Metabolic Profiles Point Out Metabolic Pathways Pivotal in Two Glioblastoma (GBM) Cell Lines, U251 and U-87MG
Abstract
:1. Introduction
2. Materials and Methods
2.1. GBM Patient Data Source
2.2. Cell Culture
2.3. Nuclear Magnetic Resonance (NMR) Spectroscopy
2.4. Reverse Transcription and Quantitative PCR (RT-qPCR)
2.5. Cell Death Analysis Using Flow Cytometry
2.6. Cell Proliferation Assay
2.7. Wound Healing Assay
2.8. Statistical Analysis
3. Results
3.1. The Expression of Metabolic Key Genes Is Altered in Glioblastoma (GBM) Specimens
3.2. Glucose, Lactate, Glutamine, and Glutamate Bioavailability Impacts the Expression Profile of Metabolic Key Genes in GBM Cell Lines Differently
3.3. Glucose, Lactate, Glutamine, and Glutamate Bioavailability Impact the Metabolic Profiles of GBM Cell Lines Differently
3.4. U251 and U-87MG GBM Cell Lines Are Metabolically Different and upon Exposure to Glucose, Lactate, Glutamine, and Glutamate, the Differences Are Emphasized, Suggesting Different Adaptive Pathways
3.5. Glucose, Glutamine, and Glutamate Increase Migration, and Lactate Tends to Decrease Proliferation in GBM Cell Lines
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Ostrom, Q.T.; Price, M.; Neff, C.; Cioffi, G.; Waite, K.A.; Kruchko, C.; Barnholtz-Sloan, J.S. CBTRUS Statistical Report: Primary Brain and Other Central Nervous System Tumors Diagnosed in the United States in 2015–2019. Neuro-Oncology 2022, 24, v1–v95. [Google Scholar] [CrossRef] [PubMed]
- Obara-Michlewska, M.; Szeliga, M. Targeting Glutamine Addiction in Gliomas. Cancers 2020, 12, 310. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Louis, D.N.; Perry, A.; Wesseling, P.; Brat, D.J.; Cree, I.A.; Figarella-Branger, D.; Hawkins, C.; Ng, H.K.; Pfister, S.M.; Reifenberger, G.; et al. The 2021 WHO Classification of Tumors of the Central Nervous System: A Summary. Neuro-Oncology 2021, 23, 1231–1251. [Google Scholar] [CrossRef]
- Louis, D.N.; Perry, A.; Reifenberger, G.; von Deimling, A.; Figarella-Branger, D.; Cavenee, W.K.; Ohgaki, H.; Wiestler, O.D.; Kleihues, P.; Ellison, D.W. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: A Summary. Acta Neuropathol. 2016, 131, 803–820. [Google Scholar] [CrossRef] [Green Version]
- Ostrom, Q.T.; Patil, N.; Cioffi, G.; Waite, K.; Kruchko, C.; Barnholtz-Sloan, J.S. CBTRUS Statistical Report: Primary Brain and Other Central Nervous System Tumors Diagnosed in the United States in 2013–2017. Neuro-Oncology 2020, 22, iv1–iv96. [Google Scholar] [CrossRef] [PubMed]
- Stoyanov, G.S.; Lyutfi, E.; Georgieva, R.; Georgiev, R.; Dzhenkov, D.L.; Petkova, L.; Ivanov, B.D.; Kaprelyan, A.; Ghenev, P. Reclassification of Glioblastoma Multiforme According to the 2021 World Health Organization Classification of Central Nervous System Tumors: A Single Institution Report and Practical Significance. Cureus 2022, 14, e21822. [Google Scholar] [CrossRef]
