Next Article in Journal
Real-World Experience in the Clinical Use of Pirfenidone in Patients with Idiopathic Pulmonary Fibrosis in Taiwan: A Post-Marketing Surveillance Study
Previous Article in Journal
The Role of Immune Cells and Signaling Pathways in Diabetic Eye Disease: A Comprehensive Review
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomedicines
Volume 12
Issue 10
10.3390/biomedicines12102347
biomedicines-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Intestinal Region-Dependent Impact of NFκB-Nrf Crosstalk in Myenteric Neurons and Adjacent Muscle Cells in Type 1 Diabetic Rats

by
Bence Pál Barta
1,
Benita Onhausz
1,
Abigél Egyed-Kolumbán
1,
Afnan AL Doghmi
1,
János Balázs
1,
Zita Szalai
1,
Ágnes Ferencz
2,
Edit Hermesz
2,
Mária Bagyánszki
1 and
Nikolett Bódi
1,*
1
Department of Physiology, Anatomy and Neuroscience, Faculty of Science and Informatics, University of Szeged, 6726 Szeged, Hungary
2
Department of Biochemistry and Molecular Biology, Faculty of Science and Informatics, University of Szeged, 6726 Szeged, Hungary
*
Author to whom correspondence should be addressed.
Biomedicines 2024, 12(10), 2347; https://doi.org/10.3390/biomedicines12102347
Submission received: 30 August 2024 / Revised: 9 October 2024 / Accepted: 12 October 2024 / Published: 15 October 2024
(This article belongs to the Special Issue Inflammation and Peripheral Nervous System)
Browse Figures
Versions Notes

Abstract

:
Background/Objectives: Type 1 diabetes affects cytokines as potential inducers of NFκB signalling involved in inflammation and neuronal survival. Our goal was to assess the expression of NFκB p65 and its negative regulator, Nrf2, in myenteric neurons and adjacent smooth muscle of different gut segments after chronic hyperglycaemia and immediate insulin treatment. Methods: After ten weeks of hyperglycaemia, intestinal samples of control, streptozotocin-induced diabetic and insulin-treated diabetic rats were prepared for fluorescent immunohistochemistry, immunogold electron microscopy, ELISA and qPCR. Results: In the diabetic rats, the proportion of NFκB p65-immunoreactive myenteric neurons decreased significantly in the duodenum and increased in the ileum. The density of NFκB p65-labelling gold particles increased in the ileal but remained unchanged in the duodenal ganglia. Meanwhile, both total and nuclear Nrf2 density increased in the myenteric neurons of the diabetic duodenum. In smooth muscle, NFκB p65 and Nrf2 density increased in the small intestine of diabetic rats. While on the mRNA level, NFκB p65 and Nrf2 were induced, on the protein level, NFκB p65 increased and Nrf2 decreased in muscle/myenteric plexus homogenates. Insulin treatment had protective effects. Conclusions: Our findings reveal a segment-specific NFκB and Nrf expression in myenteric neurons and ganglionic muscular environments, which may contribute to regional neuronal survival and motility disturbances in diabetes.

1. Introduction

Type 1 diabetes is an autoimmune metabolic disorder characterized by the destruction of insulin-producing pancreatic ß-cells. Based on WHO data, both the disease prevalence and its mortality rates are rising rapidly [1]. Diabetes causes multiple organ failure, including cardiomyopathy, retinopathy, nephropathy or neuropathy [2,3,4,5]. Among them, several cardiovascular complications are outstanding risk factors of diabetic deaths. Patients with diabetes often suffer from different gastrointestinal motility disturbances, like gastroparesis, diarrhoea or constipation related to enteric neuropathy. Diabetic damage of enteric neurons is strictly region-dependent and may result in alterations of neurochemical character or even extensive cell loss [6]. Intestinal microbial composition, oxidative circumstances and defence mechanisms basically define the environment of neurons from segment to segment and undergo regional alterations in diabetes [7]. These shifts in oxidant/antioxidant balance promote inflammatory processes that affect enteric neurons.
Cytokines, like tumour necrosis factor alpha (TNFα), and different interleukins (ILs) have a great impact on the regulation of intestinal homeostasis [8,9,10], and contribute to the modulation of enteric neuroinflammation [11,12]. Among others, these cytokines are inducers of nuclear factor kappa-light-chain-enhancer of activated B cell (NFκB) signalling pathways [13,14,15].
The NFκB transcription factor family plays an essential role in mediating rapid cellular responses to different stimuli, and is therefore a key component in immune responses, inflammation and cell survival [16,17]. The NFκB family includes five potential subunits: RelA (p65), RelB and c-Rel, which contain a transactivation domain required for gene transcription, and p50 and p52, which do not [17,18]. These subunits are able to assemble into hetero- and homodimers, from which the p65/p50 dimer appears to be the most abundant [19]. The dimers are located in the cytoplasm in an inactive state. Activation of the NFκB complex via canonical or non-canonical pathways results in NFκB nuclear translocation and regulation of specific gene transcription [20].
NFκB activation is a key point early in the pathogenesis of type 1 diabetes, and it can promote both pro-apoptotic and anti-apoptotic cascades [21]. Growing evidence supports that the cytokine-induced activation of the NFκB pathway contributes to the apoptosis of pancreatic ß cells [22,23]. However, other studies have pointed out its protective role; the NFκB blockade during pancreas development reduced the number of endocrine cells and insulin secretion-related gene expression in the adult pancreas [24]. The NFκB signalling pathway also plays a pivotal role in diabetic complications accompanied by extensive neuronal injuries, among others [21]. The dual function of NFκB regulating both pro- and anti-apoptotic gene expression may result in cell death or promote neuronal survival [25,26,27]. Upregulated NFκB activation caused by advanced glycation end products was observed in peripheral nerves that contribute to diabetic polyneuropathy [21], while the suppression of NFκB alleviates the related symptoms in patients with diabetes [28,29]. On the other hand, it has also been evidenced that NFκB activation is essential to the survival-promoting effect of TNFα on neurons [13,25].
It is well established that there is a molecular and functional crosstalk between the NFκB and nuclear factor erythroid 2-related factor 2 (Nrf2) pathways in the regulation of cellular responses to oxidative stress and inflammation [16,30]. The Nrf2 transcription factor contributes to the anti-inflammatory process through mediating the transcription of different antioxidant proteins [31]. Both NFκB and Nrf2 compete for the same transcriptional co-activator complex; therefore, Nrf2 is able to inhibit the NFκB pathway and serves as a negative regulator [16,30]. Based on that, the NFκB-Nrf2 interplay is a critical component in maintaining the epithelial barrier function and mitigating inflammation in the gastrointestinal tract in response to oxidative injury [32]. Interactions between these two factors fundamentally define inflammatory processes both in neurons and in their environment and influence the severity of diabetic neuropathy [33]. Comprehensive research of different cytokines has been implemented along the gastrointestinal tract, which highlights their roles in diabetes-related segment-specific enteric neuropathy [34,35,36]. However, the expression of NFκB and Nrf2 in enteric ganglia have not been investigated in diabetes.
Therefore, the main aim of this study was to investigate the NFκB and Nrf2 expression in the myenteric ganglia and its muscular environment in different gut segments of diabetic rats with untreated chronic hyperglycaemia and insulin treatment.

2. Materials and Methods

2.1. Animal Model

Wistar rats (200–300 g, male, Toxi-Coop Zrt., Balatonfüred, Hungary) were randomized into STZ-induced diabetic (diabetic; n = 14), insulin-treated STZ-induced diabetic (insulin-treated diabetic; n = 13) and age- and sex-matched control (n = 14) groups. Hyperglycaemia was induced by a single injection of STZ (60 mg/kg, i.p., S0130, Sigma–Aldrich, Budapest, Hungary) [6,34,37]. The rats were considered diabetic if their blood glucose level was above 18 mmol/L. The insulin-treated group received injections of insulin (Humulin M3, HI0719, Eli Lilly Nederland, Utrecht, The Netherlands) twice a day (3-3 IU, s. c.) during the 10-week experiment. Equivalent volumes of saline were injected (s. c.) in the diabetics and the controls. Monitoring of the glycaemic state and weight of the animals, and reasons for animal exclusion from this study, were detailed previously [35,38]. The principles of the National Institutes of Health (Bethesda, MD, USA) guidelines and the EU directive 2010/63/EU were followed, and our research was approved by the National Scientific Ethical Committee on Animal Experimentation (National Competent Authority).

