisoni, G.; Jousson, O.; Morandi, S.; et al. Pseudomonas aeruginosa in Dairy Goats: Genotypic and Phenotypic Comparison of Intramammary and Environmental Isolates. PLoS ONE 2015, 10, e0142973. [Google Scholar] [CrossRef] [PubMed]
  12. Sela, S.; Hammer-Muntz, O.; Krifucks, O.; Pinto, R.; Weisblit, L.; Leitner, G. Phenotypic and genotypic characterization of Pseudomonas aeruginosa strains isolated from mastitis outbreaks in dairy herds. J. Dairy. Res. 2007, 74, 425–429. [Google Scholar] [CrossRef] [PubMed]
  13. Schauer, B.; Wald, R.; Urbantke, V.; Loncaric, I.; Baumgartner, M. Tracing Mastitis Pathogens-Epidemiological Investigations of a Pseudomonas aeruginosa Mastitis Outbreak in an Austrian Dairy Herd. Animals 2021, 11, 279. [Google Scholar] [CrossRef] [PubMed]
  14. Tartor, Y.H.; Gharieb, R.M.A.; Abd El-Aziz, N.K.; El Damaty, H.M.; Enany, S.; Khalifa, E.; Attia, A.S.A.; Abdellatif, S.S.; Ramadan, H. Virulence Determinants and Plasmid-Mediated Colistin Resistance mcr Genes in Gram-Negative Bacteria Isolated From Bovine Milk. Front. Cell Infect. Microbiol. 2021, 11, 761417. [Google Scholar] [CrossRef]
  15. Banerjee, S.; Batabyal, K.; Joardar, S.N.; Isore, D.P.; Dey, S.; Samanta, I.; Samanta, T.K.; Murmu, S. Detection and characterization of pathogenic Pseudomonas aeruginosa from bovine subclinical mastitis in West Bengal, India. Vet. World 2017, 10, 738–742. [Google Scholar] [CrossRef]
  16. Arbab, S.; Ullah, H.; Wei, X.; Wang, W.; Ahmad, S.U.; Zhang, J. Drug resistance and susceptibility testing of Gram negative bacterial isolates from healthy cattle with different beta–Lactam resistance Phenotypes from Shandong province China. Braz. J. Biol. 2021, 83, e247061. [Google Scholar] [CrossRef]
  17. Yang, Y.; Peng, Y.; Jiang, J.; Gong, Z.; Zhu, H.; Wang, K.; Zhou, Q.; Tian, Y.; Qin, A.; Yang, Z.; et al. Isolation and characterization of multidrug-resistant Klebsiella pneumoniae from raw cow milk in Jiangsu and Shandong provinces, China. Transbound. Emerg. Dis. 2020, 68, 1033–1039. [Google Scholar] [CrossRef]
  18. Ashraf, A.; Imran, M. Diagnosis of bovine mastitis: From laboratory to farm. Trop. Anim. Health Prod. 2018, 50, 1193–1202. [Google Scholar] [CrossRef]
  19. Duarte, C.M.; Freitas, P.P.; Bexiga, R. Technological advances in bovine mastitis diagnosis: An overview. J. Vet. Diagn. Invest. 2015, 27, 665–672. [Google Scholar] [CrossRef]
  20. Edward, E.A.; El Shehawy, M.R.; Abouelfetouh, A.; Aboulmagd, E. Prevalence of different virulence factors and their association with antimicrobial resistance among Pseudomonas aeruginosa clinical isolates from Egypt. BMC Microbiol. 2023, 23, 161. [Google Scholar] [CrossRef]
  21. Ghanem, S.M.; Abd El-Baky, R.M.; Abourehab, M.A.S.; Fadl, G.F.M.; Gamil, N. Prevalence of Quorum Sensing and Virulence Factor Genes Among Pseudomonas aeruginosa Isolated from Patients Suffering from Different Infections and Their Association with Antimicrobial Resistance. Infect. Drug Resist. 2023, 16, 2371–2385. [Google Scholar] [CrossRef] [PubMed]
  22. Ghosh, D.; Mangar, P.; Choudhury, A.; Kumar, A.; Saha, A.; Basu, P.; Saha, D. Characterization of a hemolytic and antibiotic-resistant Pseudomonas aeruginosa strain S3 pathogenic to fish isolated from Mahananda River in India. PLoS ONE 2024, 19, e0300134. [Google Scholar] [CrossRef]
  23. CLSI. Performance Standards for Antimicrobial Susceptibility Testing. 34th ed. CLSI supplement M100. Clinical and Laboratory Standards Institute. 2024. Available online: https://clsi.org/standards/products/elearning/education/using-m100-online-learning-performance-standards-for-antimicrobial-susceptibility-testing/ (accessed on 19 March 2025).
