Microalgae Enhance the Resistance of Pond-Dwelling Ammonia-Oxidizing Bacteria to Light Irradiation

Abstract

Pond aquaculture is an important aquacultural model worldwide in which ammonia-oxidizing bacteria (AOB) are crucial for the removal of ammonia from water. The influence of light irradiation on AOB in an aquaculture pond was studied using artificial simulation wastewater under dark/light cycles of 24 h/0 h (L0), 12 h/12 h (L12), and 0 h/24 h (L24). The ammonia oxidation rates (AORs) in groups L0, L12, and L24 were 9.88 ± 0.19 mg h⁻¹, 6.01 ± 0.32 mg h⁻¹, and 1.85 ± 0.09 mg h⁻¹, respectively. Long-term exposure to light had a serious impact on the AOR and decreased the abundance of Nitrosomonas spp. and their ammonia monooxygenase genes. To determine the protective effect of microalgae on AOB, different doses of freeze-dried Chlorella spp. powder were added to the nitrifying bacteria community. The photoinhibition rate of chlorophyll a (Chla) in the groups with 300 and 1300 µg L⁻¹ of added Chlorella were 32.85% and 28.77%, respectively, while the Chla in the 2200 µg L⁻¹ Chlorella-added group was only 0.01%, with no significant differences (p > 0.05) in AOR between the dark/light treatment subgroups. Fluorescence in situ hybridization showed that AOB, nitrite-oxidizing bacteria, and algae coexist and grow together without free AOB in the nitrifying bacterial community. It was suggested that microalgae enhance the resistance of AOB to light irradiation in a pond through the shading effect provided by algal chlorophyll and the close symbiotic relationship between microalgae and AOB.

1. Introduction

Pond aquaculture is an important aquaculture model worldwide and produces 23.5 million tons of freshwater fish annually in China alone [1], accounting for 25.57% of the world’s total aquaculture production [2]. Ammonia is a harmful substance produced during aquacultural processes and mainly originates from the decomposition of residual feed, the diffusion of pore water in sediments, and animal excreta [3]. As aquaculture intensity has increased, the concentration of ammonia in aquaculture water has also increased. Studies have shown that the ammonia concentration on the surface of water and sediment pore water in grass carp ponds in summer can reach 2.80 ± 0.89 mg L⁻¹ and 46.20 ± 12.32 mg L⁻¹, respectively [4]. High concentrations of ammonia can cause stress to the growth of aquaculturally produced animals and even lead to their death [5,6]. Ammonia-oxidizing bacteria (AOB) are crucial for the removal of ammonia from aquaculture water [7,8]. Previous studies have shown that the abundance of AOB in aquaculture pond water ranges from 10² to 10⁴ cells mL⁻¹ [7] and that there is clear seasonal variation, with the highest abundance in summer. The dominant AOB in pond environments are usually species of Nitrosomonas [7]. Ammonia monooxygenase (AMO) is the most important functional enzyme in AOB and has three subunits encoded by the amoA, amoB, and amoC genes [9]. AmoA has been widely used as a functional gene marker for tracking AOB in environmental samples [10].

As early as 1962, scientists confirmed that AOB in marine laboratory cultivation conditions could be inhibited by light [11]. Over the past ten years, scientists have discovered that the photoinhibition of nitrifying bacteria also occurs in a wide variety of microalgal–bacterial wastewater treatment systems [12] and that the shading effect of microalgae allows AOB to tolerate stronger light exposures [13,14]. Aquaculture ponds are also microalgal–bacterial systems designed to grow and harvest aquatic animals. In aquaculture pond systems, the primary ecological services (waste assimilation, nutrient recycling, and food production) mainly depend on the activities of microalgae and microorganisms [15]. Light can inhibit nitrifying bacteria in pond aquaculture environments, and this has attracted research attention in recent years. For example, Zhou et al. demonstrated that illumination at 410 ± 10 nm of a Nitrospira nitrite-oxidizing bacteria (NOB) culture derived from a freshwater aquaculture pond could completely inhibit the nitrification activity of NOB; illumination at 520 ± 10 nm partially inhibits NOB, whereas illumination at 660 ± 10 nm has no effect [16]. Wu et al. found that light exposure was responsible for the loss of the nitrifying bacteria effect in natural, outdoor aquaculture systems [17]. However, so far, relatively little research has been carried out on the effect of light on AOB in freshwater aquaculture ponds.