- Stupp, R.; Mason, W.P.; van den Bent, M.J.; Weller, M.; Fisher, B.; Taphoorn, M.J.B.; Belanger, K.; Brandes, A.A.; Marosi, C.; Bogdahn, U.; et al. Radiotherapy plus Concomitant and Adjuvant Temozolomide for Glioblastoma. N. Engl. J. Med. 2005, 352, 987–996. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Davis, M. Glioblastoma: Overview of Disease and Treatment. Clin. J. Oncol. Nurs. 2016, 20, S2–S8. [Google Scholar] [CrossRef] [Green Version]
- Serpa, J. Metabolic Remodeling as a Way of Adapting to Tumor Microenvironment (TME), a Job of Several Holders. In Tumor Microenvironment—The Main Driver of Metabolic Adaptation; Serpa, J., Ed.; Springer Nature: Berlin/Heidelberg, Germany, 2020; pp. 1–34. ISBN 978-3-030-34025-4. [Google Scholar]
- Rosati, A.; Marconi, S.; Pollo, B.; Tomassini, A.; Lovato, L.; Maderna, E.; Maier, K.; Schwartz, A.; Rizzuto, N.; Padovani, A.; et al. Epilepsy in Glioblastoma Multiforme: Correlation with Glutamine Synthetase Levels. J. Neurooncol. 2009, 93, 319–324. [Google Scholar] [CrossRef]
- Rosati, A.; Poliani, P.L.; Todeschini, A.; Cominelli, M.; Medicina, D.; Cenzato, M.; Simoncini, E.L.; Magrini, S.M.; Buglione, M.; Grisanti, S.; et al. Glutamine Synthetase Expression as a Valuable Marker of Epilepsy and Longer Survival in Newly Diagnosed Glioblastoma Multiforme. Neuro-Oncology 2013, 15, 618–625. [Google Scholar] [CrossRef]
- Kobayashi, M.; Mizutani, A.; Nishi, K.; Nakajima, S.; Shikano, N.; Nishii, R.; Fukuchi, K.; Kawai, K. Differences in Accumulation and the Transport Mechanism of L- and d-Methionine in High- and Low-Grade Human Glioma Cells. Nucl. Med. Biol. 2017, 44, 78–82. [Google Scholar] [CrossRef]
- Sidoryk, M.; Matyja, E.; Dybel, A.; Zielinska, M.; Bogucki, J.; Jaskólski, D.J.; Liberski, P.P.; Kowalczyk, P.; Albrecht, J. Increased Expression of a Glutamine Transporter SNAT3 Is a Marker of Malignant Gliomas. Neuroreport 2004, 15, 575–578. [Google Scholar] [CrossRef]
- Martins, F.; Gonçalves, L.G.; Pojo, M.; Serpa, J. Take Advantage of Glutamine Anaplerosis, the Kernel of the Metabolic Rewiring in Malignant Gliomas. Biomolecules 2020, 10, 1370. [Google Scholar] [CrossRef] [PubMed]
- Szeliga, M.; Matyja, E.; Obara, M.; Grajkowska, W.; Czernicki, T.; Albrecht, J. Relative Expression of MRNAS Coding for Glutaminase Isoforms in CNS Tissues and CNS Tumors. Neurochem. Res. 2008, 33, 808–813. [Google Scholar] [CrossRef]
- DeBerardinis, R.J.; Mancuso, A.; Daikhin, E.; Nissim, I.; Yudkoff, M.; Wehrli, S.; Thompson, C.B. Beyond Aerobic Glycolysis: Transformed Cells Can Engage in Glutamine Metabolism That Exceeds the Requirement for Protein and Nucleotide Synthesis. Proc. Natl. Acad. Sci. USA 2007, 104, 19345–19350. [Google Scholar] [CrossRef]