  24. Nie, L.; Lv, Y.; Yuan, M.; Hu, X.; Nie, T.; Yang, X.; Li, G.; Pang, J.; Zhang, J.; Li, C.; et al. Genetic basis of high level aminoglycoside resistance in Acinetobacter baumannii from Beijing, China. Acta Pharm. Sin. B 2014, 4, 295–300. [Google Scholar] [CrossRef] [PubMed]
  25. Ahmed, N.; Ali, Z.; Riaz, M.; Zeshan, B.; Wattoo, J.I.; Aslam, M.N. Evaluation of Antibiotic Resistance and Virulence Genes among Clinical Isolates of Pseudomonas aeruginosa from Cancer Patients. Asian Pac. J. Cancer Prev. 2020, 21, 1333–1338. [Google Scholar] [CrossRef]
  26. Dumas, J.L.; van Delden, C.; Perron, K.; Kohler, T. Analysis of antibiotic resistance gene expression in Pseudomonas aeruginosa by quantitative real-time-PCR. FEMS Microbiol. Lett. 2006, 254, 217–225. [Google Scholar] [CrossRef]
  27. Fazeli, N.; Momtaz, H. Virulence Gene Profiles of Multidrug-Resistant Pseudomonas aeruginosa Isolated From Iranian Hospital Infections. Iran. Red. Crescent Med. J. 2014, 16, e15722. [Google Scholar] [CrossRef]
  28. Ellington, M.J.; Kistler, J.; Livermore, D.M.; Woodford, N. Multiplex PCR for rapid detection of genes encoding acquired metallo-beta-lactamases. J. Antimicrob. Chemother. 2007, 59, 321–322. [Google Scholar] [CrossRef]
  29. Jeon, B.C.; Jeong, S.H.; Bae, I.K.; Kwon, S.B.; Lee, K.; Young, D.; Lee, J.H.; Song, J.S.; Lee, S.H. Investigation of a nosocomial outbreak of imipenem-resistant Acinetobacter baumannii producing the OXA-23 beta-lactamase in korea. J. Clin. Microbiol. 2005, 43, 2241–2245. [Google Scholar] [CrossRef]
  30. Woodford, N.; Ellington, M.J.; Coelho, J.M.; Turton, J.F.; Ward, M.E.; Brown, S.; Amyes, S.G.; Livermore, D.M. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int. J. Antimicrob. Agents 2006, 27, 351–353. [Google Scholar] [CrossRef]
  31. Moubareck, C.; Bremont, S.; Conroy, M.C.; Courvalin, P.; Lambert, T. GES-11, a novel integron-associated GES variant in Acinetobacter baumannii. Antimicrob. Agents Chemother. 2009, 53, 3579–3581. [Google Scholar] [CrossRef]
  32. Zhou, X.; Xu, G.; Ying, H. Investigation of resistance genes and virulence factors in drug-resistant Pseudomonas aeruginosa isolated from burn department. Chin. J. Nosocomiology 2014, 24, 1580–1582+1589. [Google Scholar]
  33. Qian, Z.; Hui, P.; Han, L.; Ling-Zhi, Y.; Bo-Shun, Z.; Jie, Z.; Wan-Li, G.; Nan, W.; Shi-Jin, J.; Zhi-Jing, X. Serotypes and virulence genes of Pseudomonas aeruginosa isolated from mink and its pathogenicity in mink. Microb. Pathog. 2020, 139, 103904. [Google Scholar] [CrossRef] [PubMed]
  34. Lanotte, P.; Watt, S.; Mereghetti, L.; Dartiguelongue, N.; Rastegar-Lari, A.; Goudeau, A.; Quentin, R. Genetic features of Pseudomonas aeruginosa isolates from cystic fibrosis patients compared with those of isolates from other origins. J. Med. Microbiol. 2004, 53, 73–81. [Google Scholar] [CrossRef] [PubMed]