The objective of this study was to investigate the protective effect of algae on AOB in aquaculture environments. We hypothesized that a photoinhibition phenomenon exists in aquaculture pond water and that the shading and symbiotic effects related to the presence of microalgae can alleviate the suppression of AOB.

2. Materials and Methods

2.1. Reactor Description and Operating Conditions

To determine the influence of light irradiation on ammonia removal, three different light irradiation regimes were tested using dark/light cycles of 24 h/0 h (the L0 group), 12 h/12 h (the L12 group), and 0 h/24 h (the L24 group). The AOB culture used in the test was created as described in the AOB enrichment section in the Supplementary Materials. Each light irradiation pattern was tested using artificial simulation wastewater consisting of 2 L of nitrifying bacteria culture and 4 L of fresh culture medium placed in a reactor. As described in Figure S1, white light lamps (7 W) were placed at the top of the reactors for the L12 and L24 groups to provide a light intensity of 800 µE m⁻² s⁻¹ at the culture surface, as measured using a light meter (Biospherical Instruments Inc., San Diego, CA, USA), while the reactor containing the L0 group was kept in constant darkness. The cultures were continuously aerated throughout the experiment so that microorganisms were constantly brought to the surface of the culture. The culture pH was maintained in the range of 8.0~8.1 at a temperature of 28.0 °C. The ammonia oxidization rates (AORs) of each group were expressed as the changes in the concentrations of ammonia and were analyzed on the 3rd and 6th days of the experiment. At the beginning of the AOR tests, the ammonia concentration of the cultures was about 45 mg L⁻¹. During the AOR tests, 10 mL samples were collected for ammonia concentration determination from each reactor every 4 h. The AOR was calculated using Equation (1)

$$\mathrm{AOR} (\mathrm{mg}/\mathrm{L}/\mathrm{h})={\displaystyle \frac{\mathrm{d}{\mathrm{N}\mathrm{H}}_4}{\mathrm{dt}}}={\displaystyle \frac{\Delta {\mathrm{N}\mathrm{H}}_4}{\Delta \mathrm{t}}}$$

(1)

where AOR represents the ammonia oxidization rate, and ΔNH₄ represents the decrease in NH₄⁺-N concentration at reaction time t.

2.2. Microbial Analysis

To investigate the effect of light on the nitrifying bacteria community, a microbial metagenomic analysis was conducted on the samples collected on the 6th day in the experiment described in Section 2.1. Three 50 mL water samples were collected from the L0 and L24 groups and filtered through 0.22 µm filtration membranes. DNA extraction and subsequent metagenomic sequencing of the filtered membranes were conducted by the Guangdong Magigene Biotechnology Co., Ltd. (Guangzhou, China), as described by Ma et al. [18]. The resulting raw sequence data were submitted to the NCBI SRA under accession number PRJNA1152231.

2.3. Photoinhibition Batch Tests under Different Chlorophyll a Concentrations

To determine the protective effect of microalgae on AOB, different doses of commercial freeze-dried Chlorella spp. powder (Health Biotech, Nanjing, China) were added to the nitrifying bacteria community. The equipment and operating conditions used in this experiment were the same as those described in Section 2.1. The chlorophyll a (Chla) concentrations were used to represent the algae density, with initial Chla concentrations of 300, 1300, and 2200 µg L⁻¹, termed the 300, 1300, and 2200 groups, respectively. Each group contained two subgroups, one of which was kept in darkness, named “Black”, and the other received light irradiation, named “Light”. Two liters of nitrifying bacteria culture in 4 L of fresh culture medium was added to each reactor. Subsequently, the NH₄Cl solution was added to each reactor to make an initial ammonia concentration of about 45 mg L⁻¹. During the experiment, 10 mL samples were collected every 2 h to measure the concentrations of ammonia, nitrite, and nitrate. The AOR was calculated using Equation (1), and the degree of photoinhibition of the AOB was calculated using Equation (2):

$$\mathrm{I}={\displaystyle \frac{{\mathrm{A}\mathrm{O}\mathrm{R}}_{\mathrm{D}}-{\mathrm{A}\mathrm{O}\mathrm{R}}_{\mathrm{L}}}{{\mathrm{A}\mathrm{O}\mathrm{R}}_{\mathrm{D}}}}100\%$$

