Characterizing the Dynamic Expression of C1q/TNF-α-Related Protein 6 (CTRP6) during Pregnancy in Humans and Mice with Gestational Diabetes Mellitus
Abstract
1. Introduction
2. Materials and Methods
2.1. Patients and Samples
2.2. Animals
2.3. Glucose Tolerance Test for Pregnant Mice
2.4. Measurements of Plasma Lipid
2.5. Measurements of CTRP6, Adiponectin and Insulin Levels in Plasma
2.6. RNA Extraction, cDNA Synthesis, and Quantitative PCR
2.7. Western Blotting Analysis
2.8. Statistical Analysis
3. Results
3.1. Clinical Characteristics of the Research Cohort
3.2. Expression Profile of CTRP6 in Plasma, Placenta and Adipose Tissue
3.3. Correlations between Circulating Levels of CTRP6 and Clinical Features
3.4. Changes of CTRP6 Expression in GDM Mice
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sweeting, A.; Wong, J.; Murphy, H.R.; Ross, G.P. A Clinical Update on Gestational Diabetes Mellitus. Endocr. Rev. 2022, 43, 763–793. [Google Scholar] [CrossRef]
- McIntyre, H.D.; Catalano, P.; Zhang, C.; Desoye, G.; Mathiesen, E.R.; Damm, P. Gestational diabetes mellitus. Nat. Rev. Dis. Primers 2019, 5, 47. [Google Scholar] [CrossRef]
- Ye, W.; Luo, C.; Huang, J.; Li, C.; Liu, Z.; Liu, F. Gestational diabetes mellitus and adverse pregnancy outcomes: Systematic review and meta-analysis. Bmj 2022, 377, e067946. [Google Scholar] [CrossRef] [PubMed]
- Moon, J.H.; Jang, H.C. Gestational Diabetes Mellitus: Diagnostic Approaches and Maternal-Offspring Complications. Diabetes Metab. J. 2022, 46, 3–14. [Google Scholar] [CrossRef]
- Rojas-Rodriguez, R.; Ziegler, R.; DeSouza, T.; Majid, S.; Madore, A.S.; Amir, N.; Pace, V.A.; Nachreiner, D.; Alfego, D.; Mathew, J.; et al. PAPPA-mediated adipose tissue remodeling mitigates insulin resistance and protects against gestational diabetes in mice and humans. Sci. Transl. Med. 2020, 12, eaay4145. [Google Scholar] [CrossRef]
- Šimják, P.; Cinkajzlová, A.; Anderlová, K.; Pařízek, A.; Mráz, M.; Kršek, M.; Haluzík, M. The role of obesity and adipose tissue dysfunction in gestational diabetes mellitus. J. Endocrinol. 2018, 238, R63–R77. [Google Scholar] [CrossRef]
- Jayabalan, N.; Nair, S.; Nuzhat, Z.; Rice, G.E.; Zuñiga, F.A.; Sobrevia, L.; Leiva, A.; Sanhueza, C.; Gutiérrez, J.A.; Lappas, M.; et al. Cross Talk between Adipose Tissue and Placenta in Obese and Gestational Diabetes Mellitus Pregnancies via Exosomes. Front. Endocrinol. 2017, 8, 239. [Google Scholar] [CrossRef]
- Nguyen-Ngo, C.; Jayabalan, N.; Haghvirdizadeh, P.; Salomon, C.; Lappas, M. Role of adipose tissue in regulating fetal growth in gestational diabetes mellitus. Placenta 2020, 102, 39–48. [Google Scholar] [CrossRef]
- Mallardo, M.; Ferraro, S.; Daniele, A.; Nigro, E. GDM-complicated pregnancies: Focus on adipokines. Mol. Biol. Rep. 2021, 48, 8171–8180. [Google Scholar] [CrossRef] [PubMed]