  35. Sabharwal, N.; Dhall, S.; Chhibber, S.; Harjai, K. Molecular detection of virulence genes as markers in Pseudomonas aeruginosa isolated from urinary tract infections. Int. J. Mol. Epidemiol. Genet. 2014, 5, 125–134. [Google Scholar]
  36. Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef]
  37. Jolley, K.A.; Bray, J.E.; Maiden, M.C.J. Open-access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications. Wellcome Open Res. 2018, 3, 124. [Google Scholar] [CrossRef]
  38. Stover, C.K.; Pham, X.Q.; Erwin, A.L.; Mizoguchi, S.D.; Warrener, P.; Hickey, M.J.; Brinkman, F.S.; Hufnagle, W.O.; Kowalik, D.J.; Lagrou, M.; et al. Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 2000, 406, 959–964. [Google Scholar] [CrossRef]
  39. Xiao, M.; Wang, Y.; Yang, Q.W.; Fan, X.; Brown, M.; Kong, F.; Xu, Y.C. Antimicrobial susceptibility of Pseudomonas aeruginosa in China: A review of two multicentre surveillance programmes, and application of revised CLSI susceptibility breakpoints. Int. J. Antimicrob. Agents 2012, 40, 445–449. [Google Scholar] [CrossRef]
  40. Gharieb, R.; Saad, M.; Khedr, M.; El Gohary, A.; Ibrahim, H. Occurrence, virulence, carbapenem resistance, susceptibility to disinfectants and public health hazard of Pseudomonas aeruginosa isolated from animals, humans and environment in intensive farms. J. Appl. Microbiol. 2022, 132, 256–267. [Google Scholar] [CrossRef]
  41. Elshafiee, E.A.; Nader, S.M.; Dorgham, S.M.; Hamza, D.A. Carbapenem-resistant Pseudomonas aeruginosa Originating from Farm Animals and People in Egypt. J. Vet. Res. 2019, 63, 333–337. [Google Scholar] [CrossRef]
  42. Walsh, T.R.; Payne, D.J.; MacGowan, A.P.; Bennett, P.M. A clinical isolate of Aeromonas sobria with three chromosomally mediated inducible beta-lactamases: A cephalosporinase, a penicillinase and a third enzyme, displaying carbapenemase activity. J. Antimicrob. Chemother. 1995, 35, 271–279. [Google Scholar] [CrossRef] [PubMed]
  43. Shortridge, D.; Gales, A.C.; Streit, J.M.; Huband, M.D.; Tsakris, A.; Jones, R.N. Geographic and Temporal Patterns of Antimicrobial Resistance in Pseudomonas aeruginosa Over 20 Years From the SENTRY Antimicrobial Surveillance Program, 1997–2016. Open Forum Infect. Dis. 2019, 6, S63–S68. [Google Scholar] [CrossRef] [PubMed]
  44. Picao, R.C.; Poirel, L.; Gales, A.C.; Nordmann, P. Diversity of beta-lactamases produced by ceftazidime-resistant Pseudomonas aeruginosa isolates causing bloodstream infections in Brazil. Antimicrob. Agents Chemother. 2009, 53, 3908–3913. [Google Scholar] [CrossRef] [PubMed]
  45. Gales, A.C.; Menezes, L.C.; Silbert, S.; Sader, H.S. Dissemination in distinct Brazilian regions of an epidemic carbapenem-resistant Pseudomonas aeruginosa producing SPM metallo-beta-lactamase. J. Antimicrob. Chemother. 2003, 52, 699–702. [Google Scholar] [CrossRef]