2.2. Tissue Handling

Ten weeks after the induction of hyperglycaemia, the rats were killed [35,38] according to animal experiment license XX./1636/2019. The intestinal tissues of experimental groups were dissected and rinsed in 0.05 M phosphate buffer (PB; pH 7.4). Intestinal samples were taken from the duodenum, the ileum and the colon [35,36], and processed for quantitative PCR, ELISA, double-labelling fluorescent immunohistochemistry and quantitative electron microscopy. For the qPCR and ELISA, the samples were cut along the mesentery, the layers of mucosa and submucosa were removed and intestinal smooth muscle layers, including the myenteric plexus (MUSCLE-MP), were snap-frozen in liquid nitrogen and stored at −80 °C until use. For fluorescent immunohistochemistry, the gut samples were cut along the mesentery, pinched flat and fixed overnight (4 °C) in 4% formaldehyde solution (37308, Molar-Chemicals Kft., Halásztelek, Hungary). After washing, the mucosa, submucosa and circular smooth muscle were removed, and whole-mount preparations containing the myenteric plexus and the longitudinal smooth muscle were prepared. For the post-embedding immunogold technique, small pieces of different segments were fixed in 2% paraformaldehyde—2% glutaraldehyde solution and in 2% OsO4. After rinsing in buffer and dehydrating in increasing ethanol concentrations and acetone, they were embedded in Embed812 (14900, Electron Microscopy Sciences, Hatfield, PA, USA).

2.3. RNA Extraction, Reverse Transcription and Quantitative PCR

Frozen fragments were pulverized under liquid nitrogen, homogenized in RNA bee reagent (CS-104B, Tel-Test Inc., Friendswood, TX, USA) and total RNA was prepared according to the manufacturer’s recommendations. RNA purity and concentration was measured with a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). The concentration of the RNA was calculated using the A260 = 1.0 equivalent to ~40 µg/mL single-stranded RNA equation. First-strand cDNAs were synthesized using 5 µg total RNA and the Maxima H Minus First Strand cDNA Synthesis Kit with oligo(dT)18 priming, according to the manufacturer (Thermo Scientific, Waltham, MA, USA: K1652). qPCR was applied in Applied Biosystems 7500 Fast Real-Time system using Luminaris Color HiGreen qPCR Master Mix, Low ROX (Thermo Scientific, Waltham, MA, USA: K0371). The qPCR reactions were performed in 96-well plates containing 20 µL reaction mix/well with a temperature program of 95 °C for 10 min (initial denaturing), then 45 cycle of 15 s at 95 °C and 40 s at 63 °C. The RT-qPCR reactions for each sample were performed in triplicate to increase the reliability of the measurements. The Ct values of all samples were normalized to the internal control (18S rRNA) and gene expression was calculated in terms of the 2−ΔΔCt method [39].

2.4. Primers

Data of the primers (Bio Basic Canada Inc., Markham, ON, Canada) are summarized in Table 1.

2.5. Measurement of Tissue NFκB and Nrf2 Concentrations

MUSCLE-MP samples were fresh-frozen in liquid nitrogen, crushed into powder and homogenized in 500 µL homogenizing buffer (100 µL protease inhibitor cocktail (Sigma-Aldrich, Budapest, Hungary) in 20 mL 0.05 M PB). Homogenates were centrifuged at 5000 rpm for 20 min at 4 °C. The NFκB p65 and Nrf2 levels of the homogenates were determined by means of quantitative ELISA according to the manufacturer’s instructions (NFκB p65: GA-E4022RT; Nrf2: GA-E4033RT; GenAsia Biotech Co., Ltd., Shanghai, China). Optical density was measured at 450 nm (Benchmark Microplate Reader; Bio-Rad, Budapest, Hungary). Tissue NFκB p65 and Nrf2 concentrations were expressed as ng/mg protein.

2.6. Bradford Protein Micromethod

To determine the total protein content of intestinal samples, a commercial protein assay kit was used. Bradford reagent was mixed with the samples and, after 10 min incubation, the samples were assayed by a spectrophotometer (595 nm). The level of total protein content was measured as mg protein/mL.

2.7. Fluorescent Immunohistochemistry

Whole mounts derived from different segments of small intestine were immunostained with NFκB p65 and HuC/HuD pan-neuronal marker or triple-labelled with NFκB p65, Nrf2 and Peripherin pan-neuronal marker. After blocking [35,38], the whole mounts were incubated overnight with anti-NFκB p65 (F-6) (mouse monoclonal IgG; 1:50; Cat.No.sc-8008, Santa Cruz Biotechnology, Dallas, TX, USA) and anti-HuC/HuD (rabbit monoclonal IgG; 1:200; Cat.No.ab184267, Abcam, Cambridge, UK) or with anti-NFκB p65 (F-6) (mouse monoclonal IgG; 1:50; Cat.No.sc-8008, Santa Cruz Biotechnology, Dallas, TX, USA), anti-Nrf2 (rabbit polyclonal, 1:100; Cat.No.ab31163, Abcam, Cambridge, UK) and anti-Peripherin 1 (guinea pig polyclonal IgG; 1:500; Cat.No.424 004, Synaptic System, Goettingen, Germany) primary antibodies (4 °C). After washing in TBS with 0.025% Triton X-100 (A16046, Molar-Chemicals Kft., Halásztelek, Hungary), sections were incubated with anti-mouse Cy3 (1:200; Cat.No.115-165-003, Jackson ImmunoResearch Laboratories, West Grove, PA, USA), anti-rabbit Alexa Fluor 488 (1:200; Cat.No.A11008, Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) and anti-guinea pig Cy5 (1:200; Cat.No.ab102372, Abcam, Cambridge, UK, in the case of triple-labelling) secondary antibodies for 1 h at room temperature. No immunoreactivity was detected on negative controls omitting the primary antibodies. Whole mounts were mounted and photographed with a Zeiss Imager Z.2 fluorescent microscope (Axiocam 506 mono camera) (Zeiss, Jena, Germany). At least one thousand myenteric neurons were taken from the duodenum and the ileum (per group), and the proportion of NFκB p65-immunoreactive myenteric neurons were counted per ganglia.

2.8. Quantitative Post-Embedding Immunohistochemistry

From embedded blocks of small gut segments of each experimental group, ultrathin (70 nm) sections were prepared and mounted on nickel grids for NFκB p65 and Nrf2 immunogold labelling. These sections (3 grids/block) were incubated overnight in anti-NFκB p65 (F-6) (mouse monoclonal IgG; 1:25; Cat.No.sc-8008, Santa Cruz Biotechnology, Dallas, TX, USA) or anti-Nrf2 (rabbit polyclonal; 1:25; Cat.No.ab31163, Abcam, Cambridge, UK) primary antibodies, followed by anti-mouse IgG (conjugated to 18 nm colloidal gold particles; 1:20; Cat.No.115-215-071, Jackson ImmunoResearch, West Grove, PA, USA; or conjugated to 10 nm gold particles; 1:30; Cat.No.G7652, Sigma-Aldrich, Louis, MO, USA) or anti-rabbit IgG (conjugated to 18 nm gold particles; 1:20; Cat.No.111-215-144, Jackson ImmunoResearch, West Grove, PA, USA) secondary antibodies for 3 h. No immunoreactivity was detected on negative controls omitting the primary antibodies. After counterstaining [40], the sections were photographed with a JEOL JEM 1400 transmission electron microscope. The subcellular localization and quantitative features of the gold particles’ labelling NFκB p65 or Nrf2 were determined in the myenteric ganglia and surrounding smooth muscle cells. Fifty digital photographs of ten myenteric ganglia and thirty digital photographs of intestinal smooth muscle cells/gut segments/conditions were made at a magnification of 20,000× with a transmission electron microscope (JEOL JEM 1400, JEOL, Tokyo, Japan) and the TEM Center 1.6.9 software (JEOL, Tokyo, Japan). The intensity of the labelling was expressed as the total number of gold particles per unit area (µm2).

2.9. Statistical Analysis

A Kruskal–Wallis test and a Dunn’s multiple comparisons test were used for statistical analysis (GraphPad Prism 6.0; GraphPad Software Inc, San Diego, CA, USA). A probability of p < 0.05 was set as the level of significance. Data were expressed as mean ± SEM.

3. Results

3.1. Disease Characteristics of Type 1 Diabetic Rats

During the 10 weeks of the experiment, the weight and glycaemic features of the experimental animals were monitored (Table 2). Diabetic rats were characterised by a long-lasting chronic hyperglycaemia with a 29.46 ± 0.87 mmol/L average blood glucose concentration, which was almost five times higher than that of the control animals (5.92 ± 0.11 mmol/L; p < 0.0001). Immediate insulin treatment prevented extremely high glucose levels; however, the values were still higher than in the controls (12.98 ± 1.5 mmol/L; p < 0.05). All the animals gained weight during the experiment, but the final body weight of diabetic rats was notably lower compared with the insulin-treated diabetics and controls.