- Valencia-Ortega, J.; González-Reynoso, R.; Ramos-Martínez, E.G.; Ferreira-Hermosillo, A.; Peña-Cano, M.I.; Morales-Ávila, E.; Saucedo, R. New Insights into Adipokines in Gestational Diabetes Mellitus. Int. J. Mol. Sci. 2022, 23, 6279. [Google Scholar] [CrossRef]
- Pérez-Pérez, A.; Toro, A.; Vilariño-García, T.; Maymó, J.; Guadix, P.; Dueñas, J.L.; Fernández-Sánchez, M.; Varone, C.; Sánchez-Margalet, V. Leptin action in normal and pathological pregnancies. J. Cell. Mol. Med. 2018, 22, 716–727. [Google Scholar] [CrossRef] [PubMed]
- Ye, Y.; Wu, P.; Wang, Y.; Yang, X.; Ye, Y.; Yuan, J.; Liu, Y.; Song, X.; Yan, S.; Wen, Y.; et al. Adiponectin, leptin, and leptin/adiponectin ratio with risk of gestational diabetes mellitus: A prospective nested case-control study among Chinese women. Diabetes Res. Clin. Pract. 2022, 191, 110039. [Google Scholar] [CrossRef] [PubMed]
- Wong, G.W.; Krawczyk, S.A.; Kitidis-Mitrokostas, C.; Revett, T.; Gimeno, R.; Lodish, H.F. Molecular, biochemical and functional characterizations of C1q/TNF family members: Adipose-tissue-selective expression patterns, regulation by PPAR-gamma agonist, cysteine-mediated oligomerizations, combinatorial associations and metabolic functions. Biochem. J. 2008, 416, 161–177. [Google Scholar] [CrossRef]
- Sadeghi, A.; Fadaei, R.; Moradi, N.; Fouani, F.Z.; Roozbehkia, M.; Zandieh, Z.; Ansaripour, S.; Vatannejad, A.; Doustimotlagh, A.H. Circulating levels of C1q/TNF-α-related protein 6 (CTRP6) in polycystic ovary syndrome. IUBMB Life 2020, 72, 1449–1459. [Google Scholar] [CrossRef]
- Murayama, M.A.; Kakuta, S.; Inoue, A.; Umeda, N.; Yonezawa, T.; Maruhashi, T.; Tateishi, K.; Ishigame, H.; Yabe, R.; Ikeda, S.; et al. CTRP6 is an endogenous complement regulator that can effectively treat induced arthritis. Nat. Commun. 2015, 6, 8483. [Google Scholar] [CrossRef]
- Wang, S.; Sun, Z.; Yang, S.; Chen, B.; Shi, J. CTRP6 inhibits cell proliferation and ECM expression in rat mesangial cells cultured under TGF-β1. Biomed. Pharmacother. 2018, 97, 280–285. [Google Scholar] [CrossRef]
- Kurokawa, M.; Takeshita, A.; Hashimoto, S.; Koyama, M.; Morimoto, Y.; Tachibana, D. Prevention of intrauterine fetal growth restriction by administrating C1q/TNF-related protein 6, a specific inhibitor of the alternative complement pathway. J. Assist. Reprod. Genet. 2022, 39, 2191–2199. [Google Scholar] [CrossRef]
- Yan, S.; Ding, J.; Wang, Z.; Zhang, F.; Li, J.; Zhang, Y.; Wu, S.; Yang, L.; Pang, X.; Zhang, Y.; et al. CTRP6 regulates M1 macrophage polarization via the PPAR-γ/NF-κB pathway and reprogramming glycolysis in recurrent spontaneous abortion. Int. Immunopharmacol. 2023, 124 (Pt A), 110840. [Google Scholar] [CrossRef]
- Wang, M.; Tang, X.; Li, L.; Liu, D.; Liu, H.; Zheng, H.; Deng, W.; Zhao, X.; Yang, G. C1q/TNF-related protein-6 is associated with insulin resistance and the development of diabetes in Chinese population. Acta Diabetol. 2018, 55, 1221–1229. [Google Scholar] [CrossRef]
