The ABA/LANCL1-2 Hormone/Receptors System Controls ROS Production in Cardiomyocytes through ERRα
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Lentiviral and Retroviral Cell Transduction
2.3. Cell Viability Assay
2.4. Lipid Peroxides Measurement
2.5. qRT-PCR Analysis
2.6. Western Blot Analysis
2.7. ROS Detection Assays
2.8. Statistical Analysis
3. Results
3.1. Overexpression and Silencing of LANCL1 or LANCL2 in H9c2 Cells
3.2. Overexpression of LANCL1 and LANCL2 Protects H9c2 Cardiomyocytes from H2O2 Induced-Oxidative Stress
3.3. Overexpression of LANCL1 and LANCL2 Decreases, While Their Combined Silencing Increases, the Transcription and Expression of Radicals-Generating COX2, XO, and NOX4
3.4. LANCL1/2-Overexpression Increases, While Their Double-Silencing Decreases, the Transcription and Expression of the Radical Scavenging Enzymes SOD2 and GPX4
3.5. LANCL1/2-Overexpression Decreases and Their Combined Silencing Conversely Increases ROS Content in H9c2 Cells
3.6. The ABA/LANCL1-2 System Controls ROS Metabolism via the Transcription Factor ERRα
3.7. ERRα Silencing Increases ROS Production in LANCL1/2-Overexpressing Cells
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wang, J.Y.; Lin, P.Y.; Al-Babili, S. On the biosynthesis and evolution of apocarotenoid plant growth regulators. Semin. Cell Dev. Biol. 2021, 109, 3–11. [Google Scholar] [CrossRef] [PubMed]
- Bruzzone, S.; Ameri, P.; Briatore, L.; Mannino, E.; Basile, G.; Andraghetti, G.; Grozio, A.; Magnone, M.; Guida, L.; Scarfì, S.; et al. The plant hormone abscisic acid increases in human plasma after hyperglycemia and stimulates glucose consumption by adipocytes and myoblasts. FASEB J. 2012, 26, 1251–1260. [Google Scholar] [CrossRef] [PubMed]
- Magnone, M.; Leoncini, G.; Vigliarolo, T.; Emionite, L.; Sturla, L.; Zocchi, E.; Murialdo, G. Chronic Intake of Micrograms of Abscisic Acid Improves Glycemia and Lipidemia in a Human Study and in High-Glucose Fed Mice. Nutrients 2018, 10, 1495. [Google Scholar] [CrossRef] [PubMed]
- Spinelli, S.; Magnone, M.; Guida, L.; Sturla, L.; Zocchi, E. The ABA-LANCL hormone-receptor system in the control of glycemia, of cardiomyocyte energy metabolism and in neuro-protection: A new ally in the treatment of diabetes mellitus? Int. J. Mol. Sci. 2023, 24, 1199. [Google Scholar] [CrossRef]
- Magnone, M.; Spinelli, S.; Begani, G.; Guida, L.; Sturla, L.; Emionite, L.; Zocchi, E. Abscisic acid improves insulin action on glycemia in insulin-deficient mouse models of type 1 diabetes. Metabolites 2022, 12, 523. [Google Scholar] [CrossRef]
- Spinelli, S.; Guida, L.; Vigliarolo, T.; Passalacqua, M.; Begani, G.; Magnone, M.; Sturla, L.; Benzi, A.; Ameri, P.; Lazzarini, E.; et al. The ABA-LANCL1/2 Hormone-Receptors System Protects H9c2 Cardiomyocytes from Hypoxia Induced Mitochondrial Injury via an AMPK- and NO-Mediated Mechanism. Cells 2022, 11, 2888. [Google Scholar] [CrossRef]
- Spinelli, S.; Cossu, V.; Passalacqua, M.; Hansen, J.B.; Guida, L.; Magnone, M.; Sambuceti, G.; Marini, C.; Sturla, L.; Zocchi, E. The ABA/LANCL1/2 Hormone/Receptor System Controls Adipocyte Browning and Energy Expenditure. Int. J. Mol. Sci. 2023, 24, 3489. [Google Scholar] [CrossRef]