- Lopes-Coelho, F.; Gouveia-Fernandes, S.; Gonçalves, L.G.; Nunes, C.; Faustino, I.; Silva, F.; Félix, A.; Pereira, S.A.; Serpa, J. HNF1β Drives Glutathione (GSH) Synthesis Underlying Intrinsic Carboplatin Resistance of Ovarian Clear Cell Carcinoma (OCCC). Tumor Biol. 2016, 37, 4813–4829. [Google Scholar] [CrossRef] [PubMed]
- Guda, M.R.; Labak, C.M.; Omar, S.I.; Asuthkar, S.; Airala, S.; Tuszynski, J.; Tsung, A.J.; Velpula, K.K. GLUT1 and TUBB4 in Glioblastoma Could Be Efficacious Targets. Cancers 2019, 11, 1308. [Google Scholar] [CrossRef] [Green Version]
- Labak, C.M.; Wang, P.Y.; Arora, R.; Guda, M.R.; Asuthkar, S.; Tsung, A.J.; Velpula, K.K. Glucose Transport: Meeting the Metabolic Demands of Cancer, and Applications in Glioblastoma Treatment. Am. J. Cancer Res. 2016, 6, 1599–1608. [Google Scholar]
- Libby, C.J.; Zhang, S.; Benavides, G.A.; Scott, S.E.; Li, Y.; Redmann, M.; Tran, A.N.; Otamias, A.; Darley-Usmar, V.; Napierala, M.; et al. Identification of Compounds That Decrease Glioblastoma Growth and Glucose Uptake in Vitro. ACS Chem. Biol. 2018, 13, 2048–2057. [Google Scholar] [CrossRef]
- Park, S.J.; Smith, C.P.; Wilbur, R.R.; Cain, C.P.; Kallu, S.R.; Valasapalli, S.; Sahoo, A.; Guda, M.R.; Tsung, A.J.; Velpula, K.K. An Overview of MCT1 and MCT4 in GBM: Small Molecule Transporters with Large Implications. Am. J. Cancer Res. 2018, 8, 1967–1976. [Google Scholar]
- Miranda-Gonçalves, V.; Granja, S.; Martinho, O.; Honavar, M.; Pojo, M.; Costa, B.M.; Pires, M.M.; Pinheiro, C.; Cordeiro, M.; Bebiano, G.; et al. Hypoxia-Mediated Upregulation of MCT1 Expression Supports the Glycolytic Phenotype of Glioblastomas. Oncotarget 2016, 7, 46335–46353. [Google Scholar] [CrossRef] [Green Version]
- Kubelt, C.; Peters, S.; Ahmeti, H.; Huhndorf, M.; Huber, L.; Cohrs, G.; Hövener, J.-B.; Jansen, O.; Synowitz, M.; Held-Feindt, J. Intratumoral Distribution of Lactate and the Monocarboxylate Transporters 1 and 4 in Human Glioblastoma Multiforme and Their Relationships to Tumor Progression-Associated Markers. Int. J. Mol. Sci. 2020, 21, 6254. [Google Scholar] [CrossRef] [PubMed]
- Amiel, A.; Tremblay-Franco, M.; Gautier, R.; Ducheix, S.; Montagner, A.; Polizzi, A.; Debrauwer, L.; Guillou, H.; Bertrand-Michel, J.; Canlet, C. Proton NMR Enables the Absolute Quantification of Aqueous Metabolites and Lipid Classes in Unique Mouse Liver Samples. Metabolites 2019, 10, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wolf, A.; Agnihotri, S.; Munoz, D.; Guha, A. Developmental Profile and Regulation of the Glycolytic Enzyme Hexokinase 2 in Normal Brain and Glioblastoma Multiforme. Neurobiol. Dis. 2011, 44, 84–91. [Google Scholar] [CrossRef]
- Huang, Y.; Ouyang, F.; Yang, F.; Zhang, N.; Zhao, W.; Xu, H.; Yang, X. The Expression of Hexokinase 2 and Its Hub Genes Are Correlated with the Prognosis in Glioma. BMC Cancer 2022, 22, 900. [Google Scholar] [CrossRef] [PubMed]