- Lei, X.; Seldin, M.M.; Little, H.C.; Choy, N.; Klonisch, T.; Wong, G.W. C1q/TNF-related protein 6 (CTRP6) links obesity to adipose tissue inflammation and insulin resistance. J. Biol. Chem. 2017, 292, 14836–14850. [Google Scholar] [CrossRef]
- Wu, W.; Zhang, J.; Zhao, C.; Sun, Y.; Yin, Y.; Peng, Y.; Pang, W.; Yang, G. Lentivirus-mediated CTRP6 silencing ameliorates diet-induced obesity in mice. Exp. Cell Res. 2018, 367, 15–23. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Bai, W.P. C1q/tumor necrosis factor related protein 6 (CTRP6) regulates the phenotypes of high glucose-induced gestational trophoblast cells via peroxisome proliferator-activated receptor gamma (PPARγ) signaling. Bioengineered 2022, 13, 206–216. [Google Scholar] [CrossRef] [PubMed]
- Yang, Z.; Jiang, J.; Huang, J.; Zhao, Y.; Luo, X.; Song, L. Effect of high-fat diet and exercise on asprosin and CTRP6 expression in subcutaneous and retroperitoneal adipose tissues in rats during mid-gestation. Nan Fang. Yi Ke Da Xue Xue Bao 2020, 40, 1406–1414. [Google Scholar]
- Yang, Z.; Jiang, J.; Chen, M.; Huang, J.; Liu, J.; Wei, X.; Jia, R.; Song, L.; Sun, B.; Luo, X.; et al. Sex-Specific Effects of Maternal and Post-Weaning High-Fat Diet on Adipose Tissue Remodeling and Asprosin Expression in Mice Offspring. Mol. Nutr. Food Res. 2022, 66, e2100470. [Google Scholar] [CrossRef]
- Liang, S.; Han, J.; Cheng, W.; Chen, X. C1q/tumor necrosis factor-related protein-6 exerts protective effects on myocardial ischemia-reperfusion injury through the modulation of the Akt-GSK-3β-Nrf2 signaling cascade. Int. Immunopharmacol. 2023, 115, 109678. [Google Scholar] [CrossRef]
- Lei, H.; Wu, D.; Wang, J.Y.; Li, L.; Zhang, C.L.; Feng, H.; Fu, F.Y.; Wu, L.L. C1q/tumor necrosis factor-related protein-6 attenuates post-infarct cardiac fibrosis by targeting RhoA/MRTF-A pathway and inhibiting myofibroblast differentiation. Basic. Res. Cardiol. 2015, 110, 35. [Google Scholar] [CrossRef]
- Liao, X.; Liu, S.; Tang, X.; Yang, D.; Liu, H.; Gao, L.; Yang, G. Circulating CTRP6 Levels are Increased in Overweight or Obese Chinese Individuals and Associated with Insulin Resistance Parameters: A Pilot Study. Exp. Clin. Endocrinol. Diabetes 2021, 129, 535–541. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.P.; Ye, S.Z.; Li, Y.X.; Chen, J.L.; Zhang, Y.S. Research Advances in the Roles of Circular RNAs in Pathophysiology and Early Diagnosis of Gestational Diabetes Mellitus. Front. Cell Dev. Biol. 2021, 9, 739511. [Google Scholar] [CrossRef]
- Musa, E.; Matjila, M.; Levitt, N.S. Kisspeptins and Glucose Homeostasis in Pregnancy: Implications for Gestational Diabetes Mellitus-a Review Article. Reprod. Sci. 2022, 29, 321–327. [Google Scholar] [CrossRef]
- Plows, J.F.; Stanley, J.L.; Baker, P.N.; Reynolds, C.M.; Vickers, M.H. The Pathophysiology of Gestational Diabetes Mellitus. Int. J. Mol. Sci. 2018, 19, 3342. [Google Scholar] [CrossRef]