(2)

where I represents the inhibition effect of light irradiation, and AOR_D and AOR_L refer to the ammonia oxidation rate in the dark and light subgroups, respectively.

2.4. Fluorescence In Situ Hybridization Analysis of Algae and Bacteria

To obtain further insights into the microalgal–bacterial community’s resistance to light irradiation, the relative abundance of AOB, NOB, and microalgae in the enriched cultures was investigated using fluorescence in situ hybridization (FISH) technology. After a concentration batch test of the different algae, the sediment in the L24 group was collected for FISH analysis. Samples were prepared according to Zhang et al. [19] by Sango (Shanghai, China). The probes used for AOB and NOB detection are shown in

Table 1. Oligonucleotide probes used for fluorescence in situ hybridization analysis.

Probe Name	Target Organism	Probe Sequence (5′-3′)	Labeling Dye	Reference
NSO 190	β-Subdivision of AOB	CGATCCCCTGCTTTTCTCC	AMCA	[20]
Ntspa712	NOB (most members of Nitrospirae)	CGCCTTCGCCACCGGCCTTCC	Cy5	[20]

. The microalgae were assessed on the basis of their chlorophyll fluorescence. The hybridized samples were observed using a confocal laser scanning microscope (Olympus FV1200, Tokyo, Japan).

2.5. Water Quality Analysis Methodology

All water samples were filtered through acetate cellulose membranes with 0.22 µm pores before analysis. The NH₄⁺-N, NO₃⁻-N, and NO₂⁻-N concentrations were determined using the Nessler reagent photometric method (420 nm), the photometry with phenol-2-sulfonic acid method (410 nm), and the N (1-naphty1)-ethylenediamine dihydrochloride spectrophotometric method (540 nm), respectively [21]. Chla was extracted using 90% hot ethanol, and its absorptions were measured spectrophotometrically before and after acidification [22].

2.6. Statistical Analyses

The results of the AOR analyses and the relative abundance of the microbial communities and their functional genes are given as the mean ± standard error. Statistical comparisons were made using the independent sample t test method with SPSS v. 22.0 software for gene relative abundance (IBM Inc., Armonk, NY, USA).

Statistical comparisons of AOR were performed using the ‘simba’ package included in the RStudio software (version 4.1.3) [23]. First, we performed linear regression to determine the AOR and then tested the significance of the difference in AOR between different treatment groups using the independent sample t-test method. The mean levels were considered significantly different at p < 0.05. The figures were drawn using Origin 2018 software.

3. Results

3.1. Photoinhibition of Nitrification

As shown in Figure 1, on the third day, the AORs of the L12 and L24 groups were both significantly lower than that of L0, and there was no significant difference between the L12 and L24 groups, indicating that 800 µE m⁻² s⁻¹ of light irradiation can inhibit AOB. As time went by, the influence of light on the AOR became significant. On the sixth day, the AORs of groups L0, L12, and L24 were 9.88 ± 0.19 mg h⁻¹, 6.01 ± 0.32 mg h⁻¹, and 1.85 ± 0.09 mg h⁻¹, respectively. The AOR of group L0 was significantly higher than those of L12 and L24 (p > 0.5), and the AOR of group L12 was significantly higher than that of L24. These results indicate that long-term light exposure has a serious impact on AOB in aquaculture ponds and that dark conditions are beneficial for the recovery of ammonia oxidation activity [24].