- Liang, X.; Wang, Z.; Dai, Z.; Zhang, H.; Zhang, J.; Luo, P.; Liu, Z.; Liu, Z.; Yang, K.; Cheng, Q.; et al. Glioblastoma Glycolytic Signature Predicts Unfavorable Prognosis, Immunological Heterogeneity, and ENO1 Promotes Microglia M2 Polarization and Cancer Cell Malignancy. Cancer Gene Ther. 2022, 30, 481–496. [Google Scholar] [CrossRef]
- Stanke, K.M.; Wilson, C.; Kidambi, S. High Expression of Glycolytic Genes in Clinical Glioblastoma Patients Correlates with Lower Survival. Front. Mol. Biosci. 2021, 8, 752404. [Google Scholar] [CrossRef]
- Maher, E.A.; Marin-Valencia, I.; Bachoo, R.M.; Mashimo, T.; Raisanen, J.; Hatanpaa, K.J.; Jindal, A.; Jeffrey, F.M.; Choi, C.; Madden, C.; et al. Metabolism of [U- 13 C]Glucose in Human Brain Tumors In Vivo. NMR Biomed. 2012, 25, 1234–1244. [Google Scholar] [CrossRef] [Green Version]
- Cheng, T.; Sudderth, J.; Yang, C.; Mullen, A.R.; Jin, E.S.; Matés, J.M.; DeBerardinis, R.J. Pyruvate Carboxylase Is Required for Glutamine-Independent Growth of Tumor Cells. Proc. Natl. Acad. Sci. USA 2011, 108, 8674–8679. [Google Scholar] [CrossRef]
- Ye, Z.-C.; Rothstein, J.D.; Sontheimer, H. Compromised Glutamate Transport in Human Glioma Cells: Reduction–Mislocalization of Sodium-Dependent Glutamate Transporters and Enhanced Activity of Cystine–Glutamate Exchange. J. Neurosci. 1999, 19, 10767–10777. [Google Scholar] [CrossRef] [Green Version]
- Szeliga, M.; Bogacińska-Karaś, M.; Kuźmicz, K.; Rola, R.; Albrecht, J. Downregulation of GLS2 in Glioblastoma Cells Is Related to DNA Hypermethylation but Not to the P53 Status. Mol. Carcinog. 2016, 55, 1309–1316. [Google Scholar] [CrossRef] [PubMed]
- Campos-Sandoval, J.A.; Martín-Rufián, M.; Cardona, C.; Lobo, C.; Peñalver, A.; Márquez, J. Glutaminases in Brain: Multiple Isoforms for Many Purposes. Neurochem. Int. 2015, 88, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Duman, C.; Yaqubi, K.; Hoffmann, A.; Acikgöz, A.A.; Korshunov, A.; Bendszus, M.; Herold-Mende, C.; Liu, H.-K.; Alfonso, J. Acyl-CoA-Binding Protein Drives Glioblastoma Tumorigenesis by Sustaining Fatty Acid Oxidation. Cell Metab. 2019, 30, 274–289.e5. [Google Scholar] [CrossRef]
- Kant, S.; Kesarwani, P.; Prabhu, A.; Graham, S.F.; Buelow, K.L.; Nakano, I.; Chinnaiyan, P. Enhanced Fatty Acid Oxidation Provides Glioblastoma Cells Metabolic Plasticity to Accommodate to Its Dynamic Nutrient Microenvironment. Cell Death Dis. 2020, 11, 253. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Juraszek, B.; Czarnecka-Herok, J.; Nałęcz, K.A. Glioma Cells Survival Depends Both on Fatty Acid Oxidation and on Functional Carnitine Transport by SLC22A5. J. Neurochem. 2021, 156, 642–657. [Google Scholar] [CrossRef]
- Lin, H.; Patel, S.; Affleck, V.S.; Wilson, I.; Turnbull, D.M.; Joshi, A.R.; Maxwell, R.; Stoll, E.A. Fatty Acid Oxidation Is Required for the Respiration and Proliferation of Malignant Glioma Cells. Neuro-Oncology 2017, 19, 43–54. [Google Scholar] [CrossRef] [Green Version]
