Type II Collagen-Conjugated Mesenchymal Stem Cells Micromass for Articular Tissue Targeting
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Immunophenotype Analysis
2.2. Fabrication of Gelatin Microsphere
2.3. Cell Coating
2.4. Preparation of Cell Differentiation and Characterization
2.5. Evaluation of MSCs Differentiation
2.6. Immunofluorescence Staining
2.7. Measurement of Real-Time PCR
2.8. Sulfated Glycosaminoglycan (sGAG) Production Assay
2.9. Preliminary Assessment on Articular Cartilage Surface Binding
2.10. Statistical Analysis
3. Results
3.1. Stem Cell Characterization
3.2. Effect of Incubation Temperature and Period on Cell Glycosylation
3.3. Effect of PPG Coating on MSCs’ Proliferation and Differentiation in Monolayer Culture
3.4. Effect of PPG on MSCs’ Proliferation and Differentiation in 3D Culture
3.5. Conjugation of Antibody on PPG-MSCs in 3D Culture
3.6. Preliminary Assessment on Articular Cartilage Surface Attachment
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Maumus, M.; Pers, Y.-M.; Ruiz, M.; Jorgensen, C.; Noel, D. Mesenchymal stem cells and regenerative medicine: Future perspectives in osteoarthritis. Med. Sci. 2018, 34, 1092–1099. [Google Scholar]
- Vos, T.; Flaxman, A.D.; Naghavi, M.; Lozano, R.; Michaud, C.; Ezzati, M.; Shibuya, K.; Salomon, J.A.; Abdalla, S.; Aboyans, V.; et al. Years lived with disability (YLDs) for 1160 sequelae of 289 diseases and injuries 1990–2010: A systematic analysis for the Global Burden of Disease Study 2010. Lancet 2012, 380, 2163–2196. [Google Scholar] [CrossRef]
- Zhang, W.; Moskowitz, R.W.; Nuki, G.; Abramson, S.; Altman, R.D.; Arden, N.; Bierma-Zeinstra, S.; Brandt, K.D.; Croft, P.; Doherty, M.; et al. OARSI recommendations for the management of hip and knee osteoarthritis, Part II: OARSI evidence-based, expert consensus guidelines. Osteoarthr. Cartil. 2008, 16, 137–162. [Google Scholar] [CrossRef] [PubMed]
- Katz, J.N.; Earp, B.E.; Gomoll, A.H. Surgical management of osteoarthritis. Arthritis Care Res. 2010, 62, 1220–1228. [Google Scholar] [CrossRef] [PubMed]
- Yubo, M.; Yanyan, L.; Li, L.; Tao, S.; Bo, L.; Lin, C. Clinical efficacy and safety of mesenchymal stem cell transplantation for osteoarthritis treatment: A meta-analysis. PLoS ONE 2017, 12, e0175449. [Google Scholar] [CrossRef] [PubMed]
- Jevotovsky, D.S.; Alfonso, A.R.; Einhorn, T.A.; Chiu, E.S. Osteoarthritis and stem cell therapy in humans: A systematic review. Osteoarthr. Cartil. 2018, 26, 711–729. [Google Scholar] [CrossRef]
- Jo, C.H.; Lee, Y.G.; Shin, W.H.; Kim, H.; Chai, J.W.; Jeong, E.C.; Kim, J.E.; Shim, H.; Shin, J.S.; Shin, I.S.; et al. Intra-articular injection of mesenchymal stem cells for the treatment of osteoarthritis of the knee: A proof-of-concept clinical trial. Stem Cells J. 2014, 32, 1254–1266. [Google Scholar] [CrossRef]
- Pers, Y.M.; Rackwitz, L.; Ferreira, R.; Pullig, O.; Delfour, C.; Barry, F.; Sensebe, L.; Cyteval, C.; Lisignoli, G.; Scrauth, J.; et al. Adipose mesenchymal stromal cell-based therapy for severe osteoarthritis of the knee: A phase I dose-escalation Trial. Stem Cells Transl. Med. 2016, 5, 847–856. [Google Scholar] [CrossRef]
- Boberg, E.; von Bahr, L.; Afram, G.; Lindström, C.; Ljungman, P.; Heldring, N.; Petzelbauer, P.; Legert, K.G.; Kadri, N.; Le Blanc, K.; et al. Treatment of chronic GvHD with mesenchymal stromal cells induces durable responses: A phase II study. Stem Cells Transl. Med. 2020, 9, 1190–1202. [Google Scholar] [CrossRef]