3.2. Diabetic Alterations of Intestinal NFκB Expression

3.2.1. Quantitative Changes in NFκB p65 mRNA Expression

In the controls, the expression level of NFκB p65 mRNA was highest in the colon, while a third of this value was measured in the duodenum (p < 0.01) and the ileum (p < 0.01) (Figure 1a). In diabetics, the relative level of NFκB p65 mRNA increased regionally along the intestinal tract. It was more than 3.5-fold higher in tissue homogenates of both the colon (p < 0.01) and the ileum (p < 0.01) of diabetics relative to the control group, while no significant changes were observed in the diabetic duodenum (Figure 1b). In the insulin-treated diabetic group, the NFκB p65 mRNA levels were close to the control values in all investigated gut segments (Figure 1b).

3.2.2. NFκB p65 Protein Level in Smooth Muscle/Myenteric Plexus Homogenates

In the control conditions, the tissue level of NFκB p65 displayed a significant decrease from the duodenum to the colon (0.997 ± 0.27 vs. 0.16 ± 0.09 ng/mg; p < 0.05; Figure 2a). In the diabetic muscle/myenteric plexus homogenates, the NFκB p65 level increased markedly in the small intestine compared with the control samples; it doubled in the duodenum (2.01 ± 0.15 vs. 0.997 ± 0.27 ng/mg; p < 0.05) and tripled in the ileum (2.18 ± 0.3 vs. 0.68 ± 0.17 ng/mg; p < 0.05), which was completely prevented by insulin treatment (Figure 2b). In colonic homogenates, neither the diabetic nor the insulin-treated diabetic samples showed any changes in their NFκB p65 level in our 10-week diabetic rat model (Figure 2b).

3.2.3. Proportion of NFκB p65-Immunoreactive Myenteric Neurons

Double-labelling immunofluorescence unveiled regional differences in NFκB p65 immunoreactivity in the myenteric ganglia along the small intestine both in the controls and the diabetics. In the neurons, different labelling patterns of NFκB immunoreactivity was observed according to the following types: only cytosolic labelling; intensity of labelling was higher in cytoplasm than nucleus; intensity of labelling was homogenous in cytoplasm and nucleus (Figure 3). The proportion of NFκB p65-IR myenteric neurons compared with the total number of myenteric neurons was 2% in the duodenal, while it was almost double, 3.8%, in the ileal ganglia of control animals (Figure 4). In diabetics, this proportion was significantly decreased in the myenteric ganglia of the duodenum (less than 1%) and was increased in the ileum (more than 7%) relative to the controls (Figure 4). Insulin treatment completely prevented the diabetic changes in the proportion of NFκB p65-IR neurons in the duodenum; however, it decreased that proportion significantly below the control values in the ileum (Figure 4).

3.2.4. Quantitative Distribution of NFκB p65-Labelling Gold Particles in Myenteric Ganglia and Intestinal Smooth Muscle

Quantitative analysis of NFκB p65 expression in the myenteric ganglia was made after post-embedding immunogold electron microscopy using 18 nm gold particles to label NFκB p65 (Figure 5). The total density of gold particles displayed a marked increase in the myenteric ganglia of the diabetic ileum (0.48 ± 0.09 vs. 0.16 ± 0.03; p < 0.05), in both the nuclear and the cytoplasmic levels, but it did not change in the diabetic duodenum relative to the controls (0.17 ± 0.03 vs. 0.18 ± 0.03; Figure 6a). In the case of intestinal smooth muscle surrounding the myenteric ganglia, the total density of gold particles enhanced significantly in the duodenum (0.22 ± 0.03 vs. 0.13 ± 0.02; p < 0.01) and slightly increased in the ileum (0.32 ± 0.09 vs. 0.19 ± 0.02) of diabetic samples relative to the control group (Figure 6b). Regarding the intracellular distribution, the density of gold particles increased to a similar extent in both the cytoplasm and the nuclei of smooth muscle cells in both the duodenum and the ileum. Insulin treatment prevented all diabetic alterations of NFκB p65 gold particles’ density in the small intestine (Figure 6).

3.3. Diabetic Alterations of Intestinal Nrf2 Expression

3.3.1. Quantitative Changes in Nrf2 mRNA Expression

In the controls, the Nrf2 mRNA level was similarly low in the duodenum and the ileum, while in the colonic samples, it was multiple times higher (3-fold higher relative to the duodenum (p < 0.01) and 4.5-fold higher relative to the ileum) (p < 0.0001; Figure 7a). In the diabetic animals, the relative level of Nrf2 mRNA was robustly increased in all segments along the duodenum–ileum–colon axis. The greatest induction was demonstrated in the ileal homogenates of diabetic samples, where the Nrf2 mRNA level was nearly 18-fold higher than that of the control values (p < 0.01). Furthermore, an 11-fold induction was revealed in the duodenum (p < 0.05) and a 3-fold increase was demonstrated in the colon (p < 0.001) of diabetics (Figure 7b). In the insulin-treated diabetic group, the Nrf2 mRNA levels remained close to the control levels in all segments (Figure 7b).

3.3.2. Nrf2 Protein Level in Smooth Muscle/Myenteric Plexus Homogenates

Nrf2 tissue levels exhibited significant differences between small and large intestinal segments, even in the control rats, e.g., it was 15-fold higher in the duodenum than in the colon (7.12 ± 0.22 vs. 0.48 ± 0.07 ng/mg; p < 0.01; Figure 8a). In diabetic intestinal homogenates, the level of Nrf2 dropped significantly in the duodenum (2.65 ± 0.42 vs. 7.12 ± 0.22 ng/mg; p < 0.01) and displayed a decreasing tendency in the ileum, but remained unchanged in the colon relative to the control levels. A protective effect of immediate insulin treatment in the small intestinal regions was observed at least in part (Figure 8b).

3.3.3. Quantitative Evaluation of Nrf2 Immunohistochemistry in Myenteric Ganglia and Intestinal Smooth Muscle

Double-labelling fluorescent immunohistochemistry and immunogold electron microscopy have demonstrated NFκB p65 and Nrf2 co-immunoreactivity in enteric neurons on whole-mount preparations and ultrathin sections of myenteric ganglia (Figure 9).
Quantification of Nrf2 immunogold labelling was completed in both myenteric ganglia and neighbouring smooth muscle cells (Figure 10a,b). Density of gold particles labelling Nrf2 increased significantly in the ganglia (p < 0.01) and also in their muscular environment (p < 0.05) of diabetic rats compared with controls, which was prevented by insulin treatment (Figure 11a,b).
Moreover, the diabetes-related enhancement of Nrf2 density resulted from the increased number of gold particles in both the neuronal perikarya and nuclei in the case of the myenteric ganglia, while it had a mainly cytoplasmic origin in the muscle cells (Table 3).