3.2. Microbial Analysis

As shown in Figure 2, the dominant microbial community genera in the L0 dark group were Nitrosomonas, Unknown, Nitrobacter, and Hyphomicrobium, and their relative abundances were 32.13 ± 1.34%, 8.11 ± 0.01%, 8.37 ± 0.43%, and 2.63 ± 0.00%, respectively. In the L24 light group, the dominant genera in the microbial community were Nitrosomonas, Unknown, Nitrobacter, and Hyphomicrobium, and their relative abundances were 6.11 ± 0.61%, 13.63 ± 0.27%, 2.90 ± 0.35%, and 2.51 ± 0.22%, respectively. At the genetic level, the relative abundances of AOB amoA, B, and C in the dark groups were 0.028 ± 0.002%, 0.026 ± 0.001%, and 0.044 ± 0.002%, respectively. Compared with the dark groups, the relative abundances of AOB amoA, B, and C were all downregulated in the light groups, reaching 0.008 ± 0.001%, 0.007 ± 0.001%, and 0.013 ± 0.002%, respectively. These results indicated that light treatment could change the microbial community and decrease the abundance of Nitrosomonas AOB.

3.3. Algae Enhance the Resistance of AOB to Light Irradiation

To investigate the effect of microalgae on the nitrifying bacteria of ponds under light irradiation, the effect of Chla concentration on the ammonia conversion efficiency of AOB was investigated. As shown in Figure 3, the rates of AOR in the dark and light subgroups of the 300 group were 4.14 ± 0.13 and 2.78 ± 0.13 mg L⁻¹, respectively. The photoinhibition rate of the light subgroup was 32.85%. In the 1300 group, the AORs of the dark and light subgroups were 3.58 ± 0.10 and 2.55 ± 0.16 mg L⁻¹, respectively, with a photoinhibition rate of 28.77% in the light subgroups. In the 2200 group, the AORs of the dark and light subgroups were 3.63 ± 0.07 and 3.58 ± 0.10 mg L⁻¹, respectively, with a photoinhibition rate of 0.01% in the light subgroup, and no statistically significant difference (p > 0.05) in AOR between them. These results indicate that increasing concentrations of microalgae can reduce the inhibitory effect of light on AOB and that the Chla concentration can completely protect AOB from light suppression once it reaches a certain value.

3.4. Fluorescence In Situ Hybridization

FISH imaging was conducted to examine the protective effect of microalgae on AOB according to their spatial relationships. Figure 4 shows patches of blue (Figure 4a,d), pink (Figure 4b,d), and green (Figure 4c,d). These three colors form an intricate and overlapping pattern of flocculent structures, several micrometers in size, indicating that in light conditions, AOB, NOB, and algae grow and coexist together without free-growing AOB.

4. Discussion

The tolerance of nitrifying bacteria to light irradiation is closely related to the strain type [25]. We used aquaculture pond water as the inoculum for culture enrichment and were fortunate to obtain a typical AOB culture consistent with the dominant AOB in freshwater aquaculture ponds, as reported by Lu et al. (2019) [7]. A light intensity of 800 µE m⁻¹ s⁻¹ significantly inhibited ammonia-oxidation activity, and the degree of inhibition increased further over time (Figure 1). A similar observation was obtained by Wang et al., who reported that the light suppression effect on the activity of AOB and NOB is positively correlated with the light exposure period (10–16 h for 200 µmol m⁻² s⁻¹, 4–5 h for 600 µmol m⁻² s⁻¹, and 2–4 h for 2000 µmol m⁻² s⁻¹) [26]. Continuous illumination severely inhibits AOB [27], and this could be attributed to irreversible damage to the ammonia monooxygenase of AOB [25]. Compared with continuous light irradiation, a 12 h dark/12 h light alternating light pattern did not completely eliminate the influence of light on AOB (Figure 1). This suggests that, under natural conditions, there must be a photoinhibition effect on AOB in aquaculture ponds. These results further enhance our understanding of the ammonia oxidation process in freshwater aquaculture ponds.