- Kim, C.; Keating, A. Cell therapy for knee osteoarthritis: Mesenchymal stromal cells. Gerontology 2019, 65, 294–298. [Google Scholar] [CrossRef]
- Contessi Negrini, N.; Lipreri, M.V.; Tanzi, M.C.; Farè, S. In vitro cell delivery by gelatin microspheres prepared in water-in-oil emulsion. J. Mater. Sci. Mater. Med. 2020, 31, 26. [Google Scholar] [CrossRef] [PubMed]
- Im, G.I.; Kim, T.K. Regenerative therapy for osteoarthritis: A perspective. Int. J. Stem Cells 2020, 13, 177. [Google Scholar] [CrossRef] [PubMed]
- Mancuso, P.; Raman, S.; Glynn, A.; Barry, F.; Murphy, J.M. Mesenchymal stem cell therapy for osteoarthritis: The critical role of the cell secretome. Front. Bioeng. Biotechnol. 2019, 7, 9. [Google Scholar] [CrossRef]
- Park, Y.B.; Ha, C.W.; Lee, C.H.; Yoon, Y.C.; Park, Y.G. Cartilage regeneration in osteoarthritic patients by a composite of allogeneic umbilical cord blood-derived mesenchymal stem cells and hyaluronate hydrogel: Results from a clinical trial for safety and proof-of-concept with 7 years of extended follow-up. Stem Cells Transl. Med. 2017, 6, 613–621. [Google Scholar] [CrossRef] [PubMed]
- Murphy, J.M.; Fink, D.J.; Hunziker, E.B.; Barry, F.P. Stem cell therapy in a caprine model of osteoarthritis. Arthritis Rheum. 2003, 48, 3464–3474. [Google Scholar] [CrossRef] [PubMed]
- Tharmalingam, T.; Sunley, K.; Spearman, M.; Butler, M. Enhanced production of human recombinant proteins from CHO cells grown to high densities in macroporous microcarriers. Mol. Biotechnol. 2011, 49, 263–276. [Google Scholar] [CrossRef]
- Kang, S.W.; Jeon, O.; Kim, B.S. Poly (lactic-co-glycolic acid) microspheres as an injectable scaffold for cartilage tissue engineering. Tissue Eng. 2005, 11, 438–447. [Google Scholar] [CrossRef]
- Kang, S.W.; Yoon, J.R.; Lee, J.S.; Kim, H.J.; Lim, H.W.; Lim, H.C.; Park, J.H.; Kim, B.S. The use of poly (lactic-co-glycolic acid) microspheres as injectable cell carriers for cartilage regeneration in rabbit knees. J. Biomater. Sci. Polym. Ed. 2006, 17, 925–939. [Google Scholar] [CrossRef]
- García Cruz, D.M.; Sardinha, V.; Escobar Ivirico, J.L.; Mano, J.F.; Gómez Ribelles, J.L. Gelatin microparticles aggregates as three-dimensional scaffolding system in cartilage engineering. J. Mater. Sci. Mater. Med. 2013, 24, 503–513. [Google Scholar] [CrossRef]
- Sulaiman, S.; Chowdhury, S.R.; Fauzi, M.B.; Rani, R.A.; Yahaya, N.H.M.; Tabata, Y.; Hiraoka, Y.; Binti Haji Idrus, R.; Min Hwei, N. 3D culture of MSCs on a gelatin microsphere in a dynamic culture system enhances chondrogenesis. Int. J. Mol. Sci. 2020, 21, 2688. [Google Scholar] [CrossRef]
- Conaghan, P.G.; Hunter, D.J.; Cohen, S.B.; Kraus, V.B.; Berenbaum, F.; Lieberman, J.R.; Jones, D.G.; Spitzer, A.I.; Jevsevar, D.S.; Katz, N.P.; et al. Effects of a single intra-articular injection of a microsphere formulation of triamcinolone acetonide on knee osteoarthritis pain: A double-blinded, randomized, placebo-controlled, multinational study. J. Bone Jt. Surg. 2018, 100, 666–677. [Google Scholar] [CrossRef] [PubMed]
- Custódio, C.A.; Mano, J.F. Cell surface engineering to control cellular interactions. Chem. Nano. Mat. 2016, 2, 376–384. [Google Scholar] [CrossRef]
- Dennis, J.E.; Cohen, N.; Goldberg, V.M.; Caplan, A.I. Targeted delivery of progenitor cells for cartilage repair. J. Orthop. Res. 2004, 22, 735–741. [Google Scholar] [CrossRef]
