Isolation of Intestinal Macrophage Subpopulations for High-Quality Total RNA Purification in Zebrafish
Abstract
1. Introduction
2. Experimental Design
2.1. Protocol Specifications
Zebrafish Lines Maintenance
- Protocol Details
- (1)
- The Dissection and Disaggregation of the Intestine from Adults AB Wild-Type and Tg(mpeg1:EGFP) zebrafish.
- Materials
- AB wild-type and Tg(mpeg1:EGFP) adult zebrafish (either one female or one male of approximately 12 months old) can be chosen indistinctly by line.
- Petri dishes, diameter: 94 mm; height: 16 mm (Cat# 633181)
- Sterile scalpel
- Sterile dissecting forceps (Dumont #5; Cat# NC9889584)
- Ice cooler
- Sterile plastic tubes, 50 mL (Cat# 4610-1943)
- Cell Strainer 70 μm mesh (Cat# 352350)
- Cell Strainer 40 μm mesh (Cat# 352340)
- Cell Strainer 20 μm mesh (Cat# 04-004-2325)
- P1000 pipettes and tips
- Plastic graduated Pasteur pipettes (Gauss, Cat# PIPP-003-500)
- Microfuge tubes, 1.5 mL (Cat# CFT-001-015)
- Round Bottom Polystyrene FACS tube, 5 mL (Falcon, Cat#352052)
- Equipment
- Stereomicroscope (Cat. NZ.1903-S)
- Cooling centrifuge
- Reagents
- Ethanol, 70%
- Sterile distilled water
- Dulbecco’s Phosphate-Buffered Saline (DPBS), 1X, no calcium, no magnesium (Thermo Fisher, Cat# 14190094, Waltham, MA, USA).
- FACS MaxTM Cell Dissociation Solution (Cat# T200100)
- RPMI 1640 medium (Gibco, Cat # 12633012).
- Fetal Bovine Serum (FBS), qualified, heat-inactivated (Gibco, Cat# 10500064, Waltham, MA, USA)
- Penicillin-streptomycin 100X (Gibco, Cat# 15070063, Waltham, MA, USA)
- Amphotericin b (Cat: PHR1662-500MG)
- EDTA 0.5 M (pH 8.0, without RNase) (Cat # AM9260G)
- Bovine Serum Albumin (BSA)
- Procedure
- Adults Tg(mpeg1:EGFP) fish with a size of approximately 3.6 cm (Figure 1A), should be euthanized in strict compliance with the guidelines outlined in the EU Directive 2010/63/EU on the protection of animals used for scientific purposes [5]. This could be achieved through an anesthetic overdose and rapid cooling. Specifically, immerse fish in 100 mL of E3 solution with 0.017% tricaine and place it in a recipient with ice. To ensure proper euthanasia, it is imperative to allow a five-minute interval following the final closure of the fish operculum.
- Using sterile forceps, transfer the fish, holding it by the tail, and immerse it subsequently in ice-cold 70% ethanol (for disinfection), cold sterile distilled water (to remove the ethanol), and finally, ice-cold 1X DPBS.
- Put the fish laterally in a cold (to favor tissue preservation) 94 mm diameter Petri dish beneath a stereomicroscope for further procedures (Figure 1B).
- Remove all surrounding tissues (liver, gallbladder, swim bladder, and spleen) using sterile forceps. Rinse with ice-cold PBS 1X with a sterile Pasteur pipette to clean the whole intestine (Figure 1D).
- Immediately place the removed intestine in a 1.5ml microfuge tube with supplemented RPMI medium (Figure 1E). Keep it on ice while removing other intestines.
- With the help of sterile forceps, take the intestine and immerse it in 500 µL of FACS MaxTM Cell Dissociation Solution and incubate it for five minutes at room temperature. Subsequently, employ vortex and pipetting for an additional five minutes to facilitate tissue dissociation. Note: The cell suspension derived from one to four intestines can be filtered using the same cell strainer.
- Place a 70 µm cell strainer into a sterile 50 mL tube, keep it on ice, and carefully transfer the intestinal cell suspension onto the cell strainer using a 1 mL pipette.
- Proceed to rinse the cell strainer with an additional 1 mL of the FACS MaxTM Cell Dissociation Solution.
- Repeat step 8 using a 40 µm cell strainer, as illustrated in Figure 2A.
- Recover the entire cell suspension, including that on the bottom surface of the Cell Strainer (Figure 2B), place it into a microtube, and centrifugate it at 300× g for 5 min at 4 °C. During this step, an easily visible pellet will form, as seen in Figure 2C. Discard the supernatant and resuspend the pellet in 500 µL of DPBS supplemented with 1% BSA.