- Scarfì, S.; Fresia, C.; Ferraris, C.; Bruzzone, S.; Fruscione, F.; Usai, C.; Benvenuto, F.; Magnone, M.; Podestà, M.; Sturla, L.; et al. The plant hormone abscisic acid stimulates the proliferation of human hemopoietic progenitors through the second messenger cyclic ADP-ribose. Stem. Cells 2009, 27, 2469–2477. [Google Scholar] [CrossRef]
- Sturla, L.; Fresia, C.; Guida, L.; Bruzzone, S.; Scarfì, S.; Usai, C.; Fruscione, F.; Magnone, M.; Millo, E.; Basile, G.; et al. LANCL2 Is Necessary for Abscisic Acid Binding and Signaling in Human Granulocytes and in Rat Insulinoma Cells. J. Biol. Chem. 2009, 284, 28045–28057. [Google Scholar] [CrossRef]
- Spinelli, S.; Begani, G.; Guida, L.; Magnone, M.; Galante, D.; D′Arrigo, C.; Scotti, C.; Iamele, L.; De Jonge, H.; Zocchi, E.; et al. LANCL1 binds abscisic acid and stimulates glucose transport and mitochondrial respiration in muscle cells via the AMPK/PGC-1α/Sirt1 pathway. Mol. Metab. 2021, 53, 101263. [Google Scholar] [CrossRef]
- Sies, H.; Jones, D.P. Reactive oxygen species (ROS) as pleiotropic physiological signaling agents. Nat. Rev. Mol. Cell Biol. 2020, 21, 363–383. [Google Scholar] [CrossRef] [PubMed]
- Cadenasa, S. ROS and redox signaling in myocardial ischemia-reperfusion injury and cardioprotection. Free Radic. Biol. Med. 2018, 117, 76–89. [Google Scholar] [CrossRef] [PubMed]
- Shenshu Yang, S.; Lian, G. ROS and diseases: Role in metabolism and energy supply. Mol. Cell. Biochem. 2020, 467, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Valko, M.; Leibfritz, D.; Moncol, J.; Cronin, M.T.K.; Mazur, M.; Telser, J. Free radicals and antioxidants in normal physiological functions and human disease. Int. J. Biochem. Cell Biol. 2007, 39, 44–84. [Google Scholar] [CrossRef] [PubMed]
- He, L.; He, T.; Farrar, S.; Jia, L.; Liu, T.; Ma, X. Antioxidants maintain cellular redox homeostasis by elimination of reactive oxygen species. Cell. Physiol. Biochem. 2017, 44, 532–553. [Google Scholar] [CrossRef] [PubMed]
- Scholtes, C.; Giguère, V. Transcriptional Regulation of ROS Homeostasis by the ERR Subfamily of Nuclear Receptors. Antioxidants 2021, 10, 437. [Google Scholar] [CrossRef]
- Huss, J.M.; Garbacz, W.G.; Xie, W. Constitutive activities of estrogen-related receptors: Transcriptional regulation of metabolism by the ERR pathways in health and disease. Biochim. Biophys. Acta 2015, 9, 1912–1927. [Google Scholar] [CrossRef]
- Vernier, M.; Dufour, C.R.; McGuirk, S.; Scholtes, C.; Li, X.; Bourmeau, G.; Kuasne, H.; Park, M.; St-Pierre, J.; Audet-Walsh, E.; et al. Estrogen-related Receptors are Targetable ROS sensors. Genes. Dev. 2020, 34, 544–559. [Google Scholar] [CrossRef]
- Giguère, V. Transcriptional Control of Energy Homeostasis by the Estrogen-related Receptors. Endocr. Rev. 2008, 29, 677–696. [Google Scholar] [CrossRef]
- Villena, J.A.; Hock, M.B.; Chang, V.Y.; Barcas, J.E.; Gigue, V.; Kralli, A. Orphan nuclear receptor estrogen-related receptor is essential for adaptive thermogenesis. Proc. Natl. Acad. Sci. USA 2007, 104, 1418–1423. [Google Scholar] [CrossRef]
- Deblois, G.; Smith, H.W.; Tam, I.S.; Gravel, S.P.; Caron, M.; Savage, P.; Labbé, D.P.; Bégin, L.R.; Tremblay, M.L.; Park, M.; et al. ERRα Mediates Metabolic Adaptations Driving Lapatinib Resistance in Breast Cancer. Nat. Commun. 2016, 7, 12156. [Google Scholar] [CrossRef]
- Scarpulla, R.C. Metabolic control of mitochondrial biogenesis through the PGC-1 family regulatory network. Biochim. Biophys. Acta 2011, 1813, 1269–1278. [Google Scholar] [CrossRef]