- Lo, C.Y.; Weil, B.R.; Palka, B.A.; Momeni, A.; Canty, J.M.; Neelamegham, S. Cell surface glycoengineering improves selectin-mediated adhesion of mesenchymal stem cells (MSCs) and cardiosphere-derived cells (CDCs): Pilot validation in porcine ischemia-reperfusion model. Biomaterials 2016, 74, 19–30. [Google Scholar] [CrossRef]
- Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.; Krause, D.S.; Deans, R.J.; Keating, A.; Prockop, D.J.; Horwitz, E.M. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef]
- Hayashi, K.; Tabata, Y. Preparation of stem cell aggregates with gelatin microspheres to enhance biological functions. Acta Biomater. 2011, 7, 2797–2803. [Google Scholar] [CrossRef]
- Ozeki, M.; Tabata, Y. In vivo degradability of hydrogels prepared from different gelatins by various cross-linking methods. J. Biomater. Sci. Polym. Ed. 2005, 16, 549–561. [Google Scholar] [CrossRef] [PubMed]
- Ude, C.C.; Sulaiman, S.B.; Min-Hwei, N.; Hui-Cheng, C.; Ahmad, J.; Yahaya, N.M.; Saim, A.B.; Idrus, R.B. Cartilage regeneration by chondrogenic induced adult stem cells in osteoarthritic sheep model. PLoS ONE 2014, 9, e98770. [Google Scholar] [CrossRef]
- Hafez, P.; Jose, S.; Chowdhury, S.R.; Ng, M.H.; Ruszymah, B.H.I.; Abdul Rahman Mohd, R. Cardiomyogenic differentiation of human sternal bone marrow mesenchymal stem cells using a combination of basic fibroblast growth factor and hydrocortisone. Cell Biol. Int. 2016, 40, 55–64. [Google Scholar] [CrossRef] [PubMed]
- Ude, C.C.; Shamsul, B.S.; Ng, M.H.; Chen, H.C.; Ohnmar, H.; Amaramalar, S.N.; Rizal, A.R.; Johan, A.; Norhamdan, M.; Azizi, M.; et al. Long-term evaluation of osteoarthritis sheep knee, treated with TGF-β3 and BMP-6 induced multipotent stem cells. Exp. Gerontol. 2018, 104, 43–51. [Google Scholar] [CrossRef]
- He, X.T.; Wang, J.; Li, X.; Yin, Y.; Sun, H.H.; Chen, F.M. The critical role of cell homing in cytotherapeutics and regenerative medicine. Adv. Ther. 2019, 2, 1800098. [Google Scholar] [CrossRef]
- Aicart-Ramos, C.; Valero, R.A.; Rodriguez-Crespo, I. Protein palmitoylation and subcellular trafficking. Biochim. Biophys. Acta Biomembr. 2011, 1808, 2981–2994. [Google Scholar] [CrossRef] [PubMed]
- Akerström, B.; Brodin, T.H.; Reis, K.; Björck, L. Protein G: A powerful tool for binding and detection of monoclonal and polyclonal antibodies. J. Immunol. 1985, 135, 2589–2592. [Google Scholar] [PubMed]
- Ko, I.K.; Kean, T.J.; Dennis, J.E. Targeting mesenchymal stem cells to activated endothelial cells. Biomaterials 2009, 30, 3702–3710. [Google Scholar] [CrossRef] [PubMed]
- Eyre, D. Collagen of articular cartilage. Arthritis Res. 2002, 4, 30–35. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chen, A.; Zheng, G.; Tykocinski, M.L. Hierarchical costimulator thresholds for distinct immune responses: Application of a novel two-step Fc fusion protein transfer method. J. Immunol. 2000, 164, 705–711. [Google Scholar] [CrossRef]
- Sun, X.; Zhang, G.; Patel, D.; Stephens, D.; Gobin, A.M. Targeted cancer therapy by immunoconjugated gold–gold sulfide nanoparticles using Protein G as a cofactor. Ann. Biomed. Eng. 2012, 40, 2131–2139. [Google Scholar] [CrossRef]
- Centi, S.; Ratto, F.; Tatini, F.; Lai, S.; Pini, R. Ready-to-use protein G-conjugated gold nanorods for biosensing and biomedical applications. J. Nanobiotechnol. 2018, 16, 1–11. [Google Scholar] [CrossRef]