4. Discussion

The present study provides the first evidence of intestinal region-dependent alterations in both NFκB and Nrf signalling in enteric neurons and their muscular environment of type 1 diabetic rats. Beneficial effects of immediate insulin treatment on NFκB and Nrf expression were also observed in our chronic hyperglycaemic rat model, even if the blood glucose concentrations were not at control levels.
Earlier findings [34,35] regarding the strictly regional expression of different cytokines in distinct gut segments presumably contributed to the regionally induced NFκB expression in the diabetic gut. However, NFκB induction showed opposite trends in mRNA and protein levels along the intestinal axis. While the increase in NFκB p65 mRNA expression was pronounced in distal gut segments of diabetics, the NFκB p65 protein concentration was higher in small intestinal homogenates, with low and unchanged levels in the colon of the diabetic group. In the literature, all variations of NFκB p65 mRNA and protein changes have been demonstrated, e.g., increased mRNA expression was not followed by changes in protein content in human corneal fibroblasts under hypoxic conditions [41]. Unchanged NFκB mRNA levels accompanied by increased protein content [42] or enhancement of NFκB expression at both levels [43] have also been observed in different in vitro and in vivo studies. These reflect the complex regulation of NFκB signalling at multiple levels, including post-translational modifications [44]. The fact that diabetes-related changes in NFκB p65 mRNA and protein levels differed from segment to segment within the gut emphasizes the impact of the regional environmental milieu along the duodenum–ileum–colon axis and certainly contributes to the regional involvement of enteric neurons in diabetic damage.
Based on the protein measurement findings, the proximal and distal part of the small intestine was the focus of our immunofluorescence investigations. In the small intestine of healthy controls, approximately 2–4% of the total myenteric neuronal population displayed immunoreactivity for NFκB p65. In diabetic rats, the proportion of NFκB p65-IR myenteric neurons was significantly rearranged; it halved in the duodenum and doubled in the ileum. These opposite alterations suggest the activation of the NFκB system in the ileum but not in the duodenum. Besides other techniques, immunofluorescence is also appropriate to monitor the cellular states of NFκB activity [45]. The activation of NFκB as a key element of rapid cellular responses can be characterized as a dynamic system, in which different activation states, like constitutive, low and high, exist [46,47]. Among the NFκB-IR neurons, we also observed different patterns of immunolabelling from fully cytosolic to varying degrees of nuclear labelling representing distinct active states of the NFκB system [45]. It is also important to note that neurons with low or high levels of NFκB activity and neurons considered to be inactive were adjacent to each other in the myenteric ganglia, reflecting the cellular heterogeneity of NFκB activation [45].
In order to achieve a more accurate view about the subcellular localisation of NFκB, immunogold electron microscopy was applied in the myenteric ganglia and neighbouring smooth muscle cells of the small intestine. Confirming the results of fluorescent and ELISA studies, in the ileum of diabetic rats, the total density of NFκB p65-labelling gold particles increased in both the ganglia and smooth muscle. Furthermore, this increase was manifested in both the nuclei and the cytoplasm of cells. The nuclear increase in the NFκB p65 subunit suggests its translocation leading to regulate the long-term expression of numerous target genes involved in inflammation and immunity [29,48]. According to our recent findings, both the expression of IL1β inflammatory cytokine and Toll-like receptor 4-sensing microbial lipopolysaccharides were markedly induced in myenteric neurons of this particular gut segment of type 1 diabetic rats [35,38]. IL1β and bacterial lipopolysaccharides are among the main triggers of the NFκB canonical pathway [29]; therefore, we propose that they largely contribute to the increased expression and activation of NFκB in the ileum of diabetic animals.
However, in the duodenum of diabetics, the total density of NFκB p65 gold labels remained unchanged in the ganglia and increased in the smooth muscle (both nuclear and cytoplasmic level), which supports findings that an increased tissue concentration of NFκB p65 in muscle/myenteric plexus homogenates derives from the intestinal smooth muscle in this segment. Moreover, the invariable NFκB p65 density in neuronal nuclei indicates again the lack of NFκB nuclear translocation and activation in the diabetic duodenum despite enhanced cytokine expression here [34,35]. It is known that the transport of NFκB p65 from the cytoplasm to the nucleus is mediated by importin α3 [49]; therefore, further detailed investigation of the importin transportation system is aimed in our future plans.
To reveal the underlying processes that led to our NFκB findings in the duodenum, we evaluated the diabetes-related alterations in Nrf2 expression, focusing primarily on this intestinal region. According to our electron microscopic findings, the total density of Nrf2-labelling gold particles increased in the ganglia and adjacent smooth muscle cells. It should be emphasized that enhanced Nrf2 expression was accompanied by a nuclear Nrf2 increase in the myenteric neurons. The nuclear translocation of Nrf2 leads to the transcription of different antioxidants, which are expressed at higher levels in the duodenum than in other gut segments of diabetic rats [50]. Other than the upregulation of the antioxidant defence system, Nrf2 is able to downregulate the NFκB signalling and protects cells in the gastrointestinal tract against oxidative stress [32]. In a diabetic mouse model, Nrf2 overexpression also inhibited the DNA-binding activity of NFκB [51]. Additional studies described that the stimulation of Nrf2 signalling decreases oxidative damage and inflammation and alleviates diabetic neuropathy [52,53].

5. Conclusions

Similar to the regional cytokine induction in diabetic rats [34,35], the NFκB expression has also shown a strict regionality according to intestinal segments, which suggests that the different cytokines also trigger the activation of the NFκB signalling pathway in the myenteric ganglia. However, non-uniform alterations were observed in the ganglionic NFκB expression of different gut segments in which the neuronal environment (e.g., intestinal redox status, antioxidant defence) has to play a critical importance [7]. Earlier, we demonstrated that myenteric neurons located in different gut segments displayed different susceptibilities to diabetic damage, and, according to this study, the duodenum was the only segment in which diabetic cell loss was not observed [6]. Therefore, we presume that the activation of Nrf2 in myenteric neurons may inhibit the NFκB pathway in the ganglia of the duodenum and may contribute to neuronal survival through the enhancement of antioxidant mechanisms in this particular intestinal segment in type 1 diabetes [40,54]. However, considering the complexity of NFκB-Nrf crosstalk and NFκB signalling, further investigations of the pathway components are required.

Author Contributions

Conceptualization, M.B. and N.B.; methodology, M.B. and N.B.; validation, N.B.; investigation, B.P.B., B.O., A.E.-K., A.A.D., J.B., Z.S. and Á.F.; resources, J.B. and B.P.B.; writing—original draft preparation, N.B., M.B. and B.P.B.; writing—review and editing, M.B., N.B. and E.H.; visualization, M.B.; supervision, N.B.; funding acquisition, N.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Hungarian NKFIH fund project, No. FK131789 (N.B.); János Bolyai Research Scholarship of the Hungarian Academy of Sciences (N.B.), ÚNKP-22-3-SZTE-389 and ÚNKP-23-3-SZTE-426 New National Excellence Program of the Ministry for Culture and Innovation from the source of the National Research, Development and Innovation Fund (B.P.B.).

Institutional Review Board Statement

In all procedures involving experimental animals, the principles of the National Institutes of Health (Bethesda, MD, USA) guidelines and the EU directive 2010/63/EU for the protection of animals used for scientific purposes were strictly followed, and all the experiments were approved by the National Scientific Ethical Committee on Animal Experimentation (National Competent Authority), with the license number XX./1636/2019 and Animal Welfare Committee University of Szeged with the license number I-74-11/2019 MÁB.

Informed Consent Statement

Not applicable.

Data Availability Statement

Dataset available from the corresponding author at [email protected] e-mail address.