- Trivett, C.; Lees, Z.J.; Freeman, D.J. Adipose tissue function in healthy pregnancy, gestational diabetes mellitus and pre-eclampsia. Eur. J. Clin. Nutr. 2021, 75, 1745–1756. [Google Scholar] [CrossRef]
- Wu, W.J.; Mo, D.L.; Zhao, C.Z.; Zhao, C.; Chen, Y.S.; Pang, W.J.; Yang, G.S. Knockdown of CTRP6 inhibits adipogenesis via lipogenic marker genes and Erk1/2 signalling pathway. Cell Biol. Int. 2015, 39, 554–562. [Google Scholar] [CrossRef]
- Wu, W.; Zhang, J.; Zhao, C.; Sun, Y.; Pang, W.; Yang, G. CTRP6 Regulates Porcine Adipocyte Proliferation and Differentiation by the AdipoR1/MAPK Signaling Pathway. J. Agric. Food Chem. 2017, 65, 5512–5522. [Google Scholar] [CrossRef] [PubMed]
- Jacobsson, A.; Mühleisen, M.; Cannon, B.; Nedergaard, J. The uncoupling protein thermogenin during acclimation: Indications for pretranslational control. Am. J. Physiol. 1994, 267 Pt 2, R999–R1007. [Google Scholar] [CrossRef]





| Gene | Species | Accession Number | Primer Sequences (from 5′ to 3′) | Production Size |
|---|---|---|---|---|
| Ctrp6 | Mus musculus | NM_028331 | Forward primer: CCTTATGTCCTGCCTGAAGTCAG | 144 |
| Reverse primer: ACCTTTGACACCCTGAGAGCCA | ||||
| Gapdh | Mus musculus | NM_008084 | Forward primer: ACTGAGGACCAGGTTGTC | 136 |
| Reverse primer: TGCTGTAGCCGTATTCATTG | ||||
| Cyclophilin | Mus musculus | NM_008907 | Forward primer: CATACAGGTCCTGGCATCTTGTC | 112 |
| Reverse primer: AGACCACATGCTTGCCATCCAG | ||||
| CTRP6 | Homo sapiens | NM_031910 | Forward primer: CTGCCTGAGATCAGACCCTACA | 140 |
| Reverse primer: TTGTCACCCTTGCTGCCCTGAG | ||||
| GAPDH | Homo sapiens | NM_002046 | Forward primer: GTCTCCTCTGACTTCAACAGCG | 131 |
| Reverse primer: ACCACCCTGTTGCTGTAGCCAA | ||||
| Cyclophilin | Homo sapiens | NM_021130 | Forward primer: GGCAAATGCTGGACCCAACACA | 161 |
| Reverse primer: TGCTGGTCTTGCCATTCCTGGA |
| Characteristic | Second Trimester | Third Trimester | Delivery | |||
|---|---|---|---|---|---|---|
| NGT | GDM | NGT | GDM | NGT | GDM | |
| Maternal Parameters | ||||||
| Age (year) | 31.50 ± 3.66 | 31.56 ± 3.97 | 31.70 ± 1.16 | 32.86 ± 4.95 | 29.89 ± 3.98 | 30.67 ± 3.84 |
| BMI (kg/m2) | 21.56 ± 2.75 | 24.95 ± 3.24 * | 23.94 ± 2.23 | 25.29 ± 2.81 | 27.86 ± 3.03 | 29.75 ± 3.56 |
| HGB (g/L) | 117.10 ± 9.30 | 122.56 + 9.76 | 120.00 ± 14.13 | 121.22 ± 13.18 | 115.20 ± 9.48 | 115.22 ± 19.31 |
| WBC (109/L) | 8.36 ± 1.84 | 10.34 ± 2.53 | 10.57 ± 3.37 | 8.92 ± 2.56 | 9.28 ± 2.20 | 12.33 ± 6.05 |
| Systolic pressure (mmHg) | 102.70 ± 7.89 | 113.11 ± 9.49 * | 107.40 ± 8.00 | 113.00 ± 9.37 | 115.70 ± 13.87 | 122.44 ± 12.28 |
| Diastolic pressure (mmHg) | 69.90 ± 5.93 | 72.56 ± 4.98 | 69.50 ± 6.85 | 75.89 ± 3.10 | 81.20 ± 10.56 | 79.44 ± 8.59 |
| OGTT 0 h (mmol/L) | 4.23 ± 0.37 | 5.03 ± 0.52 * | 4.06 ± 0.34 | 5.09 ± 0.91 * | 4.16 ± 0.37 | 4.74 ± 0.68 * |
