Extracellular Vesicles Derived from Human Liver Stem Cells Counteract Chronic Kidney Disease Development and Cardiac Dysfunction in Remnant Kidney Murine Model: The Possible Involvement of Proteases
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation and Characterization of HLSC-EVs
2.2. Protease Array
2.3. Western Blot Analysis
2.4. Partial Nephrectomy 5/6th Murine Model
2.5. Renal Functional and Histological Analysis
2.6. Transmission Electron Microscopy (TEM)
2.7. Molecular Analysis of Renal Tissue
2.8. Cardiac Histological Analyses
2.9. Transthoracic Echocardiography
2.10. Statistical Analyses
3. Results
3.1. Set-Up of the In Vivo Model
3.2. EV Administration Improves Kidney Function and Morphology
3.3. EV Treatment Modulates the Expression of Fibrosis and Inflammation-Related Genes
3.4. EV Treatment Ameliorates Cardiac Function and Morphology
3.5. Protease Content of EVs and Its Implication for Their Anti-Fibrotic Effect In Vivo
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kovesdy, C.P. Epidemiology of chronic kidney disease: An update 2022. Kidney Int. 2022, 12 (Suppl. S12), S7–S11. [Google Scholar] [CrossRef] [PubMed]
- Niculae, A.; Gherghina, M.E.; Peride, I.; Tiglis, M.; Nechita, A.M.; Checherita, I.A. Pathway from Acute Kidney Injury to Chronic Kidney Disease: Molecules Involved in Renal Fibrosis. Int. J. Mol. Sci. 2023, 24, 14019. [Google Scholar] [CrossRef] [PubMed]
- Webster, A.C.; Nagler, E.V.; Morton, R.L.; Masson, P. Chronic Kidney Disease. Lancet 2017, 389, 1238–1252. [Google Scholar] [CrossRef] [PubMed]
- Abecassis, M.; Bartlett, S.T.; Collins, A.J. Kidney transplantation as primary therapy for end-stage renal disease: A National Kidney Foundation/Kidney Disease Outcomes Quality Initiative (NKF/KDOQITM) conference. Clin. J. Am. Soc. Nephrol. 2008, 3, 471–480. [Google Scholar] [CrossRef] [PubMed]
- Picinich, S.C.; Mishra, P.J.; Mishra, P.J.; Glod, J.; Banerjee, D. The therapeutic potential of mesenchymal stem cells. Cell- & tissue-based therapy. Expert Opin. Biol. Ther. 2007, 7, 965–973. [Google Scholar] [PubMed]
- Trohatou, O.; Roubelakis, M.G. Mesenchymal Stem/Stromal Cells in Regenerative Medicine: Past, Present, and Future. Cell. Reprogramming 2017, 19, 217–224. [Google Scholar] [CrossRef]
- Lu, Y.; Wang, L.; Zhang, M.; Chen, Z. Mesenchymal Stem Cell-Derived Small Extracellular Vesicles: A Novel Approach for Kidney Disease Treatment. Int. J. Nanomed. 2022, 17, 3603–3618. [Google Scholar] [CrossRef]
- Song, N.; Scholtemeijer, M.; Shah, K. Mesenchymal Stem Cell Immunomodulation: Mechanisms and Therapeutic Potential. Trends Pharmacol. Sci. 2020, 41, 653–664. [Google Scholar] [CrossRef]
- Merimi, M.; El-Majzoub, R.; Lagneaux, L.; Moussa Agha, D.; Bouhtit, F.; Meuleman, N.; Fahmi, H.; Lewalle, P.; Fayyad-Kazan, M.; Najar, M. The Therapeutic Potential of Mesenchymal Stromal Cells for Regenerative Medicine: Current Knowledge and Future Understandings. Front. Cell Dev. Biol. 2021, 9, 661532. [Google Scholar] [CrossRef]