Acknowledgments

We thank Erika Németh for the excellent technical assistance.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Diabetes. Available online: https://www.who.int/news-room/fact-sheets/detail/diabetes (accessed on 16 September 2024).
  2. Modarelli, R.; Brown, L.; Boyd, J.; Podd, B.; Willis, Z.; Levenson, A. Severe Multiple Organ Failure as a Consequence of Diabetic Ketoacidosis in an Adolescent with New-Onset Type 1 Diabetes: A Case Report. SAGE Open Med. Case Rep. 2023, 11, 2050313X231190004. [Google Scholar] [CrossRef] [PubMed]
  3. Avagimyan, A.; Fogacci, F.; Pogosova, N.; Kakrurskiy, L.; Kogan, E.; Urazova, O.; Kobalava, Z.; Mikhaleva, L.; Vandysheva, R.; Zarina, G.; et al. Diabetic Cardiomyopathy: 2023 Update by the International Multidisciplinary Board of Experts. Curr. Probl. Cardiol. 2024, 49, 102052. [Google Scholar] [CrossRef] [PubMed]
  4. Shivam; Gupta, A.K.; Kumar, S. Current Concepts in the Molecular Mechanisms and Management ofDiabetic Neuropathy by Pharmacotherapeutics and Natural Compounds. Cent. Nerv. Syst. Agents Med. Chem. 2024, 24, 264–280. [Google Scholar] [CrossRef] [PubMed]
  5. Wang, N.; Zhang, C. Recent Advances in the Management of Diabetic Kidney Disease: Slowing Progression. Int. J. Mol. Sci. 2024, 25, 3086. [Google Scholar] [CrossRef] [PubMed]
  6. Izbéki, F.; Wittman, T.; Rosztóczy, A.; Linke, N.; Bódi, N.; Fekete, É.; Bagyánszki, M. Immediate Insulin Treatment Prevents Gut Motility Alterations and Loss of Nitrergic Neurons in the Ileum and Colon of Rats with Streptozotocin-Induced Diabetes. Diabetes Res. Clin. Pract. 2008, 80, 192–198. [Google Scholar] [CrossRef] [PubMed]
  7. Bagyánszki, M.; Bódi, N. Key Elements Determining the Intestinal Region-Specific Environment of Enteric Neurons in Type 1 Diabetes. World J. Gastroenterol. 2023, 29, 2704–2716. [Google Scholar] [CrossRef] [PubMed]
  8. Ruder, B.; Atreya, R.; Becker, C. Tumour Necrosis Factor Alpha in Intestinal Homeostasis and Gut Related Diseases. Int. J. Mol. Sci. 2019, 20, 1887. [Google Scholar] [CrossRef]
  9. Jarret, A.; Jackson, R.; Duizer, C.; Healy, M.E.; Zhao, J.; Rone, J.M.; Bielecki, P.; Sefik, E.; Roulis, M.; Rice, T.; et al. Enteric Nervous System-Derived IL-18 Orchestrates Mucosal Barrier Immunity. Cell 2020, 180, 50–63. [Google Scholar] [CrossRef]
  10. Wei, H.-X.; Wang, B.; Li, B. IL-10 and IL-22 in Mucosal Immunity: Driving Protection and Pathology. Front. Immunol. 2020, 11, 1315. [Google Scholar] [CrossRef]
  11. Bessac, A.; Cani, P.D.; Meunier, E.; Dietrich, G.; Knauf, C. Inflammation and Gut-Brain Axis During Type 2 Diabetes: Focus on the Crosstalk Between Intestinal Immune Cells and Enteric Nervous System. Front. Neurosci. 2018, 12, 725. [Google Scholar] [CrossRef]
  12. Wang, H.; Foong, J.P.P.; Harris, N.L.; Bornstein, J.C. Enteric Neuroimmune Interactions Coordinate Intestinal Responses in Health and Disease. Mucosal Immunol. 2022, 15, 27–39. [Google Scholar] [CrossRef] [PubMed]
  13. Dolga, A.M.; Granic, I.; Blank, T.; Knaus, H.; Spiess, J.; Luiten, P.G.M.; Eisel, U.L.M.; Nijholt, I.M. TNF-α-mediates Neuroprotection against Glutamate-induced Excitotoxicity via NF-κB-dependent Up-regulation of KCa 2.2 Channels. J. Neurochem. 2008, 107, 1158–1167. [Google Scholar] [CrossRef] [PubMed]
  14. Mitchell, S.; Vargas, J.; Hoffmann, A. Signaling via the NFκB System. Wiley Interdiscip. Rev. Syst. Biol. Med. 2016, 8, 227–241. [Google Scholar] [CrossRef]
  15. Alam, M.; Javed, M.N.; Najmi, A.K.; Ahmad, F.J.; Imam, S.S.; Akhtar, M. Thymoquinone Lipid Nanoparticles Cut the Gordian Knots of Depression via NeuroprotectiveBDNF and Downregulation of Neuro-Inflammatory NF-κB, IL-6, andTNF-α in LPS Treated Rats. Curr. Drug Metab. 2021, 22, 978–988. [Google Scholar] [CrossRef] [PubMed]
  16. Wardyn, J.D.; Ponsford, A.H.; Sanderson, C.M. Dissecting Molecular Cross-Talk between Nrf2 and NF-κB Response Pathways. Biochem. Soc. Trans. 2015, 43, 621–626. [Google Scholar] [CrossRef]
  17. Zhang, H.; Sun, S.-C. NF-κB in Inflammation and Renal Diseases. Cell Biosci. 2015, 5, 63. [Google Scholar] [CrossRef]
  18. Baldwin, A.S. THE NF-κB AND IκB PROTEINS: New Discoveries and Insights. Annu. Rev. Immunol. 1996, 14, 649–681. [Google Scholar] [CrossRef]
  19. Dresselhaus, E.C.; Meffert, M.K. Cellular Specificity of NF-κB Function in the Nervous System. Front. Immunol. 2019, 10, 1043. [Google Scholar] [CrossRef] [PubMed]
  20. Giridharan, S.; Srinivasan, M. Mechanisms of NF-&kappa;B P65 and Strategies for Therapeutic Manipulation. J. Inflamm. Res. 2018, 11, 407–419. [Google Scholar] [CrossRef]
  21. Patel, S.; Santani, D. Role of NF-κB in the Pathogenesis of Diabetes and Its Associated Complications. Pharmacol. Rep. 2009, 61, 595–603. [Google Scholar] [CrossRef]
  22. Heimberg, H.; Heremans, Y.; Jobin, C.; Leemans, R.; Cardozo, A.K.; Darville, M.; Eizirik, D.L. Inhibition of Cytokine-Induced NF-κB Activation by Adenovirus-Mediated Expression of a NF-κB Super-Repressor Prevents β-Cell Apoptosis. Diabetes 2001, 50, 2219–2224. [Google Scholar] [CrossRef] [PubMed]
  23. Eldor, R.; Yeffet, A.; Baum, K.; Doviner, V.; Amar, D.; Ben-Neriah, Y.; Christofori, G.; Peled, A.; Carel, J.C.; Boitard, C.; et al. Conditional and Specific NF-κB Blockade Protects Pancreatic Beta Cells from Diabetogenic Agents. Proc. Natl. Acad. Sci. USA 2006, 103, 5072–5077. [Google Scholar] [CrossRef] [PubMed]
  24. Norlin, S.; Ahlgren, U.; Edlund, H. Nuclear Factor-κB Activity in β-Cells Is Required for Glucose-Stimulated Insulin Secretion. Diabetes 2005, 54, 125–132. [Google Scholar] [CrossRef] [PubMed]
  25. Mattson, M.P.; Meffert, M.K. Roles for NF-κB in Nerve Cell Survival, Plasticity, and Disease. Cell Death Differ. 2006, 13, 852–860. [Google Scholar] [CrossRef]
  26. Qin, Z.; Tao, L.; Chen, X. Dual Roles of NF-κB in Cell Survival and Implications of NF-κB Inhibitors in Neuroprotective Therapy. Acta Pharmacol. Sin. 2007, 28, 1859–1872. [Google Scholar] [CrossRef] [PubMed]
  27. Singh, S.; Singh, T.G. Role of Nuclear Factor Kappa B (NF-κB) Signalling in Neurodegenerative Diseases: An Mechanistic Approach. Curr. Neuropharmacol. 2020, 18, 918–935. [Google Scholar] [CrossRef]
  28. Jeffrey, S.; Samraj, P.I.; Raj, B.S. The Role of Alpha-Lipoic Acid Supplementation in the Prevention of Diabetes Complications: A Comprehensive Review of Clinical Trials. Curr. Diabetes Rev. 2021, 17, 87–98. [Google Scholar] [CrossRef]
  29. Guo, Q.; Jin, Y.; Chen, X.; Ye, X.; Shen, X.; Lin, M.; Zeng, C.; Zhou, T.; Zhang, J. NF-κB in Biology and Targeted Therapy: New Insights and Translational Implications. Signal Transduct. Target. Ther. 2024, 9, 53. [Google Scholar] [CrossRef]
  30. Gao, W.; Guo, L.; Yang, Y.; Wang, Y.; Xia, S.; Gong, H.; Zhang, B.-K.; Yan, M. Dissecting the Crosstalk Between Nrf2 and NF-κB Response Pathways in Drug-Induced Toxicity. Front. Cell Dev. Biol. 2022, 9, 809952. [Google Scholar] [CrossRef]
  31. Kobayashi, A.; Ohta, T.; Yamamoto, M. Unique Function of the Nrf2–Keap1 Pathway in the Inducible Expression of Antioxidant and Detoxifying Enzymes. Methods Enzymol. 2004, 378, 273–286. [Google Scholar] [CrossRef]
  32. Yanaka, A. Role of NRF2 in Protection of the Gastrointestinal Tract against Oxidative Stress. J. Clin. Biochem. Nutr. 2018, 63, 18–25. [Google Scholar] [CrossRef] [PubMed]
  33. Hashemi, M.; Zandieh, M.A.; Ziaolhagh, S.; Mojtabavi, S.; Sadi, F.H.; Koohpar, Z.K.; Ghanbarirad, M.; Haghighatfard, A.; Behroozaghdam, M.; Khorrami, R.; et al. Nrf2 Signaling in Diabetic Nephropathy, Cardiomyopathy and Neuropathy: Therapeutic Targeting, Challenges and Future Prospective. Biochim. Et Biophys. Acta (BBA)-Mol. Basis Dis. 2023, 1869, 166714. [Google Scholar] [CrossRef] [PubMed]
  34. Bódi, N.; Chandrakumar, L.; Al Doghmi, A.; Mezei, D.; Szalai, Z.; Barta, B.P.; Balázs, J.; Bagyánszki, M. Intestinal Region-Specific and Layer-Dependent Induction of TNFα in Rats with Streptozotocin-Induced Diabetes and after Insulin Replacement. Cells 2021, 10, 2410. [Google Scholar] [CrossRef] [PubMed]
  35. Al Doghmi, A.; Barta, B.P.; Egyed-Kolumbán, A.; Onhausz, B.; Kiss, S.; Balázs, J.; Szalai, Z.; Bagyánszki, M.; Bódi, N. Gut Region-Specific Interleukin 1β Induction in Different Myenteric Neuronal Subpopulations of Type 1 Diabetic Rats. Int. J. Mol. Sci. 2023, 24, 5804. [Google Scholar] [CrossRef]
  36. Barta, B.P.; Onhausz, B.; Doghmi, A.A.; Szalai, Z.; Balázs, J.; Bagyánszki, M.; Bódi, N. Gut Region-Specific TNFR Expression: TNFR2 Is More Affected than TNFR1 in Duodenal Myenteric Ganglia of Diabetic Rats. World J. Diabetes 2023, 14, 48–61. [Google Scholar] [CrossRef]
  37. Chandrakumar, L.; Bagyánszki, M.; Szalai, Z.; Mezei, D.; Bódi, N. Diabetes-Related Induction of the Heme Oxygenase System and Enhanced Colocalization of Heme Oxygenase 1 and 2 with Neuronal Nitric Oxide Synthase in Myenteric Neurons of Different Intestinal Segments. Oxidative Med. Cell. Longev. 2017, 2017, 1–13. [Google Scholar] [CrossRef]
  38. Bódi, N.; Egyed-Kolumbán, A.; Onhausz, B.; Barta, B.P.; Doghmi, A.A.; Balázs, J.; Szalai, Z.; Bagyánszki, M. Intestinal Region-Dependent Alterations of Toll-Like Receptor 4 Expression in Myenteric Neurons of Type 1 Diabetic Rats. Biomedicines 2023, 11, 129. [Google Scholar] [CrossRef]
  39. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  40. Barta, B.P.; Onhausz, B.; AL Doghmi, A.; Egyed-Kolumbán, A.; Kiss, S.Z.; Szalai, Z.; Balázs, J.; Bagyánszki, M.; Bódi, N. Gut Region-Specific Expression of Nuclear Factor Kappa B P65 in the Myenteric Ganglia and Its Microenvironment of Streptozotocin Induced Diabetic Rats. In Proceedings of the 1st International Conference on Antioxidants, Barcelona, Spain, 10–12 May 2023. [Google Scholar]
  41. Stachon, T.; Latta, L.; Seitz, B.; Szentmáry, N. Hypoxic Stress Increases NF-κB and iNOS mRNA Expression in Normal, but Not in Keratoconus Corneal Fibroblasts. Graefe’s Arch. Clin. Exp. Ophthalmol. 2021, 259, 449–458. [Google Scholar] [CrossRef]
  42. Cuadrado, A.; Martín-Moldes, Z.; Ye, J.; Lastres-Becker, I. Transcription Factors NRF2 and NF-κB Are Coordinated Effectors of the Rho Family, GTP-Binding Protein RAC1 during Inflammation. J. Biol. Chem. 2014, 289, 15244–15258. [Google Scholar] [CrossRef]
  43. Luo, Q.; Cui, H.; Deng, H.; Kuang, P.; Liu, H.; Lu, Y.; Fang, J.; Zuo, Z.; Deng, J.; Li, Y.; et al. Sodium Fluoride Induces Renal Inflammatory Responses by Activating NF-κB Signaling Pathway and Reducing Anti-Inflammatory Cytokine Expression in Mice. Oncotarget 2017, 8, 80192–80207. [Google Scholar] [CrossRef] [PubMed]