- Perform an additional centrifugation at 300× g for 5 min at 4 °C. Discard the supernatant and gently resuspend the pellet in 1 mL of the RPMI medium, enriched with 10% FBS, 3X Penicillin-Streptomycin, 12.5 µg/mL Amphotericin, and 2 mM EDTA. This step is essential for enhancing cell viability and preserving cell morphology.
- Position a 20 µm cell strainer within a sterile 5 mL round bottom polystyrene FACS tube and filter the cell suspension while maintaining the entire process on ice (Figure 2D).
- Maintain the cell suspension on ice until the FACS experiments are ready to be conducted (Figure 2E).
- Repeat the same procedure for the AB Wild-Type fish.
- (2)
- Isolation of GFP+ subpopulation by FACSNotes: It is imperative to conduct FACS experiments promptly following tissue dissociation. If necessary, adjust the concentration of the cell suspension using the supplemented RPMI medium. We strongly recommend directly recovering the sorted cells into a lysis buffer to minimize RNA degradation [7,8].
- Materials
- Intestinal cells suspension
- Ice cooler
- Round Bottom Polystyrene FACS tube, 5 mL (Falcon, Cat#352052)
- RNase/DNase-free 1.5 mL microfuge tubes (Cat# CFT-001-015)
- P1000 pipettes and tips
- Microfuge tubes, 1.5 mL (Cat# CFT-001-015)
- Equipment
- BD FACSAriaTM Fusion Cell Sorter
- Reagents
- RPMI medium supplemented with 10% FBSi, 3X Pen-Strep and 12.5 μg/mL Amphotericin
- Propidium Iodide stain (Cat# P4864-10ML)
- RLT Buffer (lysis buffer provided by the RNeasy micro-Kit, Qiagen, Les Ulis, France)
- Procedure
- In our case, sorting procedures were conducted in a BD FACSAriaTM Fusion Cell Sorter, equipped with four spatially separated lasers (405 nm, 488 nm, 561 nm, and 633 nm). Calibration and a performance assessment of the instrument were carried out prior to the experiments.
- To prevent a decrease in the cell viability, preferably use a nozzle size of 100 µm for the whole procedure.
- Adjust the voltage settings as needed and set any compensation controls if necessary during the procedure.
- Incubate the intestinal cell suspensions with 1 mg/mL propidium iodide (PI) in a dilution of 1 µL PI in 1 mL of cell suspension (1:1000), to label all dead cells.
- We recommend employing a back-gating strategy to set up the sorting enrichment experiments.
- Identify the live GFP+ cells by gating the PI− cells and GFP+ cells simultaneously in wild-type and Tg(mpeg1:EGFP) samples, using the following configuration: 695/40 band-passfilter and 488 nm excitation (PerCP-Cy5-5-A in the graph) to collet PI and 530/30 band-passfilter and 488 nm excitation (FITC-A in the graph) to collect GFP. Plot the graph in log mode (Figure 3A,B).
- Set up the cell autofluorescence using a dot plot in log mod of FITC-A vs. Pacific Blue-A (525/50 band-pass filter and 405 nm excitation) for the wild-type sample, establishing the limit of the green autofluorescence versus the blue autofluorescence simultaneously (Figure 3C,D).
- Separate the GFP+ cells from the Tg(mpeg1:EGFP) sample using the setting established in step 7, with the same detectors to ensure gating only GFP+ cells. We recommend establishing the gate usually between 102 and 105 in the FITC-A detector.
- We do not recommend discriminating cell doublets using the FSC parameter due to the high heterogenicity in size of these cells (Figure 3E,F).
- Identify the two GFP+ cell populations from the Tg(mpeg1:EGFP) sample by making a dot plot based on the GFP fluorescence and size (FITC-A vs. FSC-A), defining the sorting parameters for small GFP+ cells as FSC-Alow GFP+ cells and big GFP+ cells as FSC-Ahigh GFP+ cells (Figure 3G,H).
- Additionally, analyze the fluorescence peaks intensity of the small GFP+ and big GFP+ cells by histogram plots to uncover variations in GFP expression within each population, thereby facilitating the identification of distinct subpopulations (Figure 3I).
- Finally, sort the small GFP+ and big GFP+ cells, as well as GFP− cells as a control.
- Ensure that the sorted cells are directly collected into a microfuge tube containing the lysis buffer and maintain them on ice.