- Kong, X.; Wang, R.; Xue, Y.; Liu, X.; Zhang, H.; Chen, Y.; Fang, F.; Chang, Y. Sirtuin 3, a new target of PGC-1alpha, plays an important role in the suppression of ROS and mitochondrial biogenesis. PLoS ONE 2010, 22, e11707. [Google Scholar]
- Magnone, M.; Emionite, L.; Guida, L.; Vigliarolo, T.; Sturla, L.; Spinelli, S.; Buschiazzo, A.; Marini, C.; Sambuceti, G.; De Flora, A.; et al. Insulin-independent stimulation of skeletal muscle glucose uptake by low-dose abscisic acid via AMPK activation. Sci. Rep. 2020, 10, 1454. [Google Scholar] [CrossRef]
- Spinelli, S.; Guida, L.; Passalacqua, M.; Magnone, M.; Cossu, V.; Sambuceti, G.; Marini, C.; Sturla, L.; Zocchi, E. Abscisic Acid and Its Receptors LANCL1 and LANCL2 Control Cardiomyocyte Mitochondrial Function, Expression of Contractile, Cytoskeletal and Ion Channel Proteins and Cell Proliferation via ERRα. Antioxidants 2023, 12, 1692. [Google Scholar] [CrossRef]
- Spinelli, S.; Bruschi, M.; Passalacqua, M.; Guida, L.; Magnone, M.; Sturla, L.; Zocchi, E. Estrogen-Related Receptor α: A Key Transcription Factor in the Regulation of Energy Metabolism at an Organismic Level and a Target of the ABA/LANCL Hormone Receptor System. Int. J. Mol. Sci. 2024, 25, 4796. [Google Scholar] [CrossRef]
- Cea, M.; Cagnetta, A.; Adamia, S.; Acharya, C.; Tai, Y.T.; Fulciniti, M.; Ohguchi, H.; Munshi, A.; Acharya, P.; Bhasin, M.K.; et al. Evidence for a role of the histone deacetylase SIRT6 in DNA damage response of multiple myeloma cells. Blood 2016, 127, 1138–1150. [Google Scholar] [CrossRef]
- O′Brien, J.; Wilson, I.; Orton, T.; Pognan, F. Investigation of the Alamar Blue (resazurin) fluorescent dye for the assessment of mammalian cell cytotoxicity. Eur. J. Biochem. 2000, 17, 5421–5426. [Google Scholar] [CrossRef]
- Pap, E.H.; Drummen, G.P.; Post, J.A.; Rijken, P.J.; Wirtz, K.W. Fluorescent fatty acid to monitor reactive oxygen in single cells. Methods Enzymol. 2000, 319, 603–612. [Google Scholar]
- Vigliarolo, T.; Guida, L.; Millo, E.; Fresia, C.; Turco, E.; de Flora, A.; Zocchi, E. Abscisic acid transport in human erythrocytes. J. Biol. Chem. 2015, 290, 13042–13052. [Google Scholar] [CrossRef]
- Gomes, A.; Fernandes, E.; Lima, J.L. Fluorescence probes used for detection of reactive oxygen species. J. Biochem. Biophys. Methods 2005, 65, 45–80. [Google Scholar] [CrossRef] [PubMed]
- Robinson, K.M.; Janes, M.S.; Pehar, M.; Monette, J.S.; Ross, M.F.; Hagen, T.M.; Murphy, M.P.; Beckmanet, J.S. Selective fluorescent imaging of superoxide in vivo using ethidium-based probes. Proc. Natl. Acad. Sci. USA 2006, 103, 15038–15043. [Google Scholar] [CrossRef] [PubMed]
- Ransy, C.; Vaz, C.; Lombes, A.; Bouillaud, F. Use of H2O2 to Cause Oxidative Stress, the Catalase Issue. Int. J. Mol. Sci. 2020, 21, 9149. [Google Scholar] [CrossRef] [PubMed]
- Jiang, J.; Borisenko, G.G.; Osipov, A.; Martin, I.; Chen, R.; Shvedova, A.A.; Sorokin, A.; Tyurina, Y.Y.; Potapovich, A.; Tyurin, V.A.; et al. Arachidonic acid-induced carbon-centered radicals and phospholipid peroxidation in cyclo-oxygenase-2-transfected PC12 cells. J. Neurochem. 2004, 90, 1036–1049. [Google Scholar] [CrossRef]
- Sofiullah, S.S.M.; Murugan, D.D.; Muid, S.A.; Seng, W.Y.; Abdul Kadir, S.Z.S.A.; Abas, R.; Ridzuan, N.R.A.; Zamakshshari, N.H.; Woon, C.K. Natural bioactive compounds targeting NADPH Oxidase pathway in cardiovascular diseases. Molecules 2023, 28, 1047. [Google Scholar] [CrossRef]