  44. Huang, B.; Yang, X.-D.; Lamb, A.; Chen, L.-F. Posttranslational Modifications of NF-κB: Another Layer of Regulation for NF-κB Signaling Pathway. Cell. Signal. 2010, 22, 1282–1290. [Google Scholar] [CrossRef] [PubMed]
  45. Meier-Soelch, J.; Mayr-Buro, C.; Juli, J.; Leib, L.; Linne, U.; Dreute, J.; Papantonis, A.; Schmitz, M.L.; Kracht, M. Monitoring the Levels of Cellular NF-κB Activation States. Cancers 2021, 13, 5351. [Google Scholar] [CrossRef]
  46. Kaltschmidt, C.; Kaltschmidt, B.; Neumann, H.; Wekerle, H.; Baeuerle, P.A. Constitutive NF-Kappa B Activity in Neurons. Mol. Cell. Biol. 1994, 14, 3981–3992. [Google Scholar] [CrossRef]
  47. Kracht, M.; Müller-Ladner, U.; Schmitz, M.L. Mutual Regulation of Metabolic Processes and Proinflammatory NF-κB Signaling. J. Allergy Clin. Immunol. 2020, 146, 694–705. [Google Scholar] [CrossRef]
  48. Zhu, J.; Cynader, M.S.; Jia, W. TDP-43 Inhibits NF-κB Activity by Blocking P65 Nuclear Translocation. PLoS ONE 2015, 10, e0142296. [Google Scholar] [CrossRef]
  49. Fagerlund, R.; Kinnunen, L.; Köhler, M.; Julkunen, I.; Melén, K. NF-κB Is Transported into the Nucleus by Importin A3 and Importin A4. J. Biol. Chem. 2005, 280, 15942–15951. [Google Scholar] [CrossRef]
  50. Jancsó, Z.; Bódi, N.; Borsos, B.; Fekete, É.; Hermesz, E. Gut Region-Specific Accumulation of Reactive Oxygen Species Leads to Regionally Distinct Activation of Antioxidant and Apoptotic Marker Molecules in Rats with STZ-Induced Diabetes. Int. J. Biochem. Cell Biol. 2015, 62, 125–131. [Google Scholar] [CrossRef] [PubMed]
  51. Song, M.-Y.; Kim, E.-K.; Moon, W.-S.; Park, J.-W.; Kim, H.-J.; So, H.-S.; Park, R.; Kwon, K.-B.; Park, B.-H. Sulforaphane Protects against Cytokine- and Streptozotocin-Induced β-Cell Damage by Suppressing the NF-κB Pathway. Toxicol. Appl. Pharmacol. 2009, 235, 57–67. [Google Scholar] [CrossRef]
  52. Sandireddy, R.; Yerra, V.G.; Komirishetti, P.; Areti, A.; Kumar, A. Fisetin Imparts Neuroprotection in Experimental Diabetic Neuropathy by Modulating Nrf2 and NF-κB Pathways. Cell. Mol. Neurobiol. 2016, 36, 883–892. [Google Scholar] [CrossRef]
  53. Zhang, W.; Yu, H.; Lin, Q.; Liu, X.; Cheng, Y.; Deng, B. Anti-Inflammatory Effect of Resveratrol Attenuates the Severity of Diabetic Neuropathy by Activating the Nrf2 Pathway. Aging 2021, 13, 10659–10671. [Google Scholar] [CrossRef] [PubMed]
  54. Bódi, N.; Barta, B.P.; Onhausz, B.; Doghmi, A.A.L.; Egyed-Kolumbán, A.; Szalai, Z.; Balázs, J.; Bagyánszki, M. Diabetes-Related Alterations in the Expression of NFκB and Its Negative Regulator in the Myenteric Ganglia and Neighbouring Muscular Environment of Rat Duodenum. In Proceedings of the 48th FEBS Congress, Milan, Italy, 29 June–3 July 2024. [Google Scholar]
Biomedicines 12 02347 g001
Figure 1. Relative levels of NFκB p65 mRNA. (a) Relative levels of NFκB p65 mRNA in tissue homogenates from different gut segments of control rats. The expression level of NFκB p65 mRNA was nearly three times higher in the colon than in the small intestinal segments of controls. Data were expressed as means ± SEM. ** p < 0.01 (compare with CD); oo p < 0.01 (between CI and CC). CD—control duodenum, CI—control ileum, CC—control colon. (b) Effects of long-lasting hyperglycaemia and insulin treatment on the relative level of NFκB p65 mRNA in tissue homogenates from different gut segments. In the diabetics, the relative level of NFκB p65 mRNA displayed a more than 3-fold increase in the tissue homogenates of the colon and ileum, which was prevented by insulin treatment. Data were expressed as means ± SEM. ** p < 0.01 (compare to C); oo p < 0.01 (between D and ID). C—controls, D—diabetics, ID—insulin-treated diabetics.
Figure 1. Relative levels of NFκB p65 mRNA. (a) Relative levels of NFκB p65 mRNA in tissue homogenates from different gut segments of control rats. The expression level of NFκB p65 mRNA was nearly three times higher in the colon than in the small intestinal segments of controls. Data were expressed as means ± SEM. ** p < 0.01 (compare with CD); oo p < 0.01 (between CI and CC). CD—control duodenum, CI—control ileum, CC—control colon. (b) Effects of long-lasting hyperglycaemia and insulin treatment on the relative level of NFκB p65 mRNA in tissue homogenates from different gut segments. In the diabetics, the relative level of NFκB p65 mRNA displayed a more than 3-fold increase in the tissue homogenates of the colon and ileum, which was prevented by insulin treatment. Data were expressed as means ± SEM. ** p < 0.01 (compare to C); oo p < 0.01 (between D and ID). C—controls, D—diabetics, ID—insulin-treated diabetics.
Biomedicines 12 02347 g001
Biomedicines 12 02347 g002
Figure 2. Tissue levels of NFκB p65. (a) Tissue levels of NFκB p65 in intestinal smooth muscle/myenteric plexus homogenates from different gut segments of control rats. The tissue level of NFκB p65 displayed a significant decrease from the duodenum to the colon of controls. Data were expressed as means ± SEM. * p < 0.05 (compare with CD). CD—control duodenum, CI—control ileum, CC—control colon. (b) Effects of long-lasting hyperglycaemia and insulin treatment on the tissue levels of NFκB p65 in smooth muscle/myenteric plexus homogenates from different gut segments. In the diabetic rats, the NFκB p65 level was doubled in the duodenum and tripled in the ileum, while it did not change in the colon. Immediate insulin treatment was completely protective against diabetes-related changes. Data were expressed as means ± SEM. * p < 0.05 (compare with C); o p < 0.05 (between D and ID). C—controls, D—diabetics, ID—insulin-treated diabetics.
Figure 2. Tissue levels of NFκB p65. (a) Tissue levels of NFκB p65 in intestinal smooth muscle/myenteric plexus homogenates from different gut segments of control rats. The tissue level of NFκB p65 displayed a significant decrease from the duodenum to the colon of controls. Data were expressed as means ± SEM. * p < 0.05 (compare with CD). CD—control duodenum, CI—control ileum, CC—control colon. (b) Effects of long-lasting hyperglycaemia and insulin treatment on the tissue levels of NFκB p65 in smooth muscle/myenteric plexus homogenates from different gut segments. In the diabetic rats, the NFκB p65 level was doubled in the duodenum and tripled in the ileum, while it did not change in the colon. Immediate insulin treatment was completely protective against diabetes-related changes. Data were expressed as means ± SEM. * p < 0.05 (compare with C); o p < 0.05 (between D and ID). C—controls, D—diabetics, ID—insulin-treated diabetics.
Biomedicines 12 02347 g002
Biomedicines 12 02347 g003aBiomedicines 12 02347 g003b
Figure 3. Representative fluorescent micrographs of whole-mount preparations of myenteric ganglia from the duodenum and ileum of control, diabetic and insulin-treated diabetic rats after NFκB p65-HuC/HuD double-labelling immunohistochemistry. HuC/HuD as a pan-neuronal marker was applied to label myenteric neurons. CD—control duodenum, CI—control ileum, DD—diabetic duodenum, DI—diabetic ileum, IDD—insulin-treated diabetic duodenum, IDI—insulin-treated diabetic ileum, arrows—NFκB p65-immunoreactive myenteric neurons. Scale bars: 20 μm.
Figure 3. Representative fluorescent micrographs of whole-mount preparations of myenteric ganglia from the duodenum and ileum of control, diabetic and insulin-treated diabetic rats after NFκB p65-HuC/HuD double-labelling immunohistochemistry. HuC/HuD as a pan-neuronal marker was applied to label myenteric neurons. CD—control duodenum, CI—control ileum, DD—diabetic duodenum, DI—diabetic ileum, IDD—insulin-treated diabetic duodenum, IDI—insulin-treated diabetic ileum, arrows—NFκB p65-immunoreactive myenteric neurons. Scale bars: 20 μm.
Biomedicines 12 02347 g003aBiomedicines 12 02347 g003b
Biomedicines 12 02347 g004
Figure 4. Proportion of NFκB p65-immunoreactive myenteric neurons in the duodenum and ileum of control, diabetic and insulin-treated diabetic rats. In the diabetics, the proportion of NFκB p65-immunoreactive myenteric neurons was significantly decreased in the duodenum and increased in the ileum, which was prevented by immediate insulin treatment. Data were expressed as mean ± SEM. * p < 0.05, ** p < 0.01 (compare with C); o p < 0.05, oooo p < 0.0001 (between D and ID). C—controls, D—diabetics, ID—insulin-treated diabetics.
Figure 4. Proportion of NFκB p65-immunoreactive myenteric neurons in the duodenum and ileum of control, diabetic and insulin-treated diabetic rats. In the diabetics, the proportion of NFκB p65-immunoreactive myenteric neurons was significantly decreased in the duodenum and increased in the ileum, which was prevented by immediate insulin treatment. Data were expressed as mean ± SEM. * p < 0.05, ** p < 0.01 (compare with C); o p < 0.05, oooo p < 0.0001 (between D and ID). C—controls, D—diabetics, ID—insulin-treated diabetics.
Biomedicines 12 02347 g004
Biomedicines 12 02347 g005
Figure 5. Representative electron micrographs of portions of the perikaryon and nuclei of myenteric neurons from ileum and intestinal smooth muscle cells from duodenum of control, diabetic and insulin-treated diabetic rats after NFκB p65 post-embedding immunohistochemistry. CD—control duodenum, CI—control ileum, DD—diabetic duodenum, DI—diabetic ileum, IDD—insulin-treated diabetic duodenum, IDI—insulin-treated diabetic ileum, arrows—18 nm gold particles’ labelling NFκB p65. Scale bars: 250 nm.
Figure 5. Representative electron micrographs of portions of the perikaryon and nuclei of myenteric neurons from ileum and intestinal smooth muscle cells from duodenum of control, diabetic and insulin-treated diabetic rats after NFκB p65 post-embedding immunohistochemistry. CD—control duodenum, CI—control ileum, DD—diabetic duodenum, DI—diabetic ileum, IDD—insulin-treated diabetic duodenum, IDI—insulin-treated diabetic ileum, arrows—18 nm gold particles’ labelling NFκB p65. Scale bars: 250 nm.
Biomedicines 12 02347 g005
Biomedicines 12 02347 g006
Figure 6. Quantification of gold particles’ labelling NFκB p65 in myenteric ganglia (a) and intestinal smooth muscle (b) from different gut segments of control, diabetic and insulin-treated diabetic rats. The number of NFκB p65-labelling gold particles increased in the ileal myenteric ganglia and intestinal smooth muscle of both the duodenum and the ileum of diabetic animals relative to the controls, which was prevented by insulin. Data were expressed as means ± SEM. * p < 0.05, ** p < 0.01 (compare with C); o p < 0.05, oo p < 0.01 (between D and ID). C—controls, D—diabetics, ID—insulin-treated diabetics.