  46. Lee, S.; Park, Y.J.; Kim, M.; Lee, H.K.; Han, K.; Kang, C.S.; Kang, M.W. Prevalence of Ambler class A and D beta-lactamases among clinical isolates of Pseudomonas aeruginosa in Korea. J. Antimicrob. Chemother. 2005, 56, 122–127. [Google Scholar] [CrossRef]
  47. Hong, J.S.; Yoon, E.J.; Lee, H.; Jeong, S.H.; Lee, K. Clonal Dissemination of Pseudomonas aeruginosa Sequence Type 235 Isolates Carrying blaIMP-6 and Emergence of blaGES-24 and blaIMP-10 on Novel Genomic Islands PAGI-15 and -16 in South Korea. Antimicrob. Agents Chemother. 2016, 60, 7216–7223. [Google Scholar] [CrossRef]
  48. Kim, M.J.; Bae, I.K.; Jeong, S.H.; Kim, S.H.; Song, J.H.; Choi, J.Y.; Yoon, S.S.; Thamlikitkul, V.; Hsueh, P.R.; Yasin, R.M.; et al. Dissemination of metallo-beta-lactamase-producing Pseudomonas aeruginosa of sequence type 235 in Asian countries. J. Antimicrob. Chemother. 2013, 68, 2820–2824. [Google Scholar] [CrossRef]
  49. Hogan, J.; Larry Smith, K. Coliform mastitis. Vet. Res. 2003, 34, 507–519. [Google Scholar] [CrossRef]
  50. Petridou, E.J.; Fragkou, I.A.; Lafi, S.Q.; Giadinis, N.D. Outbreak of Pseudomonas aeruginosa mastitis in a dairy cow herd in northern Greece and its control with an autogenous vaccine. Pol. J. Vet. Sci. 2021, 24, 303–305. [Google Scholar] [CrossRef]
  51. Ohnishi, M.; Sawada, T.; Hirose, K.; Sato, R.; Hayashimoto, M.; Hata, E.; Yonezawa, C.; Kato, H. Antimicrobial susceptibilities and bacteriological characteristics of bovine Pseudomonas aeruginosa and Serratia marcescens isolates from mastitis. Vet. Microbiol. 2011, 154, 202–207. [Google Scholar] [CrossRef]
  52. Arslan, S.; Eyi, A.; Ozdemir, F. Spoilage potentials and antimicrobial resistance of Pseudomonas spp. isolated from cheeses. J. Dairy. Sci. 2011, 94, 5851–5856. [Google Scholar] [CrossRef] [PubMed]
  53. Hu, Z.; Zhou, L.; Tao, X.; Li, P.; Zheng, X.; Zhang, W.; Tan, Z. Antimicrobial resistance survey and whole-genome analysis of nosocomial P. Aeruginosa isolated from eastern Province of China in 2016–2021. Ann. Clin. Microbiol. Antimicrob 2024, 23, 12. [Google Scholar] [CrossRef] [PubMed]
  54. Finnan, S.; Morrissey, J.P.; O’Gara, F.; Boyd, E.F. Genome diversity of Pseudomonas aeruginosa isolates from cystic fibrosis patients and the hospital environment. J. Clin. Microbiol. 2004, 42, 5783–5792. [Google Scholar] [CrossRef] [PubMed]
  55. Tartor, Y.H.; El-Naenaeey, E.Y. RT-PCR detection of exotoxin genes expression in multidrug resistant Pseudomonas aeruginosa. Cell. Mol. Biol. 2016, 62, 56–62. [Google Scholar]
  56. Feltman, H.; Schulert, G.; Khan, S.; Jain, M.; Peterson, L.; Hauser, A.R. Prevalence of type III secretion genes in clinical and environmental isolates of Pseudomonas aeruginosa. Microbiology 2001, 147, 2659–2669. [Google Scholar] [CrossRef]
Table 1. Primers used for the screen of antimicrobial resistance genes and virulence factors in this study.