- Granger, D.N.; Kvietys, P.R. Reperfusion injury and reactive oxygen species: The evolution of a concept. Redox Biol. 2015, 6, 524–551. [Google Scholar] [CrossRef]
- Brigelius-Flohé, R.; Maiorino, M. Glutathione peroxidases. Biochim. Biophys. Acta 2013, 5, 3289–3303. [Google Scholar] [CrossRef]
- Forcina, G.C.; Dixon, S.J. GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis. Proteomics 2019, 18, e1800311. [Google Scholar] [CrossRef]
- Chen, Z.; Yan, Y.; Qi, C.; Liu, J.; Li, L.; Wang, J. The Role of Ferroptosis in Cardiovascular Disease and Its Therapeutic Significance. Front. Cardiovasc. Med. 2021, 8, 733229. [Google Scholar] [CrossRef]
- Huang, H.; Tsui, Y.M.; Ho, D.W.; Chung, C.Y.; Sze, K.M.; Lee, E.; Cheung, G.C.; Zhang, V.X.; Wang, X.; Lyu, X.; et al. LANCL1, a cell surface protein, promotes liver tumor initiation through FAM49B-Rac1 axis to suppress oxidative stress. Hepatology 2024, 79, 323–340. [Google Scholar] [CrossRef]
- Zhao, Y.; Wang, J.; Shi, S.; Lan, X.; Cheng, X.; Li, L.; Zou, Y.; Jia, L.; Liu, W.; Luo, Q.; et al. LanCL2 Implicates in Testicular Redox Homeostasis and Acrosomal Maturation. Antioxidants 2024, 13, 534. [Google Scholar] [CrossRef] [PubMed]
- Kreiter, J.; Rupprecht, A.; Škulj, S.; Brklăjca, Z.; Žuna, K.; Knyazev, D.G.; Bardakji, S.; Vazdar, M.; Pohl, E.E. ANT1 Activation and Inhibition Patterns Support the Fatty Acid Cycling Mechanism for Proton Transport. Int. J. Mol. Sci. 2021, 22, 2490. [Google Scholar] [CrossRef] [PubMed]
- Scialò, F.; Fernández-Ayala, D.J.; Sanz, A. Role of Mitochondrial Reverse Electron Transport in ROS Signaling: Potential Roles in Health and Disease. Front. Physiol. 2017, 8, 428. [Google Scholar] [CrossRef] [PubMed]
- Ramírez-Camacho, I.; Flores-Herrera, O.; Zazueta, C. The relevance of the supramolecular arrangements of the respiratory chain complexes in human diseases and aging. Mitochondrion 2019, 47, 266–272. [Google Scholar] [CrossRef] [PubMed]
- Ramzan, R.; Vogt, S.; Kadenbach, B. Stress-mediated generation of deleterious ROS in healthy individuals-role of cytochrome c oxidase. J. Mol. Med. 2020, 98, 651–657. [Google Scholar] [CrossRef]
- Dröse, S.; Brandt, U. Molecular mechanisms of superoxide production by the mitochondrial respiratory chain. Adv. Exp. Med. Biol. 2012, 748, 145–169. [Google Scholar]
- Grivennikova, V.G.; Kozlovsky, V.S.; Vinogradov, A.D. Respiratory complex II: ROS production and the kinetics of ubiquinone reduction. Biochim. Biophys. Acta Bioenerg. 2017, 1858, 109–117. [Google Scholar] [CrossRef]
- Larosa, V.; Remacle, C. Insights into the respiratory chain and oxidative stress. Biosci. Rep. 2018, 38, BSR20171492. [Google Scholar] [CrossRef]
- Mazat, J.P.; Devin, A.; Ransac, S. Modelling mitochondrial ROS production by the respiratory chain. Cell. Mol. Life Sci. 2020, 77, 455–465. [Google Scholar] [CrossRef]
- Kröger, A. Fumarate as terminal acceptor of phosphorylative electron transport. Biochim. Biophys. Acta 1978, 505, 129–145. [Google Scholar] [CrossRef]
- Spinelli, J.B.; Rosen, P.C.; Sprenger, H.G.; Puszynska, A.M.; Mann, J.L.; Roessler, J.M.; Cangelosi, A.L.; Henne, A.; Condon, K.J.; Zhang, T.; et al. Fumarate is a terminal electron acceptor in the mammalian electron transport chain. Science 2021, 374, 1227–1237. [Google Scholar] [CrossRef] [PubMed]