- Herrmann, I.K.; Wood, M.J.A.; Fuhrmann, G. Extracellular vesicles as a next-generation drug delivery platform. Nat. Nanotechnol. 2021, 16, 748–759. [Google Scholar] [CrossRef]
- Birtwistle, L.; Chen, X.-M.; Pollock, C. Mesenchymal Stem Cell-Derived Extracellular Vesicles to the Rescue of Renal Injury. Int. J. Mol. Sci. 2021, 22, 6596. [Google Scholar] [CrossRef] [PubMed]
- Bruno, S.; Grange, C.; Deregibus, M.C.; Calogero, R.A.; Saviozzi, S.; Collino, F.; Morando, L.; Busca, A.; Falda, M.; Bussolati, B.; et al. Mesenchymal stem cell-derived microvesicles protect against acute tubular injury. J. Am. Soc. Nephrol. 2009, 20, 1053–1067. [Google Scholar] [CrossRef] [PubMed]
- Herrera Sanchez, M.B.; Bruno, S.; Grange, C.; Tapparo, M.; Cantaluppi, V.; Tetta, C.; Camussi, G. Human liver stem cells and derived extracellular vesicles improve recovery in a murine model of acute kidney injury. Stem Cell Res. Ther. 2014, 5, 124. [Google Scholar] [CrossRef] [PubMed]
- Monsel, A.; Zhu, Y.; Gennai, S.; Hao, Q.; Hu, S.; Rouby, J.J.; Rosenzwajg, M.; Matthay, M.A.; Lee, J. Therapeutic Effects of Human Mesenchymal Stem Cell-derived Microvesicles in Severe Pneumonia in Mice. Am. J. Respir. Crit. Care Med. 2015, 192, 324–336. [Google Scholar] [CrossRef] [PubMed]
- Herrera, M.B.; Bruno, S.; Buttiglieri, S.; Tetta, C.; Gatti, S.; Deregibus, M.C.; Bussolati, B.; Camussi, G. Isolation and characterization of a stem cell population from adult human liver. Stem Cells 2006, 24, 2840–2850. [Google Scholar] [CrossRef] [PubMed]
- Kholia, S.; Herrera Sanchez, M.B.; Cedrino, M.; Papadimitriou, E.; Tapparo, M.; Deregibus, M.C.; Brizzi, M.F.; Tetta, C.; Camussi, G. Human Liver Stem Cell-Derived Extracellular Vesicles Prevent Aristolochic Acid-Induced Kidney Fibrosis. Front. Immunol. 2018, 9, 1639. [Google Scholar] [CrossRef] [PubMed]
- Grange, C.; Tritta, S.; Tapparo, M.; Cedrino, M.; Tetta, C.; Camussi, G.; Brizzi, M.F. Stem cell-derived extracellular vesicles inhibit and revert fibrosis progression in a mouse model of diabetic nephropathy. Sci. Rep. 2019, 9, 4468. [Google Scholar] [CrossRef] [PubMed]
- Bruno, S.; Chiabotto, G.; Cedrino, M.; Ceccotti, E.; Pasquino, C.; De Rosa, S.; Grange, C.; Tritta, S.; Camussi, G. Extracellular Vesicles Derived from Human Liver Stem Cells Attenuate Chronic Kidney Disease Development in an In Vivo Experimental Model of Renal Ischemia and Reperfusion Injury. Int. J. Mol. Sci. 2022, 23, 1485. [Google Scholar] [CrossRef] [PubMed]
- Tan, R.-Z.; Zhong, X.; Li, J.-C.; Zhang, Y.W.; Yan, Y.; Liao, Y.; Wen, D.; Diao, H.; Wang, L.; Shen, H.C. An optimized 5/6 nephrectomy mouse model based on unilateral kidney ligation and its application in renal fibrosis research. Ren. Fail. 2019, 41, 555–566. [Google Scholar] [CrossRef]
- Hills, C.E.; Squires, P.E. The role of TGF-β and epithelial-to mesenchymal transition in diabetic nephropathy. Cytokine Growth Factor Rev. 2011, 22, 131–139. [Google Scholar] [CrossRef]