Table 1. Primers used for the screen of antimicrobial resistance genes and virulence factors in this study.
GenePrimer Sequence (5′-3′)Amplicon Length (bp)Reference
16S rDNAAGAGTTTGATCCTGGCTCAG1514[17]
TACGGCTACCTTGTTACGACT
aac(3′)-ITTACGCAGCAGCAACGATGT402[24]
GTTGGCCTCATGCTTGAGGA
aac(6′)-IbCATGACCTTGCGATGCTCTA490[24]
GCTCGAATGCCTGGCGTCTT
aac(6′)-IITTCATGTCCGCGAGCACCCC178[24]
GACTCTTCCGCCATCGCTCT
ant(2″)-IaGCTCACGCAACTGGTCCAGA719[24]
GGCACGCAAGACCTCAACCT
ant(3″)-ITGATTTGCTGGTTACGGTGAC284[24]
CGCTATGTTCTCTTGCTTTTG
blaAIMCTGAAGGTGTACGGAAACAC445[25]
GTTCGGCCACCTCGAATTG
blaPDCCGGCTCGGTGAGCAAGACCTTC218[26]
AGTCGCGGATCTGTGCCTGGTC
blaCTX-MATGTGCAGYACCAGTAARGT593[27]
TGGGTRAARTARGTSACCAGA
blaGIMTCGACACACCTTGGTCTGAA477[28]
AACTTCCAACTTTGCCATGC
blaIMPCATGGTTTGGTGGTTCTTGT488[29]
TTATTCCGGAAGTCCCTGT
blaKPCCGTCTAGTTCTGCTGTCTTG439[25]
CTTGTCATCCTTGTTAGGCG
blaNDM-1GGTTTGGCGATCTGGTTTTC621[25]
CGGAATGGCTCATCACGATC
blaOXA-51TAATGCTTTGATCGGCCTTG353[30]
TGGATTGCACTTCATCTTGG
blaSHVGGTTATGCGTTATATTCGCC867[27]
TTAGCGTTGCCAGTGCTC
blaSIMTACAAGGGATTCGGCATCG570[28]
TAATGGCCTGTTCCCATGTG
blaSPMAAAATCTGGGTACGCAAACG271[25]
ACATTATCCGCTGGAACAGG
blaTEMGCCAACTTACTTCTGACAACGA440[25]
ATCCGCCTCCATCCAGTCT
blaVEBATTTCCCGATGCAAAGCGT542[31]
TTATTCCGGAAGTCCCTGT
blaVIMATTGGTCTATTTGACCGCGTC780[29]
TGCTACTCAACGACTGAGCG
exoSTCAGCAGAGTCCGTCTTTCGCC407[32]
GCCAGGCGGGAGTGCTCCCGG
exoTTCAGCAGAACCCGTCTTTCGT407[32]
GCCAGGCGGCGTGTGATCCTTC
exoUCCGTCGCAGGCAGCGCATAAGTCC420[32]
GAACGCCGCCGGGCTCATACCTGA
pyoTGCCGGTACGACTCACGAGTG231[32]
GTTCTGGCTTCCTGGAGGGGT
aprACAGACCCTGACCCACGAGAT452[33]
CATTGCCCTTCAACCCG
toxAGGTAACCAGCTCAGCCACA301[34]
TGCCTTCCCAGGTATCGT
plcHGCACGTGGTCATTCCTGATGC608[27]
TCCGTAGGCGTCGACGTAC
algDATCAGCATCTTTGGTTTGGG346[33]
TGTGGCGTTCGGACTTCT
lasBCGTCTCCTACCTGATTCCCG413[33]
GCACCTTCATGTACAGCTTGTG
lasICGTGCTCAAGTGTTCAAGG295[35]
TACAGTCGGAAAAGCCCAG
lasRAAGTGGAAAATTGGAGTGGAG130[35]
GTAGTTGCCGACGACGATGAAG
rh1LTTCATCCTCCTTTAGTCTTCCC155[35]
TTCCAGCGATTCAGAGAGC
rh1RTGCATTTATCGATCAGGGC133[35]
CACTTCCTTTTCCAGGACG
Table 2. Resistance pattern of P. aeruginosa isolates.