- (3)
- Total RNA Extraction ProceduresNote: To ensure an RNA degradation-free environment, it is advisable to clean the workspace with an RNase decontaminating product and employ filter tips. Utilize the appropriate RNA extraction kit according to the number of cells recovered in each case and adhere to the manufacturer’s instructions meticulously. We recommend using the RNeasy Micro Kit—QIAGEN to perform a successful RNA extraction for a low number of cells (<5 × 105 cells).
- Materials
- Sorted cells
- RNeasy micro-Kit (Cat# 74104, Qiagen, Les Ulis, France)
- RNase/DNase-free 1.5 mL microfuge tubes (supplemented by RNeasy micro-Kit, Qiagen)
- P1000 pipettes and tips
- Equipment
- Cooling centrifuge
- Vortex
- Reagents
- Ethanol Absolute
- Ultrapure DNase/RNase-free distilled water (Cat# 10977035, Invitrogen, Boston, MA, USA)
- Procedure
- Prepare 70% and 80% ethanol solutions using Ultrapure distilled RNase-free water.
- Following FACS sorting, ensure that the collected cells in the lysis buffer are kept on ice or frozen at −20 °C.
- To ensure high-quality RNA, proceed with RNA extraction according to the Qiagen RNeasy micro-Kit procedure, following the manufacturer’s instructions.
- For optimal RNA concentration, elute the RNA in the column using 14 µL of RNase-free water and promptly place the RNA sample on ice.
- Set aside a minimum of 1 µL of RNA from each sample to assess its concentration and quality (Table 1).
- Store the RNA sample at −20 °C for short-term analysis or −80 °C for long-term analysis. However, it is preferable to perform cDNA synthesis as soon as possible.
- (4)
- Analysis of the Gene Expression Levels in Zebrafish Intestinal Macrophages via RT-qPCR
- Materials
- Total RNA from sorted cell populations
- cDNA from sorted cell populations
- RNase/DNase-free 0.2 mL microfuge tubes
- Pipettes and tips
- Equipment
- Thermocycler
- Real-Time PCR System
- Reagents
- SensiFASTTM cDNA Synthesis Kit (Meridian Bioscience, BIO-65053; Cincinnati, OH, USA)
- SensiFAST™ SYBR® No-ROX Kit (Meridian Bioscience, BIO-98005, Cincinnati, OH, USA)
- Ultrapure DNase/RNase-free distilled water (Invitrogen, Cat# 10977035, Boston, MA, USA)
- Primer aliquots from each gene (mpeg1.1, tnfα and il10).
- Procedure
- Carry out retro-transcription using the SensiFASTTM cDNA Synthesis Kit, adhering to the manufacturer’s recommended procedures.
- Following cDNA synthesis, conduct qPCR assays using primers aliquots from gene mpeg1.1, tnfα and il10 (Table 2) and the SensiFAST™ SYBR® No-ROX Kit.
- Perform data analysis using the QuantStudioTM Real-Time PCR System Software v1.3 and GraphPad Prism v9.0.1 software.
3. Results
4. Discussion and Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hedrera, M.I.; Galdames, J.A.; Jimenez-Reyes, M.F.; Reyes, A.E.; Avendaño-Herrera, R.; Romero, J.; Feijóo, C.G. Soybean Meal Induces Intestinal Inflammation in Zebrafish Larvae. PLoS ONE 2013, 8, e69983. [Google Scholar] [CrossRef] [PubMed]
- Coronado, M.; Solis, C.J.; Hernandez, P.P.; Feijóo, C.G. Soybean meal-induced intestinal inflammation in zebrafish is T cell-dependent and has a Th17 cytokine profile. Front. Immunol. 2019, 10, 409146. [Google Scholar]
- ZFIN: Zebrafish Book: Contents. Available online: https://zfin.org/zf_info/zfbook/zfbk.html (accessed on 24 February 2024).