- Tso, C.-L.; Shintaku, P.; Chen, J.; Liu, Q.; Liu, J.; Chen, Z.; Yoshimoto, K.; Mischel, P.S.; Cloughesy, T.F.; Liau, L.M.; et al. Primary Glioblastomas Express Mesenchymal Stem-Like Properties. Mol. Cancer Res. 2006, 4, 607–619. [Google Scholar] [CrossRef] [Green Version]
- Mita, R.; Coles, J.E.; Glubrecht, D.D.; Sung, R.; Sun, X.; Godbout, R. B-FABP-Expressing Radial Glial Cells: The Malignant Glioma Cell of Origin? Neoplasia 2007, 9, 734–744. [Google Scholar] [CrossRef] [Green Version]
- Mita, R.; Beaulieu, M.J.; Field, C.; Godbout, R. Brain Fatty Acid-Binding Protein and ω-3/ω-6 Fatty Acids. J. Biol. Chem. 2010, 285, 37005–37015. [Google Scholar] [CrossRef] [Green Version]
- Mallick, R.; Basak, S.; Duttaroy, A.K. Fatty Acids and Evolving Roles of Their Proteins in Neurological, Cardiovascular Disorders and Cancers. Prog. Lipid Res. 2021, 83, 101116. [Google Scholar] [CrossRef]
- Fitscher, B.A.; Riedel, H.-D.; Young, K.C.; Stremmel, W. Tissue Distribution and CDNA Cloning of a Human Fatty Acid Transport Protein (HsFATP4). Biochim. Biophys. Acta Gene Struct. Expr. 1998, 1443, 381–385. [Google Scholar] [CrossRef] [PubMed]
- Pei, Z.; Sun, P.; Huang, P.; Lal, B.; Laterra, J.; Watkins, P.A. Acyl-CoA Synthetase VL3 Knockdown Inhibits Human Glioma Cell Proliferation and Tumorigenicity. Cancer Res. 2009, 69, 9175–9182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pei, Z.; Fraisl, P.; Berger, J.; Jia, Z.; Forss-Petter, S.; Watkins, P.A. Mouse Very Long-Chain Acyl-CoA Synthetase 3/Fatty Acid Transport Protein 3 Catalyzes Fatty Acid Activation but Not Fatty Acid Transport in MA-10 Cells. J. Biol. Chem. 2004, 279, 54454–54462. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anderson, C.M.; Stahl, A. SLC27 Fatty Acid Transport Proteins. Mol. Aspects Med. 2013, 34, 516–528. [Google Scholar] [CrossRef] [Green Version]
- Sun, P.; Xia, S.; Lal, B.; Shi, X.; Yang, K.S.; Watkins, P.A.; Laterra, J. Lipid Metabolism Enzyme ACSVL3 Supports Glioblastoma Stem Cell Maintenance and Tumorigenicity. BMC Cancer 2014, 14, 401. [Google Scholar] [CrossRef] [Green Version]
- Hale, J.S.; Otvos, B.; Sinyuk, M.; Alvarado, A.G.; Hitomi, M.; Stoltz, K.; Wu, Q.; Flavahan, W.; Levison, B.; Johansen, M.L.; et al. Cancer Stem Cell-Specific Scavenger Receptor CD36 Drives Glioblastoma Progression. Stem Cells 2014, 32, 1746–1758. [Google Scholar] [CrossRef] [Green Version]
- Ioghen, O.; Chițoiu, L.; Gherghiceanu, M.; Ceafalan, L.C.; Hinescu, M.E. CD36—A Novel Molecular Target in the Neurovascular Unit. Eur. J. Neurosci. 2021, 53, 2500–2510. [Google Scholar] [CrossRef]
- Tanase, C.; Enciu, A.M.; Codrici, E.; Popescu, I.D.; Dudau, M.; Dobri, A.M.; Pop, S.; Mihai, S.; Gheorghișan-Gălățeanu, A.-A.; Hinescu, M.E. Fatty Acids, CD36, Thrombospondin-1, and CD47 in Glioblastoma: Together and/or Separately? Int. J. Mol. Sci. 2022, 23, 604. [Google Scholar] [CrossRef]