Figure 6. Quantification of gold particles’ labelling NFκB p65 in myenteric ganglia (a) and intestinal smooth muscle (b) from different gut segments of control, diabetic and insulin-treated diabetic rats. The number of NFκB p65-labelling gold particles increased in the ileal myenteric ganglia and intestinal smooth muscle of both the duodenum and the ileum of diabetic animals relative to the controls, which was prevented by insulin. Data were expressed as means ± SEM. * p < 0.05, ** p < 0.01 (compare with C); o p < 0.05, oo p < 0.01 (between D and ID). C—controls, D—diabetics, ID—insulin-treated diabetics.
Biomedicines 12 02347 g006
Biomedicines 12 02347 g007
Figure 7. Relative levels of Nrf2 mRNA. (a) Relative levels of Nrf2 mRNA in tissue homogenates from different gut segments of control rats. The expression level of Nrf2 mRNA was multiple times higher in the colon than in the small intestinal segments of the controls. Data were expressed as means ± SEM. ** p < 0.01 (compare with CD); oooo p < 0.0001 (between CI and CC). CD—control duodenum, CI—control ileum, CC—control colon. (b) Effects of long-lasting hyperglycaemia and insulin treatment on the relative level of Nrf2 mRNA in tissue homogenates from different gut segments. In the diabetics, the relative level of Nrf2 mRNA displayed a robust increase in all segments along the duodenum–ileum–colon axis, which was prevented by insulin treatment. Data were expressed as means ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 (compare with C); oo p < 0.01, ooo p < 0.001 (between D and ID). C—controls, D—diabetics, ID—insulin-treated diabetics.
Figure 7. Relative levels of Nrf2 mRNA. (a) Relative levels of Nrf2 mRNA in tissue homogenates from different gut segments of control rats. The expression level of Nrf2 mRNA was multiple times higher in the colon than in the small intestinal segments of the controls. Data were expressed as means ± SEM. ** p < 0.01 (compare with CD); oooo p < 0.0001 (between CI and CC). CD—control duodenum, CI—control ileum, CC—control colon. (b) Effects of long-lasting hyperglycaemia and insulin treatment on the relative level of Nrf2 mRNA in tissue homogenates from different gut segments. In the diabetics, the relative level of Nrf2 mRNA displayed a robust increase in all segments along the duodenum–ileum–colon axis, which was prevented by insulin treatment. Data were expressed as means ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 (compare with C); oo p < 0.01, ooo p < 0.001 (between D and ID). C—controls, D—diabetics, ID—insulin-treated diabetics.
Biomedicines 12 02347 g007
Biomedicines 12 02347 g008
Figure 8. Tissue levels of Nrf2. (a) Tissue levels of Nrf2 in intestinal smooth muscle/myenteric plexus homogenates from different gut segments of control rats. The tissue levels of Nrf2 were significantly higher in the small intestine than the colon of the controls. Data were expressed as means ± SEM. ** p < 0.01 (compare with CD); o p < 0.05 (between CI and CC). CD—control duodenum, CI—control ileum, CC—control colon. (b) Effects of long-lasting hyperglycaemia and insulin treatment on the tissue levels of Nrf2 in smooth muscle/myenteric plexus homogenates from different gut segments. In the diabetic rats, the Nrf2 level was decreased in the duodenum and ileum, while it did not change in the colon. Immediate insulin treatment was protective against diabetes-related changes. Data were expressed as means ± SEM. ** p < 0.01 (compare with C); o p < 0.05 (between D and ID). C—controls, D—diabetics, ID—insulin-treated diabetics.
Figure 8. Tissue levels of Nrf2. (a) Tissue levels of Nrf2 in intestinal smooth muscle/myenteric plexus homogenates from different gut segments of control rats. The tissue levels of Nrf2 were significantly higher in the small intestine than the colon of the controls. Data were expressed as means ± SEM. ** p < 0.01 (compare with CD); o p < 0.05 (between CI and CC). CD—control duodenum, CI—control ileum, CC—control colon. (b) Effects of long-lasting hyperglycaemia and insulin treatment on the tissue levels of Nrf2 in smooth muscle/myenteric plexus homogenates from different gut segments. In the diabetic rats, the Nrf2 level was decreased in the duodenum and ileum, while it did not change in the colon. Immediate insulin treatment was protective against diabetes-related changes. Data were expressed as means ± SEM. ** p < 0.01 (compare with C); o p < 0.05 (between D and ID). C—controls, D—diabetics, ID—insulin-treated diabetics.
Biomedicines 12 02347 g008
Biomedicines 12 02347 g009
Figure 9. Representative fluorescent micrograph of a whole-mount preparation of myenteric ganglia from the ileum of a control rat after NFκB p65-Nrf2-Peripherin triple-labelling immunohistochemistry (a). Pan-neuronal Peripherin was used to label myenteric neurons. Representative electron micrograph of a portion of the perikaryon and nucleus of a myenteric neuron from duodenum of a control rat after NFκB p65-Nrf2 post-embedding immunohistochemistry (b). Red circles—10 nm gold particles’ labelling NFκB p65, arrows—18 nm gold particles’ labelling Nrf2. CI—control ileum, CD—control duodenum. Scale bars: 20 µm (a), 250 nm (b).
Figure 9. Representative fluorescent micrograph of a whole-mount preparation of myenteric ganglia from the ileum of a control rat after NFκB p65-Nrf2-Peripherin triple-labelling immunohistochemistry (a). Pan-neuronal Peripherin was used to label myenteric neurons. Representative electron micrograph of a portion of the perikaryon and nucleus of a myenteric neuron from duodenum of a control rat after NFκB p65-Nrf2 post-embedding immunohistochemistry (b). Red circles—10 nm gold particles’ labelling NFκB p65, arrows—18 nm gold particles’ labelling Nrf2. CI—control ileum, CD—control duodenum. Scale bars: 20 µm (a), 250 nm (b).
Biomedicines 12 02347 g009
Biomedicines 12 02347 g010
Figure 10. Representative electron micrographs of portions of the perikaryon and nuclei of myenteric neurons (a) and intestinal smooth muscle cells (b) from the duodenum of control and diabetic rats after Nrf2 post-embedding immunohistochemistry. CD—control duodenum, DD—diabetic duodenum. Arrows—18 nm gold particles’ labelling Nrf2 in myenteric neurons, arrowheads—18 nm gold particles’ labelling Nrf2 in muscle cells. Scale bars: 250 nm.
Figure 10. Representative electron micrographs of portions of the perikaryon and nuclei of myenteric neurons (a) and intestinal smooth muscle cells (b) from the duodenum of control and diabetic rats after Nrf2 post-embedding immunohistochemistry. CD—control duodenum, DD—diabetic duodenum. Arrows—18 nm gold particles’ labelling Nrf2 in myenteric neurons, arrowheads—18 nm gold particles’ labelling Nrf2 in muscle cells. Scale bars: 250 nm.
Biomedicines 12 02347 g010
Biomedicines 12 02347 g011
Figure 11. Quantification of gold particles’ labelling Nrf2 in myenteric ganglia (a) and intestinal smooth muscle (b) from the duodenum of control, diabetic and insulin-treated diabetic rats. The number of Nrf2-labelling gold particles increased in the myenteric ganglia and smooth muscle of diabetic duodenum relative to controls, which was partially prevented by insulin treatment. Data were expressed as means ± SEM. * p < 0.05, ** p < 0.01 (compare with C); oo p < 0.01 (between D and ID). C—controls, D—diabetics, ID—insulin-treated diabetics.
Figure 11. Quantification of gold particles’ labelling Nrf2 in myenteric ganglia (a) and intestinal smooth muscle (b) from the duodenum of control, diabetic and insulin-treated diabetic rats. The number of Nrf2-labelling gold particles increased in the myenteric ganglia and smooth muscle of diabetic duodenum relative to controls, which was partially prevented by insulin treatment. Data were expressed as means ± SEM. * p < 0.05, ** p < 0.01 (compare with C); oo p < 0.01 (between D and ID). C—controls, D—diabetics, ID—insulin-treated diabetics.
Biomedicines 12 02347 g011
Table 1. Primer sequences with accession number.
Table 1. Primer sequences with accession number.
GenePrimers (5′ → 3′)
NFκB (NM_199267)CCGGAACTCTGGGAGCTGCC
AGGCTAGGGTCAGCGTATGG
NRF2 (XM_006234397)GCAACTCCAGAAGGAACAGG
GGAATGTCTCTGCCAAAAGC
NFκB—nuclear factor kappa-light-chain-enhancer of activated B cells, NRF2—nuclear factor erythroid 2-related factor 2.
Table 2. Weight and blood glucose characteristics of the experimental animals.
Table 2. Weight and blood glucose characteristics of the experimental animals.
Body Weight (g)Blood Glucose Concentration (mmol/L)
InitialFinalInitialFinal (Average)
Controls (n = 14)256.7 ± 17.68467 ± 16.13 ****5.96 ± 0.265.92 ± 0.11
Diabetics (n = 14)223.9 ± 7.54320.9 ± 14.736.09 ± 0.3729.46 ± 0.87 ****,oooo
Insulin-treated diabetics (n = 13)233.7 ± 9.44463.1 ± 14.87 ****5.86 ± 0.3512.98 ± 1.5 *,o
Statistics: Kruskal–Wallis test with a Dunn’s multiple comparisons test. Data are expressed as mean ± SEM; * p < 0.05, **** p < 0.0001 vs. initial; o p < 0.05, oooo p < 0.0001 vs. controls.
Table 3. Intracellular distribution of Nrf2-labelling gold particles in myenteric neurons and intestinal smooth muscle cells (labels/µm2).
Table 3. Intracellular distribution of Nrf2-labelling gold particles in myenteric neurons and intestinal smooth muscle cells (labels/µm2).
Myenteric NeuronsSmooth Muscle Cells
PerikaryaNucleiCytoplasmNuclei
Controls1.12 ± 0.160.95 ± 0.060.67 ± 0.041.27 ± 0.11
Diabetics1.43 ± 0.09 **1.28 ± 0.08 *0.92 ± 0.05 ***1.35 ± 0.10
Insulin-treated diabetics1.32 ± 0.09 *1.16 ± 0.070.75 ± 0.04 °0.97 ± 0.08 °
Statistics: Kruskal–Wallis test with a Dunn’s multiple comparisons test. Data are expressed as mean ± SEM; * p < 0.05, ** p < 0.01, *** p < 0.001 vs. controls; ° p < 0.05 vs. diabetics.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Barta, B.P.; Onhausz, B.; Egyed-Kolumbán, A.; AL Doghmi, A.; Balázs, J.; Szalai, Z.; Ferencz, Á.; Hermesz, E.; Bagyánszki, M.; Bódi, N. Intestinal Region-Dependent Impact of NFκB-Nrf Crosstalk in Myenteric Neurons and Adjacent Muscle Cells in Type 1 Diabetic Rats. Biomedicines 2024, 12, 2347. https://doi.org/10.3390/biomedicines12102347