- Shimoda, M.; Khokha, R. Metalloproteinases in extracellular vesicles. Biochim. Biophys. Acta Mol. Cell Res. 2017, 1864, 1989–2000. [Google Scholar] [CrossRef] [PubMed]
- Bruno, S.; Herrera Sanchez, M.B.; Pasquino, C.; Tapparo, M.; Cedrino, M.; Tetta, C.; Camussi, G. Human Liver-Derived Stem Cells Improve Fibrosis and Inflammation Associated with Nonalcoholic Steatohepatitis. Stem Cells Int. 2019, 2019, 6351091. [Google Scholar] [CrossRef] [PubMed]
- Spada, M.; Porta, F.; Righi, D.; Gazzera, C.; Tandoi, F.; Ferrero, I.; Fagioli, F.; Sanchez, M.B.H.; Calvo, P.L.; Biamino, E.; et al. Intrahepatic Administration of Human Liver Stem Cells in Infants with Inherited Neonatal-Onset Hyperammonemia: A Phase I Study. Stem Cell Rev. Rep. 2020, 16, 186–197. [Google Scholar] [CrossRef] [PubMed]
- Chiabotto, G.; Ceccotti, E.; Tapparo, M.; Camussi, G.; Bruno, S. Human Liver Stem Cell-Derived Extracellular Vesicles Target Hepatic Stellate Cells and Attenuate Their Pro-fibrotic Phenotype. Front. Cell Dev. Biol. 2021, 9, 777462. [Google Scholar] [CrossRef] [PubMed]
- Bruno, S.; Pasquino, C.; Herrera Sanchez, M.B.; Tapparo, M.; Figliolini, F.; Grange, C.; Chiabotto, G.; Cedrino, M.; Deregibus, M.C.; Tetta, C.; et al. HLSC-Derived Extracellular Vesicles Attenuate Liver Fibrosis and Inflammation in a Murine Model of Non-alcoholic Steatohepatitis. Mol. Ther. 2020, 28, 479–489. [Google Scholar] [CrossRef] [PubMed]
- Koliha, N.; Wiencek, Y.; Heider, U.; Jüngst, C.; Kladt, N.; Krauthäuser, S.; Johnston, I.C.; Bosio, A.; Schauss, A.; Wild, S. A novel multiplex bead-based platform highlights the diversity of extracellular vesicles. J. Extracell. Vesicles 2016, 5, 29975. [Google Scholar] [CrossRef]
- Wiklander, O.P.B.; Bostancioglu, R.B.; Welsh, J.A.; Zickler, A.M.; Murke, F.; Corso, G.; Felldin, U.; Hagey, D.W.; Evertsson, B.; Liang, X.M.; et al. Systematic Methodological Evaluation of a Multiplex Bead-Based Flow Cytometry Assay for Detection of Extracellular Vesicle Surface Signatures. Front. Immunol. 2018, 9, 1326. [Google Scholar] [CrossRef] [PubMed]
- Kowal, J.; Arras, G.; Colombo, M.; Jouve, M.; Morath, J.P.; Primdal-Bengtson, B.; Dingli, F.; Loew, D.; Tkach, M.; Théry, C. Proteomic comparison defines novel markers to characterize heterogeneous populations of extracellular vesicle subtypes. Proc. Natl. Acad. Sci. USA 2016, 113, E968–E977. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Chaudhry, M.A.; Nie, Y.; Xie, Z.; Shapiro, J.I.; Liu, J. A Mouse 5/6th Nephrectomy Model That Induces Experimental Uremic Cardiomyopathy. J. Vis. Exp. JoVE 2017, 129, 55825. [Google Scholar]
- Jokinen, M.P.; Lieuallen, W.G.; Johnson, C.L.; Dunnick, J.; Nyska, A. Characterization of spontaneous and chemically induced cardiac lesions in rodent model systems: The national toxicology program experience. Cardiovasc. Toxicol. 2005, 5, 227–244. [Google Scholar] [CrossRef]