Table 2. Resistance pattern of P. aeruginosa isolates.
Sample IDGenBank Accession NumberHealth/MastitisFarmGentamicinTobramycinCeftazidimeAME Genesβ-lactamase Genes
Kirby–Bauer (mm)MIC (μg/mL)Kirby–Bauer (mm)MIC (μg/mL)Kirby–Bauer (mm)MIC (μg/mL)
P2MN314754HealthAR16S S aac(6′)-IbblaOXA-51
P17MN314764HealthAR16S S aac(6′)-Ib
P18MN314753HealthAR16S S ant(3″)-IblaNDM-1
P49MN314614HealthBR32S S
P50MN314609HealthBR32S S aac(6′)-Ib, ant(3″)-I
P52MN314607HealthBS S R20aac(6′)-II
P56MN314600HealthBR8R16S aac(6′)-II, ant(3″)-I
P57MN314598HealthBR16R16S aac(6′)-II, ant(3″)-I
P61MN314603HealthBR32R16S ant(3″)-IblaPDC
P62MN314602HealthBS R16S aac(6′)-II, ant(3″)-I
P78MN314679HealthBR16R16S aac(6′)-II, ant(3″)-I
P79MN314675HealthBR8S S aac(6′)-II, ant(3″)-I
P81MN314604HealthBS R16S aac(6′)-II, ant(3″)-I
P82MN314601HealthBR16R8S aac(6′)-II, ant(3″)-I
P90MN314610HealthBR8R8S aac(6′)-IIblaPDC
P136MN314801HealthDS S R640 blaPDC
P150MN314828HealthDR32S S blaOXA-51
P151MN314818HealthDS S S aac(6′)-Ib, ant(3″)-IblaPDC
Table 3. The information of P. aeruginosa isolates susceptible to all the listed antibiotics.
Table 3. The information of P. aeruginosa isolates susceptible to all the listed antibiotics.
FarmHealth/MastitisAminoglycoside Modifying Enzyme GenesΒ-Lactamase Encoding GenesSample ID
A14/0 blaNDM-1P1, P29
blaOXA-51P1, P4
ant(3″)-I P3, P27
aac(6′)-Ib, P25, P27, P29
aac(6′)-II P25
B70/10 blaNDM-1P99
blaPDCP31, P33, P45, P68, P85, P94, P104
ant(3″)-I P30, P32, P39, P48, P51, P53, P54, P58, P60, P63, P64, P67, P68, P70, P72, P74, P76, P80, P84, P86, P87, P89, P95, P97, P100, P102, P103, P106, P109
aac(6′)-II P42, P43, P64, P84, P91
C19/0 blaPDCP116, P124, P125, P133
ant(3″)-I P117, P119, P125, P131
aac(6′)-II P115
D19/0 blaPDCP152
ant(3″)-I P134, P135, P140, P141, P146
aac(6′)-Ib, P135, P142, P144, P155
aac(6′)-II P142
Table 4. The detection of 13 virulence factors in antimicrobial-resistant P. aeruginosa isolates.
Table 4. The detection of 13 virulence factors in antimicrobial-resistant P. aeruginosa isolates.