AMA Style

Barta BP, Onhausz B, Egyed-Kolumbán A, AL Doghmi A, Balázs J, Szalai Z, Ferencz Á, Hermesz E, Bagyánszki M, Bódi N. Intestinal Region-Dependent Impact of NFκB-Nrf Crosstalk in Myenteric Neurons and Adjacent Muscle Cells in Type 1 Diabetic Rats. Biomedicines. 2024; 12(10):2347. https://doi.org/10.3390/biomedicines12102347

Chicago/Turabian Style

Barta, Bence Pál, Benita Onhausz, Abigél Egyed-Kolumbán, Afnan AL Doghmi, János Balázs, Zita Szalai, Ágnes Ferencz, Edit Hermesz, Mária Bagyánszki, and Nikolett Bódi. 2024. "Intestinal Region-Dependent Impact of NFκB-Nrf Crosstalk in Myenteric Neurons and Adjacent Muscle Cells in Type 1 Diabetic Rats" Biomedicines 12, no. 10: 2347. https://doi.org/10.3390/biomedicines12102347

APA Style

Barta, B. P., Onhausz, B., Egyed-Kolumbán, A., AL Doghmi, A., Balázs, J., Szalai, Z., Ferencz, Á., Hermesz, E., Bagyánszki, M., & Bódi, N. (2024). Intestinal Region-Dependent Impact of NFκB-Nrf Crosstalk in Myenteric Neurons and Adjacent Muscle Cells in Type 1 Diabetic Rats. Biomedicines, 12(10), 2347. https://doi.org/10.3390/biomedicines12102347

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop