Comparison of Multiple Carbapenemase Tests Based on an Unbiased Colony-Selection Method
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strain Re-Isolation and Species Identification
2.2. Conventional Colony and Unbiased Colony-Selection Methods
2.3. BD CPO Panel
2.4. Carba5 Test
2.5. Multiplex PCR (MPCR)
2.6. MIC of Antibiotics
3. Results
3.1. Discrepancy of MPCR Results Based on Different Colony-Selection Methods (The FirstAll Method versus The Conventional Method)
3.2. Carbapenemase Testing Comparison (CPO Panel versus mCIM/eCIM) Based on FirstAll
3.3. Carbapenemase Testing Comparison (CPO Panel versus MPCR) Based on FirstAll
3.4. Carbapenemase Testing Comparison (Carba5 versus MPCR) Based on FirstAll
3.5. Carbapenemase Testing Comparison (CPO Panel versus Carba5) Based on FirstAll
3.6. Association between Carbapenemase Tests and MICs of Ceftazidime–Avibactam
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bonomo, R.A.; Burd, E.M.; Conly, J.; Limbago, B.M.; Poirel, L.; Segre, J.A.; Westblade, L.F. Carbapenemase-Producing Organisms: A Global Scourge. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 2018, 66, 1290–1297. [Google Scholar] [CrossRef] [PubMed]
- Cui, X.; Zhang, H.; Du, H. Carbapenemases in Enterobacteriaceae: Detection and Antimicrobial Therapy. Front. Microbiol. 2019, 10, 1823. [Google Scholar] [CrossRef] [PubMed]
- van Duin, D.; Doi, Y. The global epidemiology of carbapenemase-producing Enterobacteriaceae. Virulence 2017, 8, 460–469. [Google Scholar] [CrossRef] [PubMed]
- CRE Technical Information | CRE | HAI | CDC. 2021. Available online: https://www.cdc.gov/cre/hcp/infection-control/?CDC_AAref_Val=https://www.cdc.gov/hai/organisms/cre/technical-info.html (accessed on 10 February 2023).
- Tamma, P.D.; Goodman, K.E.; Harris, A.D.; Tekle, T.; Roberts, A.; Taiwo, A.; Simner, P.J. Comparing the Outcomes of Patients With Carbapenemase-Producing and Non-Carbapenemase-Producing Carbapenem-Resistant Enterobacteriaceae Bacteremia. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 2017, 64, 257–264. [Google Scholar] [CrossRef] [PubMed]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 33rd ed.; CLSI supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2023. [Google Scholar]
- Maurer, F.P.; Castelberg, C.; Quiblier, C.; Bloemberg, G.V.; Hombach, M. Evaluation of Carbapenemase Screening and Confirmation Tests with Enterobacteriaceae and Development of a Practical Diagnostic Algorithm. J. Clin. Microbiol. 2015, 53, 95–104. [Google Scholar] [CrossRef] [PubMed]
- Kalpana, S.; Lin, W.Y.; Wang, Y.C.; Fu, Y.; Lakshmi, A.; Wang, H.Y. Antibiotic Resistance Diagnosis in ESKAPE Pathogens—A Review on Proteomic Perspective. Diagnostics 2023, 13, 1014. [Google Scholar] [CrossRef] [PubMed]
- Lippi, G.; Rin, G.D. Advantages and limitations of total laboratory automation: A personal overview. Clin. Chem. Lab. Med. (CCLM) 2019, 57, 802–811. [Google Scholar] [CrossRef] [PubMed]
- Kragh, K.N.; Alhede, M.; Rybtke, M.; Stavnsberg, C.; Jensen, P.Ø.; Tolker-Nielsen, T.; Whiteley, M.; Bjarnsholt, T. The Inoculation Method Could Impact the Outcome of Microbiological Experiments. Appl. Environ. Microbiol. 2018, 84, e02264-17. [Google Scholar] [CrossRef] [PubMed]
- Bloom, D.E.; Cadarette, D. Infectious Disease Threats in the Twenty-First Century: Strengthening the Global Response. Front. Immunol. 2019, 10, 549. [Google Scholar] [CrossRef] [PubMed]
- Mwangi, M.M.; Wu, S.W.; Zhou, Y.; Sieradzki, K.; de Lencastre, H.; Richardson, P.; Bruce, D.; Rubin, E.; Myers, E.; Siggia, E.D.; et al. Tracking the in vivo evolution of multidrug resistance in Staphylococcus aureus by whole-genome sequencing. Proc. Natl. Acad. Sci. USA 2007, 104, 9451–9456. [Google Scholar] [CrossRef] [PubMed]
- Cheng, S.; Fleres, G.; Chen, L.; Liu, G.; Hao, B.; Newbrough, A.; Driscoll, E.; Shields, R.K.; Squires, K.M.; Chu, T.-Y.; et al. Within-Host Genotypic and Phenotypic Diversity of Contemporaneous Carbapenem-Resistant Klebsiella pneumoniae from Blood Cultures of Patients with Bacteremia. mBio 2022, 13, e0290622. [Google Scholar] [CrossRef] [PubMed]
- Lindstedt, K.; Buczek, D.; Pedersen, T.; Hjerde, E.; Raffelsberger, N.; Suzuki, Y.; Brisse, S.; Holt, K.; Samuelsen, Ø.; Sundsfjord, A. Detection of Klebsiella pneumoniae human gut carriage: A comparison of culture, qPCR, and whole metagenomic sequencing methods. Gut Microbes 2022, 14, 2118500. [Google Scholar] [CrossRef] [PubMed]
- Both, A.; Kruse, F.; Mirwald, N.; Franke, G.; Christner, M.; Huang, J.; Hansen, J.L.; Kröger, N.; Berneking, L.; Lellek, H.; et al. Population dynamics in colonizing vancomycin-resistant Enterococcus faecium isolated from immunosuppressed patients. J. Glob. Antimicrob. Resist. 2022, 28, 267–273. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.Y.; Li, W.C.; Huang, K.Y.; Chung, C.R.; Horng, J.T.; Hsu, J.F.; Lu, J.J.; Lee, T.Y. Rapid classification of group B Streptococcus serotypes based on matrix-assisted laser desorption ionization-time of flight mass spectrometry and machine learning techniques. BMC Bioinform. 2019, 20, 703. [Google Scholar] [CrossRef] [PubMed]
- Wareth, G.; Sprague, L.D.; Neubauer, H.; Pletz, M.W. Klebsiella pneumoniae in Germany: An overview on spatiotemporal distribution and resistance development in humans. Ger. J. Microbiol. 2021, 1, 16–25. [Google Scholar] [CrossRef]
- Wareth, G.; Neubauer, H. The Animal-foods-environment interface of Klebsiella pneumoniae in Germany: An observational study on pathogenicity, resistance development and the current situation. Vet. Res. 2021, 52, 16. [Google Scholar] [CrossRef] [PubMed]
- Yoshino, M.; Aihara, M.; Gotoh, Y.; Akimoto, M.; Tatsuhara, W.; Kiyosuke, M.; Matsushima, Y.; Uchiumi, T.; Hayashi, T.; Kang, D. Stepwise Evolution of a Klebsiella pneumoniae Clone within a Host Leading to Increased Multidrug Resistance. mSphere 2021, 6, e0073421. [Google Scholar] [CrossRef] [PubMed]
- Baeza, L.L.; Pfennigwerth, N.; Greissl, C.; Göttig, S.; Saleh, A.; Stelzer, Y.; Gatermann, S.; Hamprecht, A. Comparison of five methods for detection of carbapenemases in Enterobacterales with proposal of a new algorithm. Clin. Microbiol. Infect. 2019, 25, 1286.e9–1286.e15. [Google Scholar] [CrossRef] [PubMed]
- Khalifa, H.O.; Okanda, T.; Abd El-Hafeez, A.A.; El Latif, A.A.; Habib, A.G.K.; Yano, H.; Kato, Y.; Matsumoto, T. Comparative Evaluation of Five Assays for Detection of Carbapenemases with a Proposed Scheme for Their Precise Application. J. Mol. Diagn. 2020, 22, 1129–1138. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer | Nucleotide Sequence (5′-3′) | Amplicon Size (bp) |
---|---|---|---|
KPC | F R | CTGACCAACCTCGTCGCGGAAC TTGTTAGGCGCCCGGGTGTAGA | 731 |
OXA | F R | TGGGATGGACAGACGCGCGATA CCAACCGACCCACCAGCCAATC | 393 |
VIM | F R | TTGGACTTCCCGTAACGCGTGC AGCTCTACTGGACCGAAGCGCA | 208 |
NDM | F R | AAGGCCAAGTCGCTCGGCAATC ACTCGTCGCAAAGCCCAGCTTC | 264 |
IMP | F R | GCAGGAGCGGCTTTGCCTGATT GGCGGACTTTGGCCAAGCTTCT | 543 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, H.-Y.; Tseng, Y.-J.; Lin, W.-Y.; Wang, Y.-C.; Lin, T.-W.; Hsu, J.-F.; Wu, M.Y.-C.; Wu, C.-H.; Kalpana, S.; Lu, J.-J. Comparison of Multiple Carbapenemase Tests Based on an Unbiased Colony-Selection Method. Biomedicines 2024, 12, 2134. https://doi.org/10.3390/biomedicines12092134
Wang H-Y, Tseng Y-J, Lin W-Y, Wang Y-C, Lin T-W, Hsu J-F, Wu MY-C, Wu C-H, Kalpana S, Lu J-J. Comparison of Multiple Carbapenemase Tests Based on an Unbiased Colony-Selection Method. Biomedicines. 2024; 12(9):2134. https://doi.org/10.3390/biomedicines12092134
Chicago/Turabian StyleWang, Hsin-Yao, Yi-Ju Tseng, Wan-Ying Lin, Yu-Chiang Wang, Ting-Wei Lin, Jen-Fu Hsu, Marie Yung-Chen Wu, Chiu-Hsiang Wu, Sriram Kalpana, and Jang-Jih Lu. 2024. "Comparison of Multiple Carbapenemase Tests Based on an Unbiased Colony-Selection Method" Biomedicines 12, no. 9: 2134. https://doi.org/10.3390/biomedicines12092134
APA StyleWang, H.-Y., Tseng, Y.-J., Lin, W.-Y., Wang, Y.-C., Lin, T.-W., Hsu, J.-F., Wu, M. Y.-C., Wu, C.-H., Kalpana, S., & Lu, J.-J. (2024). Comparison of Multiple Carbapenemase Tests Based on an Unbiased Colony-Selection Method. Biomedicines, 12(9), 2134. https://doi.org/10.3390/biomedicines12092134