- Jokinen, M.P.; Lieuallen, W.G.; Boyle, M.C.; Johnson, C.L.; Malarkey, D.E.; Nyska, A. Morphologic aspects of rodent cardiotoxicity in a retrospective evaluation of National Toxicology Program studies. Toxicol. Pathol. 2011, 39, 850–860. [Google Scholar] [CrossRef] [PubMed]
- Ishibashi-Ueda, H.; Matsuyama, T.-A.; Ohta-Ogo, K.; Ikeda, Y. Significance and Value of Endomyocardial Biopsy Based on Our Own Experience. Circ. J. 2017, 81, 417–426. [Google Scholar] [CrossRef] [PubMed]
- Gürtl, B.; Kratky, D.; Guelly, C.; Zhang, L.; Gorkiewicz, G.; Das, S.K.; Tamilarasan, K.P.; Hoefler, G. Apoptosis and fibrosis are early features of heart failure in an animal model of metabolic cardiomyopathy. Int. J. Exp. Pathol. 2009, 90, 338–346. [Google Scholar] [CrossRef] [PubMed]
- Gay-Jordi, G.; Guash, E.; Benito, B.; Brugada, J.; Nattel, S.; Mont, L.; Serrano-Mollar, A. Losartan prevents heart fibrosis induced by long-term intensive exercise in an animal model. PLoS ONE 2013, 8, e55427. [Google Scholar]
- He, J.; Wang, Y.; Sun, S.; Yu, M.; Wang, C.; Pei, X.; Zhu, B.; Wu, J.; Zhao, W. Bone marrow stem cells-derived microvesicles protect against renal injury in the mouse remnant kidney model. Nephrology 2012, 17, 493–500. [Google Scholar] [CrossRef] [PubMed]
- Wan, F.; Yang, R.-C.; Tang, Y.-W.; Tang, X.L.; Ye, T.; Zheng, J.; Zhang, H.Q.; Lin, Y. BMSC-derived exosomes protect against kidney injury through regulating klotho in 5/6 nephrectomy rats. Eur. J. Med. Res. 2022, 27, 118. [Google Scholar] [CrossRef] [PubMed]
- Lindoso, R.S.; Lopes, J.A.; Binato, R.; Abdelhay, E.; Takiya, C.M.; Miranda, K.R.; Lara, L.S.; Viola, A.; Bussolati, B.; Vieyra, A.; et al. Adipose Mesenchymal Cells-Derived EVs Alleviate DOCA-Salt-Induced Hypertension by Promoting Cardio-Renal Protection. Mol. Ther. Methods Clin. Dev. 2020, 16, 63–77. [Google Scholar] [CrossRef]
- Bhatt, K.; Lanting, L.L.; Jia, Y.; Yadav, S.; Reddy, M.A.; Magilnick, N.; Boldin, M.; Natarajan, R. Anti-Inflammatory Role of MicroRNA-146a in the Pathogenesis of Diabetic Nephropathy. J. Am. Soc. Nephrol. 2016, 27, 2277–2288. [Google Scholar] [CrossRef]
- Liao, Z.; Zheng, R.; Shao, G. Mechanisms and application strategies of miRNA-146a regulating inflammation and fibrosis at molecular and cellular levels. Int. J. Mol. Med. 2023, 51, 7. [Google Scholar] [CrossRef]
- Lai, R.C.; Tan, S.S.; The, B.J.; Sze, S.K.; Arslan, F.; de Kleijn, D.P.; Choo, A.; Lim, S.K. Proteolytic Potential of the MSC Exosome Proteome: Implications for an Exosome-Mediated Delivery of Therapeutic Proteasome. Int. J. Proteom. 2012, 2012, 971907. [Google Scholar] [CrossRef]
- Geervliet, E.; Moreno, S.; Baiamonte, L.; Booijink, R.; Boye, S.; Wang, P.; Voit, B.; Lederer, A.; Appelhans, D.; Bansal, R. Matrix metalloproteinase-1 decorated polymersomes, a surface-active extracellular matrix therapeutic, potentiates collagen degradation and attenuates early liver fibrosis. J. Control. Release 2021, 332, 594–607. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