- Ellett, F.; Pase, L.; Hayman, J.W.; Andrianopoulos, A.; Lieschke, G.J. mpeg1 promoter transgenes direct macrophage-lineage expression in zebrafish. Blood 2011, 117, e49–e56. [Google Scholar] [CrossRef] [PubMed]
- Strähle, U.; Scholz, S.; Geisler, R.; Greiner, P.; Hollert, H.; Rastegar, S.; Schumacher, A.; Selderslaghs, I.; Weiss, C.; Witters, H.; et al. Zebrafish embryos as an alternative to animal experiments—A commentary on the definition of the onset of protected life stages in animal welfare regulations. Reprod. Toxicol. 2012, 33, 128–132. [Google Scholar] [CrossRef] [PubMed]
- Gupta, T.; Mullins, M.C. Dissection of Organs from the Adult Zebrafish. J. Vis. Exp. 2010, 1717. [Google Scholar] [CrossRef] [PubMed]
- Loontiens, S.; Depestel, L.; Vanhauwaert, S.; Dewyn, G.; Gistelinck, C.; Verboom, K.; Van Loocke, W.; Matthijssens, F.; Willaert, A.; Vandesompele, J.; et al. Purification of high-quality RNA from a small number of fluorescence activated cell sorted zebrafish cells for RNA sequencing purposes. BMC Genom. 2019, 20, 228. [Google Scholar] [CrossRef] [PubMed]
- Begon-Pescia, C.; Boireau, S.; Boyer-Clavel, M.; Lutfalla, G.; Nguyen-Chi, M. Preparing sequencing grade RNAs from a small number of FACS-sorted larvae macrophages isolated from enzyme free dissociated zebrafish larvae. MethodsX 2022, 9, 101651. [Google Scholar] [PubMed]
- Samsa, L.A.; Fleming, N.; Magness, S.; Qian, L.; Liu, J. Isolation and Characterization of Single Cells from Zebrafish Embryos. J. Vis. Exp. 2016, 2016, 53877. [Google Scholar] [CrossRef] [PubMed]
- Mazzolini, J.; Chia, K.; Sieger, D. Isolation and RNA extraction of neurons, macrophages and microglia from Larval Zebrafish brains. J. Vis. Exp. 2018, 2018, e57431. [Google Scholar] [CrossRef] [PubMed]
- Rani, U.; Singh, M.; Saith, A.; Jain, S.; Aggarwal, A.; Aggarwal, S. Evaluation of Use of RPMI Medium to Preserve Cell Morphology for Pleural/Peritoneal Fluid Cytology. J. Cytol. 2022, 39, 26. [Google Scholar] [CrossRef] [PubMed]
Population | No. of Intestines | No. of Cells | Total RNA Concentration | Ratio 260/280 |
---|---|---|---|---|
Small GFP+ cells | 4 | 20,931 | 3.9 ng/µL | 1.86 |
Big GFP+ cells | 54,745 | 9.2 ng/µL | 1.96 |
Gen | Primer Sequence 5′-3′ |
---|---|
zEF1a.5 | TTCTGTTACCTGGCAAAGGG |
zEF1a.3 | TTCAGTTTGTCCAACACCCA |
zmpeg1.5 | GTGAAAGAGGGTTCTGTTACA |
zmpeg1.3 | GCCGTAATCAAGTACGAGTT |
zTNFa.54 | TTCACGCTCCATAAGACCCA |
zTNFa.34 | CCGTAGGATTCAGAAAAGCG |
zIL10.51 | CCAACGATGACTTGGAACCA |
zIL10.3 | CTAGATACTGCTCGATGTAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Del Río-Jay, Y.; Barthelaix, A.; Reyes-Martínez, C.; Duperray, C.; Solis-Cascante, C.J.; Hidalgo, Y.; Luz-Crawford, P.; Djouad, F.; Feijoo, C.G. Isolation of Intestinal Macrophage Subpopulations for High-Quality Total RNA Purification in Zebrafish. Methods Protoc. 2024, 7, 43. https://doi.org/10.3390/mps7030043
Del Río-Jay Y, Barthelaix A, Reyes-Martínez C, Duperray C, Solis-Cascante CJ, Hidalgo Y, Luz-Crawford P, Djouad F, Feijoo CG. Isolation of Intestinal Macrophage Subpopulations for High-Quality Total RNA Purification in Zebrafish. Methods and Protocols. 2024; 7(3):43. https://doi.org/10.3390/mps7030043
Chicago/Turabian StyleDel Río-Jay, Yalén, Audrey Barthelaix, Cristian Reyes-Martínez, Christophe Duperray, Camila J. Solis-Cascante, Yessia Hidalgo, Patricia Luz-Crawford, Farida Djouad, and Carmen G. Feijoo. 2024. "Isolation of Intestinal Macrophage Subpopulations for High-Quality Total RNA Purification in Zebrafish" Methods and Protocols 7, no. 3: 43. https://doi.org/10.3390/mps7030043
APA StyleDel Río-Jay, Y., Barthelaix, A., Reyes-Martínez, C., Duperray, C., Solis-Cascante, C. J., Hidalgo, Y., Luz-Crawford, P., Djouad, F., & Feijoo, C. G. (2024). Isolation of Intestinal Macrophage Subpopulations for High-Quality Total RNA Purification in Zebrafish. Methods and Protocols, 7(3), 43. https://doi.org/10.3390/mps7030043