Sample IDFarmVirulence Factors
exoSexoTexoUpyoaprAtoxAplcHalgDlasBlasIlasRrh1Lrh1R
P2A+++-+-+-+-+++
P17A--+-+-+++++++
P18A++--+-+++++++
P49B+----------++
P50B+--++++++++++
P52B+-+-+++++++++
P56B++---++--++--
P57B+++-+++++++++
P61B-------+-+---
P62B++--+++++++--
P78B++-++++++++++
P79B++--+++++++++
P81B++--+-++++++-
P82B++--+++++++++
P90B------+-++--+
P136D++--+-+++++++
P150D+++-+-+++++++
P151D+++++++++++++
% 83.366.733.316.777.850.088.977.883.388.983.377.877.8
Table 5. The presence of 19 antimicrobial resistance genes and 13 virulence factors listed in this study detected by real-time PCR and NGS.
Table 5. The presence of 19 antimicrobial resistance genes and 13 virulence factors listed in this study detected by real-time PCR and NGS.
Sample IDGenBank Accession NumberFarmMLST Sequence TypeAntibiotic Resistance Genes Real-Time PCRAntibiotic Resistance Genes_NGSVirulence Factors Real-Time PCRVirulence Factors_NGS
P2MN314754AST319aac(6′)-Ib, blaOXA-51blaOXA-50, blaPDCaprA, exoS, exoT, exoU, lasB, lasR, plcH, rhlI, rhlRalgD, aprA, exoT, exoU, lasB, lasI, plcH, rhlI
P61MN314603BST1435ant(3″)-I, blaPDC *aac(6′)-IIa, ant(3″)-Ia, blaOXA50, blaPDCalgD, lasIalgD, aprA, exoS, exoT, exoU, lasB, lasI, plcH, rhlI, toxA
P136MN314801DST1638blaPDCblaOXA-50, blaPDCalgD, aprA, exoS, exoT, lasB, lasI, lasR, plcH, rhlI, rhlRalgD, aprA, exoS, exoT, lasB, lasI, plcH, rhlI, toxA
* Antimicrobial resistance genes and virulence factors detect to be positive with real-time PCR are indicated in bold.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Meng, Y.; Zhu, W.; Han, S.; Jiang, H.; Chen, J.; Zhou, Z.; Hao, X.; Xu, T.; Qin, A.; Yang, Z.; et al. Presence of Aminoglycoside and β-Lactam-Resistant Pseudomonas aeruginosa in Raw Milk of Cows. Dairy 2025, 6, 13. https://doi.org/10.3390/dairy6020013

AMA Style

Meng Y, Zhu W, Han S, Jiang H, Chen J, Zhou Z, Hao X, Xu T, Qin A, Yang Z, et al. Presence of Aminoglycoside and β-Lactam-Resistant Pseudomonas aeruginosa in Raw Milk of Cows. Dairy. 2025; 6(2):13. https://doi.org/10.3390/dairy6020013

Chicago/Turabian Style

Meng, Yining, Wen Zhu, Shitong Han, Hui Jiang, Jie Chen, Zhou Zhou, Xiaoli Hao, Tianle Xu, Aijian Qin, Zhangping Yang, and et al. 2025. "Presence of Aminoglycoside and β-Lactam-Resistant Pseudomonas aeruginosa in Raw Milk of Cows" Dairy 6, no. 2: 13. https://doi.org/10.3390/dairy6020013

APA Style

Meng, Y., Zhu, W., Han, S., Jiang, H., Chen, J., Zhou, Z., Hao, X., Xu, T., Qin, A., Yang, Z., Shang, S., & Yang, Y. (2025). Presence of Aminoglycoside and β-Lactam-Resistant Pseudomonas aeruginosa in Raw Milk of Cows. Dairy, 6(2), 13. https://doi.org/10.3390/dairy6020013

Article Metrics

Back to TopTop