Many previous studies have shown that the concentration of Chla is a key factor affecting AOB. For example, the AOB community was strongly correlated with the Chla content in surface sediments in the waters adjacent to Rushan Bay, Shandong Peninsula, China [28]. Climate and local environments play important roles in shaping ammonia-oxidizing archaea (AOA) communities, whereas Chla concentration is a key factor influencing AOB communities [29]. The concentration of Chla is a key factor determining potential nitrification rates in benthic environments, where AOB outnumbers AOA by one order of magnitude [30]. So far, however, few reports have mentioned that Chla promotes AOB growth through the algal shading effect. This study provided a reasonable explanation for the survival of AOB in pond water throughout the year [5]. Sunlight intensity often exceeds 2000 µmol m⁻²·s⁻¹ [13,31]. Ponds are directly exposed to sunlight, and aquaculture waters are disturbed by aerators almost every day during the breeding season, resulting in AOB exposure to sunlight from time to time. It can be imagined that nitrifying bacteria find it hard to survive in aquaculture pond water without the protection afforded by algae and other suspended solids.

FISH images showed that AOB were always associated with microalgae and NOB and that no free AOB were found (Figure 4); consequently, shading by algae is perhaps the best survival strategy for AOB against the effects of solar irradiation. The biological structures of microalgae protect AOB from the inhibiting effects of light exposure, and this is more evident in biofilms. A recent study examined the biofilm that formed on the surface of the polyurethane foam filling a light reactor. The AOB and anaerobic ammonia-oxidizing bacteria occupied the inner biofilm layer, while the outer layer was dominated by microalgae [32]. In aquaculture pond water, most of the particles formed by microalgae and organic debris are several tens of micrometers in size [33]. Although these particles are not as large as those formed under cultivation conditions, they are still sufficient to provide enough shade for AOB growth because the particle size of Nitrosomonas, which are the predominant AOB in pond water, is only about 1.0 µm [34], which is hugely different in volume from shading algae. Where microalgae and AOB coexist, there is not only a good algal shading environment for AOB growth, but algal photosynthesis also provides oxygen for nitrifying bacteria [12]. In addition, AOB generate H⁺ through ammonia oxidation [35] and provide reaction substrates for photosynthesis, maintaining the acid-base balance [12]. AOB and NOB coexist, and AOB provide substrates for the growth of NOB. NOB utilize the metabolic product NO₂⁻-N produced by AOB and prevent high concentrations of NO₂⁻-N, which is toxic to AOB. In microalgae–bacterial wastewater treatment systems, the microalgae–bacteria community can help nitrifying bacteria tolerate white light radiation up to the 1500 µE m⁻² s⁻¹ level [36]. This study, therefore, suggests that microalgae enhance the resistance of AOB to light irradiation in ponds through the shading effect provided by algal chlorophyll, as well as by the close symbiotic relationship between microalgae and AOB.

Microalgae not only provide oxygen for the respiration of aquaculture animals, thus saving mechanical oxygenation costs, but also provide food for filter-feeding animals, thus reducing aquaculture feed costs. Therefore, ponds are good aquaculture systems with low rearing costs and good economic benefits. Due to the currently limited understanding of pond aquaculture systems, it is not possible to install efficient nitrification devices in them similar to those used in circulating aquaculture systems (RAS). The weak nitrification activity in ponds prevents high-density production from becoming possible in RAS. This study expands our understanding of the functions of microalgae in pond aquaculture and shows that microalgae can provide substrates for the growth of nitrifying bacteria, and there is an opportunity for nitrifying bacteria–microalgae symbiotic relationships to develop. These results could enable the future development of a “photosynthetic-nitrification suspension growth system” on the same principles as the “photosynthetic suspended growth systems in aquaculture” [15]. Microalgal assimilation and nitrification–denitrification could remove ammonia from aquaculture water, perhaps enabling ponds with “algae-bacteria” nitrification systems to perform as well as high-density production systems, such as RAS.

5. Conclusions

• Long-term exposure to light has a serious impact on the AOR of aquaculture ponds, as well as on the potential to decrease the abundance of Nitrosomonas AOB species and their ammonia monooxygenase genes.
• In light conditions, AOB, NOB, and algae can coexist and grow together without free-growing AOB.
• Microalgae could enhance the resistance of AOB in ponds to light irradiation when Chla concentrations reach a certain value and can even completely protect AOB from the suppressive effects of light.