- Miska, J.; Chandel, N.S. Targeting Fatty Acid Metabolism in Glioblastoma. J. Clin. Investig. 2023, 133, e163448. [Google Scholar] [CrossRef]
- Pathmanapan, S.; Ilkayeva, O.; Martin, J.T.; Loe, A.K.H.; Zhang, H.; Zhang, G.-F.; Newgard, C.B.; Wunder, J.S.; Alman, B.A. Mutant IDH and Non-Mutant Chondrosarcomas Display Distinct Cellular Metabolomes. Cancer Metab. 2021, 9, 13. [Google Scholar] [CrossRef]
- McBrayer, S.K.; Mayers, J.R.; DiNatale, G.J.; Shi, D.D.; Khanal, J.; Chakraborty, A.A.; Sarosiek, K.A.; Briggs, K.J.; Robbins, A.K.; Sewastianik, T.; et al. Transaminase Inhibition by 2-Hydroxyglutarate Impairs Glutamate Biosynthesis and Redox Homeostasis in Glioma. Cell 2018, 175, 101–116.e25. [Google Scholar] [CrossRef] [Green Version]
- Tönjes, M.; Barbus, S.; Park, Y.J.; Wang, W.; Schlotter, M.; Lindroth, A.M.; Pleier, S.V.; Bai, A.H.C.; Karra, D.; Piro, R.M.; et al. BCAT1 Promotes Cell Proliferation through Amino Acid Catabolism in Gliomas Carrying Wild-Type IDH1. Nat. Med. 2013, 19, 901–908. [Google Scholar] [CrossRef] [Green Version]
- Ye, Z.; Wang, S.; Zhang, C.; Zhao, Y. Coordinated Modulation of Energy Metabolism and Inflammation by Branched-Chain Amino Acids and Fatty Acids. Front. Endocrinol. 2020, 11, 617. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.H.; Cho, Y.; Kim, J.H.; Kim, J.; Nam, H.Y.; Kim, S.W.; Son, J. Branched-Chain Amino Acids Sustain Pancreatic Cancer Growth by Regulating Lipid Metabolism. Exp. Mol. Med. 2019, 51, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Schulz, J.A.; Rodgers, L.T.; Kryscio, R.J.; Hartz, A.M.S.; Bauer, B. Characterization and Comparison of Human Glioblastoma Models. BMC Cancer 2022, 22, 844. [Google Scholar] [CrossRef]
- Qi, S.; Liu, Y. Differences in Protein Expression between the U251 and U87 Cell Lines. Turk. Neurosurg. 2016, 27, 894–903. [Google Scholar] [CrossRef] [Green Version]
- Motaln, H.; Koren, A.; Gruden, K.; Ramšak, Ž.; Schichor, C.; Lah, T.T. Heterogeneous Glioblastoma Cell Cross-Talk Promotes Phenotype Alterations and Enhanced Drug Resistance. Oncotarget 2015, 6, 40998–41017. [Google Scholar] [CrossRef] [Green Version]
- Bélanger, M.; Allaman, I.; Magistretti, P.J. Brain Energy Metabolism: Focus on Astrocyte-Neuron Metabolic Cooperation. Cell Metab. 2011, 14, 724–738. [Google Scholar] [CrossRef] [Green Version]
- Bulik, M.; Jancalek, R.; Vanicek, J.; Skoch, A.; Mechl, M. Potential of MR Spectroscopy for Assessment of Glioma Grading. Clin. Neurol. Neurosurg. 2013, 115, 146–153. [Google Scholar] [CrossRef]
- Longhitano, L.; Vicario, N.; Tibullo, D.; Giallongo, C.; Broggi, G.; Caltabiano, R.; Barbagallo, G.M.V.; Altieri, R.; Baghini, M.; Di Rosa, M.; et al. Lactate Induces the Expressions of MCT1 and HCAR1 to Promote Tumor Growth and Progression in Glioblastoma. Front. Oncol. 2022, 12, 871798. [Google Scholar] [CrossRef]