- Ross, T.; Szczepanek, K.; Bowler, E.; Hu, Y.; Larner, A.; Lesnefsky, E.J.; Chen, Q. Reverse electron flow-mediated ROS generation in ischemia-damaged mitochondria: Role of complex I inhibition vs. depolarization of inner mitochondrial membrane. Biochim. Biophys. Acta 2013, 1830, 4537–4542. [Google Scholar] [CrossRef] [PubMed]
- Miwa, S.; Brand, M.D. Mitochondrial matrix reactive oxygen species production is very sensitive to mild uncoupling. Biochem. Soc. Trans. 2003, 31, 1300–1301. [Google Scholar] [CrossRef] [PubMed]
Rat Genes | Accession N. | Forward Primer 5′-3′ | Reverse Primer 5′-3′ |
---|---|---|---|
Lancl1 | NM_053723 | TCTTGCTCCTCATCCTGCTCATC | CACTGTACTCGCCGAAGGTCTC |
Lancl2 | NM_001014187 | GGTGCCACGGTGCTCCAG | CCTCGCTGCCAAATCACATCAC |
Sod2 | NM_017051 | TAAGGGTGGTGGAGAACCCA | ACCTTGGACTCCCACAGACA |
Nox4 | NM_053524 | CTGTACAACCAAGGGCCAGA | GCTCTGCTCAAACACAATCCT |
Gpx4 | NM_017165 | CCGTCTGAGCCGCTTATTGA | AATCATCGCGGGATGCACA |
Cox2 | S67722 | GTGAAAACTGTACTACGCCGAG | TACTGTGTTTGGGGTGGGCT |
Xor | NM_017154 | TCCCTGCGTTTGGTAGCATC | CCAGGAAAAGAGGTGGCTCC |
Hprt1 | NM_012583 | TTGGTCAAGCAGTACAGCCC | TGGCCTGTATCCAACACTTCG |
Primary Antibody | Host | Concentrations | Manufacturer |
---|---|---|---|
Anti-LANCL1 | Rabbit | 1:250 | Novus Biologicals, Centennial, CO, USA |
Anti-LANCL2 | Mouse | 1:1000 | Reference [30] |
Anti-XO | Mouse | 1:100 | Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA |
Anti-COX2 | Goat | 1:200 | Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA |
Anti-SOD2 | Rabbit | 1:5000 | Abcam |
Anti-GPX4 | Mouse | 1:100 | Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA |
Anti-ERRα | Mouse | 1:200 | Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA |
Anti-vinculin | Rabbit | 1:1000 | Cell Signaling Technology, Danvers, MA, USA |
Anti-Actin | Mouse | 1:1000 | Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA |
Secondary Antibody | Concentrations | Manufacturer | |
Anti-Mouse | 1:2000 | Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA | |
Anti-Rabbit | 1:1000 | Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA | |
Anti-Goat | 1:1000 | Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Spinelli, S.; Guida, L.; Passalacqua, M.; Magnone, M.; Caushi, B.; Zocchi, E.; Sturla, L. The ABA/LANCL1-2 Hormone/Receptors System Controls ROS Production in Cardiomyocytes through ERRα. Biomedicines 2024, 12, 2071. https://doi.org/10.3390/biomedicines12092071
Spinelli S, Guida L, Passalacqua M, Magnone M, Caushi B, Zocchi E, Sturla L. The ABA/LANCL1-2 Hormone/Receptors System Controls ROS Production in Cardiomyocytes through ERRα. Biomedicines. 2024; 12(9):2071. https://doi.org/10.3390/biomedicines12092071
Chicago/Turabian StyleSpinelli, Sonia, Lucrezia Guida, Mario Passalacqua, Mirko Magnone, Bujar Caushi, Elena Zocchi, and Laura Sturla. 2024. "The ABA/LANCL1-2 Hormone/Receptors System Controls ROS Production in Cardiomyocytes through ERRα" Biomedicines 12, no. 9: 2071. https://doi.org/10.3390/biomedicines12092071
APA StyleSpinelli, S., Guida, L., Passalacqua, M., Magnone, M., Caushi, B., Zocchi, E., & Sturla, L. (2024). The ABA/LANCL1-2 Hormone/Receptors System Controls ROS Production in Cardiomyocytes through ERRα. Biomedicines, 12(9), 2071. https://doi.org/10.3390/biomedicines12092071