- Hubka, K.M.; Dahlin, R.L.; Meretoja, V.V.; Kasper, F.K.; Mikos, A.G. Enhancing chondrogenic phenotype for cartilage tissue engineering: Monoculture and coculture of articular chondrocytes and mesenchymal stem cells. Tissue Eng. Part B Rev. 2014, 20, 641–654. [Google Scholar] [CrossRef]
- Schnabel, M.; Marlovits, S.; Eckhoff, G.; Fichtel, I.; Gotzen, L.; Vecsei, V.; Schlegel, J. Dedifferentiation—Associated changes in morphology and gene expression in primary human articular chondrocytes in cell culture. Osteoarthr. Cartil. 2002, 10, 62–70. [Google Scholar] [CrossRef]
- Von der Mark, K.; Gauss, V.; von der Mark, H.; Muller, P. Relationship between cell shape and type of collagen synthesised as chondrocytes lose their cartilage phenotype in culture. Nature 1977, 267, 531–532. [Google Scholar] [CrossRef] [PubMed]
- Giovannini, S.; Diaz-Romero, J.; Aigner, T.; Mainil-Varlet, P.; Nesic, D. Population doublings and percentage of S100-positive cells as predictors of in vitro chondrogenicity of expanded human articular chondrocytes. J. Cell Physiol. 2010, 222, 411–420. [Google Scholar] [CrossRef]
- Leong, W.; Lau, T.T.; Wang, D.A. A temperature-Cured dissolvable gelatin microsphere-based cell carrier for chondrocyte delivery in a hydrogel scaffolding system. Acta Biomater. 2013, 9, 6459–6467. [Google Scholar] [CrossRef] [PubMed]
- Stefani, R.M.; Lee, A.J.; Tan, A.R.; Halder, S.S.; Hu, Y.; Guo, X.E.; Stoker, A.M.; Ateshian, G.A.; Marra, K.G.; Cook, J.L.; et al. Sustained low-dose dexamethasone delivery via a PLGA microsphere-embedded agarose implant for enhanced osteochondral repair. Acta Biomater. 2020, 102, 326–340. [Google Scholar] [CrossRef] [PubMed]
- Tan, H.; Huang, D.; Lao, L.; Gao, C. RGD modified PLGA/gelatin microspheres as microcarriers for chondrocyte delivery. J. Biomed. Mater. Res. B Appl. Biomater. 2009, 91, 228–238. [Google Scholar] [CrossRef]







| Gen Name | Forward 5′-3′ | Reverse 5′-3′ |
|---|---|---|
| Type I Col | AAGGCTTCAAGGTCCCCCTGGTG | CAGCACCAGTAGCACCATCATTTC |
| Type II Col | GGCAATAGCAGGTTCACGTACA | CGATAACAGTCTTGCCCCACTT |
| Aggrecan | ACTTCCGCTGGTCAGATGGA | TCTCGTGCCAGATCATCACC |
| GAPDH | GGCGATGCTGGCGCTGAGTAC | TGGTTCACACCCATGACGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sulaiman, S.B.; Chowdhury, S.R.; Busra, M.F.B.M.; Abdul Rani, R.B.; Mohamad Yahaya, N.H.B.; Tabata, Y.; Hiraoka, Y.; Haji Idrus, R.B.; Hwei, N.M. Type II Collagen-Conjugated Mesenchymal Stem Cells Micromass for Articular Tissue Targeting. Biomedicines 2021, 9, 880. https://doi.org/10.3390/biomedicines9080880
Sulaiman SB, Chowdhury SR, Busra MFBM, Abdul Rani RB, Mohamad Yahaya NHB, Tabata Y, Hiraoka Y, Haji Idrus RB, Hwei NM. Type II Collagen-Conjugated Mesenchymal Stem Cells Micromass for Articular Tissue Targeting. Biomedicines. 2021; 9(8):880. https://doi.org/10.3390/biomedicines9080880
Chicago/Turabian StyleSulaiman, Shamsul Bin, Shiplu Roy Chowdhury, Mohd Fauzi Bin Mh Busra, Rizal Bin Abdul Rani, Nor Hamdan Bin Mohamad Yahaya, Yasuhiko Tabata, Yosuke Hiraoka, Ruszymah Binti Haji Idrus, and Ng Min Hwei. 2021. "Type II Collagen-Conjugated Mesenchymal Stem Cells Micromass for Articular Tissue Targeting" Biomedicines 9, no. 8: 880. https://doi.org/10.3390/biomedicines9080880
APA StyleSulaiman, S. B., Chowdhury, S. R., Busra, M. F. B. M., Abdul Rani, R. B., Mohamad Yahaya, N. H. B., Tabata, Y., Hiraoka, Y., Haji Idrus, R. B., & Hwei, N. M. (2021). Type II Collagen-Conjugated Mesenchymal Stem Cells Micromass for Articular Tissue Targeting. Biomedicines, 9(8), 880. https://doi.org/10.3390/biomedicines9080880