| OGTT 1 h (mmol/L) | 6.31 ± 1.24 | 10.31 ± 0.76 * | 6.59 ± 0.88 | 10.99 ± 1.21 * | 6.72 ± 0.83 | 10.61 ± 1.59 * |
| OGTT 2 h (mmol/L) | 5.69 ± 0.84 | 8.02 ± 1.67 * | 5.69 ± 0.82 | 8.49 ± 1.29 * | 5.79 ± 0.63 | 8.46 ± 1.22 * |
| Neonatal parameters | ||||||
| Birth height (cm) | 50.00 ± 0.58 | 48.40 ± 3.13 | ||||
| Birth weight (g) | / | / | / | / | 3338.00 ± 412.40 | 3557.56 ± 488.73 |
| Blood glucose (mmol/L) | / | / | / | / | 3.48 ± 0.61 | 3.50 ± 0.67 |
| Placenta (g) | / | / | / | / | 511.00 ± 35.42 | 575.56 ± 46.40 * |
| Correlation | Second Trimester | Third Trimester | Delivery | |||
|---|---|---|---|---|---|---|
| r | p | r | p | r | p | |
| Maternal indices | ||||||
| Age | −0.27 | 0.27 | −0.06 | 0.82 | 0.42 | 0.08 |
| BMI | −0.08 | 0.76 | −0.24 | 0.32 | −0.20 | 0.42 |
| HGB | −0.08 | 0.75 | 0.02 | 0.41 | 0.11 | 0.66 |
| WBC | −0.11 | 0.66 | 0.48 | 0.04 * | 0.19 | 0.44 |
| Systolic pressure | −0.50 | 0.03 * | −0.32 | 0.18 | −0.20 | 0.41 |
| Diastolic pressure | −0.01 | 0.96 | −0.41 | 0.08 | −0.19 | 0.44 |
| OGTT 0 h | −0.34 | 0.16 | −0.52 | 0.02 * | 0.17 | 0.50 |
| OGTT 1 h | −0.25 | 0.29 | −0.58 | 0.01 * | 0.35 | 0.14 |
| OGTT 2 h | −0.27 | 0.26 | −0.40 | 0.09 | 0.26 | 0.29 |
| CHO | −0.10 | 0.70 | −0.23 | 0.34 | −0.16 | 0.53 |
| Neonatal parameters | ||||||
| Birth height (cm) | −0.40 | 0.23 | ||||
| Birth weight (g) | / | / | / | / | 0.42 | 0.41 |
| Blood glucose (mmol/L) | / | / | / | / | −0.30 | 0.21 |
| Placenta (g) | / | / | / | / | 0.42 | 0.08 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiang, J.; Wei, S.; Chen, M.; Tan, Y.; Yang, Z.; Yang, G.; Feng, W.; Han, Z.; Wei, X.; Luo, X. Characterizing the Dynamic Expression of C1q/TNF-α-Related Protein 6 (CTRP6) during Pregnancy in Humans and Mice with Gestational Diabetes Mellitus. Biomedicines 2024, 12, 1128. https://doi.org/10.3390/biomedicines12051128
Jiang J, Wei S, Chen M, Tan Y, Yang Z, Yang G, Feng W, Han Z, Wei X, Luo X. Characterizing the Dynamic Expression of C1q/TNF-α-Related Protein 6 (CTRP6) during Pregnancy in Humans and Mice with Gestational Diabetes Mellitus. Biomedicines. 2024; 12(5):1128. https://doi.org/10.3390/biomedicines12051128
Chicago/Turabian StyleJiang, Jianan, Shuangyu Wei, Miao Chen, Yutian Tan, Zhao Yang, Guiying Yang, Weijie Feng, Zhen Han, Xiaojing Wei, and Xiao Luo. 2024. "Characterizing the Dynamic Expression of C1q/TNF-α-Related Protein 6 (CTRP6) during Pregnancy in Humans and Mice with Gestational Diabetes Mellitus" Biomedicines 12, no. 5: 1128. https://doi.org/10.3390/biomedicines12051128
APA StyleJiang, J., Wei, S., Chen, M., Tan, Y., Yang, Z., Yang, G., Feng, W., Han, Z., Wei, X., & Luo, X. (2024). Characterizing the Dynamic Expression of C1q/TNF-α-Related Protein 6 (CTRP6) during Pregnancy in Humans and Mice with Gestational Diabetes Mellitus. Biomedicines, 12(5), 1128. https://doi.org/10.3390/biomedicines12051128