GAPDH | TGTCAAGCTCATTTCCTGGTA | TCTTACTCCTTGGAGGCCATGT |
Alpha-SMA | CATCTCCGAAGTCCAGCACA | GACGCACCACTGAACCCTAA |
COL1A1 | ACCTTGTTTGCCAGGTTCAC | ATCTCCCTGGTGCTGATGGAC |
IL-6 | ACCAGAGGAAATTTTCAATAGGC | TGATGCACTTGCAGAAAACA |
TGF-beta | GCAACAATTCCTGGCGTTACC | CGAAAGCCCTGTATTCCGTCT |
TNF-alpha | CATCTTCTCAAAATTCGAGTGACAA | TGGGAGTAGACAAGGTACAACCC |
Group | Fibrosis | ||||
---|---|---|---|---|---|
Type | Number of Cases with Increased Fibrosis | Overall Grade | Location | Distribution | |
SHAM | Absent | 0/8 | None | ||
PNx week 4 | Interstitial | 3/3 | Mild | Sub-endocardium | Focal |
PNx week 8 | Interstitial | 5/5 | Mild | Sub-endocardium | Multifocal |
PNx + vehicle | Interstitial | 6/7 | Mild | Sub-endocardium | Focal |
PNx + EVs Dose 1 | Interstitial | 1/10 | Mild | Sub-endocardium | Focal |
PNx + EVs Dose 2 | Interstitial | 1/6 | Mild | Sub-endocardium | Focal |
PNx + EVs Dose 3 | Interstitial | 1/6 | Moderate | Sub-endocardium | Focal |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ceccotti, E.; Chiabotto, G.; Cedrino, M.; Gambella, A.; Delsedime, L.; Ghigo, A.; Salio, C.; Grange, C.; Herrera Sanchez, M.B.; Femminò, S.; et al. Extracellular Vesicles Derived from Human Liver Stem Cells Counteract Chronic Kidney Disease Development and Cardiac Dysfunction in Remnant Kidney Murine Model: The Possible Involvement of Proteases. Biomedicines 2024, 12, 1517. https://doi.org/10.3390/biomedicines12071517
Ceccotti E, Chiabotto G, Cedrino M, Gambella A, Delsedime L, Ghigo A, Salio C, Grange C, Herrera Sanchez MB, Femminò S, et al. Extracellular Vesicles Derived from Human Liver Stem Cells Counteract Chronic Kidney Disease Development and Cardiac Dysfunction in Remnant Kidney Murine Model: The Possible Involvement of Proteases. Biomedicines. 2024; 12(7):1517. https://doi.org/10.3390/biomedicines12071517
Chicago/Turabian StyleCeccotti, Elena, Giulia Chiabotto, Massimo Cedrino, Alessandro Gambella, Luisa Delsedime, Alessandra Ghigo, Chiara Salio, Cristina Grange, Maria Beatriz Herrera Sanchez, Saveria Femminò, and et al. 2024. "Extracellular Vesicles Derived from Human Liver Stem Cells Counteract Chronic Kidney Disease Development and Cardiac Dysfunction in Remnant Kidney Murine Model: The Possible Involvement of Proteases" Biomedicines 12, no. 7: 1517. https://doi.org/10.3390/biomedicines12071517
APA StyleCeccotti, E., Chiabotto, G., Cedrino, M., Gambella, A., Delsedime, L., Ghigo, A., Salio, C., Grange, C., Herrera Sanchez, M. B., Femminò, S., Sassoè-Pognetto, M., Brizzi, M. F., Camussi, G., & Bruno, S. (2024). Extracellular Vesicles Derived from Human Liver Stem Cells Counteract Chronic Kidney Disease Development and Cardiac Dysfunction in Remnant Kidney Murine Model: The Possible Involvement of Proteases. Biomedicines, 12(7), 1517. https://doi.org/10.3390/biomedicines12071517