- de Freitas Saito, R.; de Sousa Andrade, L.N.; Bustos, S.O.; Chammas, R. Phosphatidylcholine-Derived Lipid Mediators: The Crosstalk Between Cancer Cells and Immune Cells. Front. Immunol. 2022, 13, 768606. [Google Scholar] [CrossRef] [PubMed]
- Stoica, C.; Ferreira, A.K.; Hannan, K.; Bakovic, M. Bilayer Forming Phospholipids as Targets for Cancer Therapy. Int. J. Mol. Sci. 2022, 23, 5266. [Google Scholar] [CrossRef]
- Minami, N.; Tanaka, K.; Sasayama, T.; Kohmura, E.; Saya, H.; Sampetrean, O. Lactate Reprograms Energy and Lipid Metabolism in Glucose-Deprived Oxidative Glioma Stem Cells. Metabolites 2021, 11, 325. [Google Scholar] [CrossRef] [PubMed]
- Grasmann, G.; Smolle, E.; Olschewski, H.; Leithner, K. Gluconeogenesis in Cancer Cells—Repurposing of a Starvation-Induced Metabolic Pathway? Biochim. Biophys. Acta Rev. Cancer 2019, 1872, 24–36. [Google Scholar] [CrossRef]
- Li, X.; Yang, Y.; Zhang, B.; Lin, X.; Fu, X.; An, Y.; Zou, Y.; Wang, J.-X.; Wang, Z.; Yu, T. Lactate Metabolism in Human Health and Disease. Signal Transduct. Target. Ther. 2022, 7, 305. [Google Scholar] [CrossRef]
- Halestrap, A.P. The SLC16 Gene Family—Structure, Role and Regulation in Health and Disease. Mol. Aspects Med. 2013, 34, 337–349. [Google Scholar] [CrossRef]
- Mendes, C.; Serpa, J. Revisiting Lactate Dynamics in Cancer—A Metabolic Expertise or an Alternative Attempt to Survive? J. Mol. Med. 2020, 98, 1397–1414. [Google Scholar] [CrossRef]
- Martínez-Reyes, I.; Chandel, N.S. Waste Not, Want Not: Lactate Oxidation Fuels the TCA Cycle. Cell Metab. 2017, 26, 803–804. [Google Scholar] [CrossRef] [Green Version]
- Sang, N.; He, D.; Qie, S. Glutamine Metabolism in Cancer Cells. In Reference Module in Biomedical Sciences; Elsevier: Amsterdam, The Netherlands, 2018. [Google Scholar]
- Kohlmeier, M. Glutamine. In Nutrient Metabolism; Elsevier: Amsterdam, The Netherlands, 2003; pp. 280–288. [Google Scholar]
- Walker, M.C.; van der Donk, W.A. The Many Roles of Glutamate in Metabolism. J. Ind. Microbiol. Biotechnol. 2016, 43, 419–430. [Google Scholar] [CrossRef] [Green Version]
- Snaebjornsson, M.T.; Janaki-Raman, S.; Schulze, A. Greasing the Wheels of the Cancer Machine: The Role of Lipid Metabolism in Cancer. Cell Metab. 2020, 31, 62–76. [Google Scholar] [CrossRef] [PubMed]
- Yoo, H.C.; Yu, Y.C.; Sung, Y.; Han, J.M. Glutamine Reliance in Cell Metabolism. Exp. Mol. Med. 2020, 52, 1496–1516. [Google Scholar] [CrossRef]
- He, W.; Wu, G. Oxidation of Amino Acids, Glucose, and Fatty Acids as Metabolic Fuels in Enterocytes of Developing Pigs. Amino Acids 2022, 54, 1025–1039. [Google Scholar] [CrossRef]
- Altman, B.J.; Stine, Z.E.; Dang, C.V. From Krebs to Clinic: Glutamine Metabolism to Cancer Therapy. Nat. Rev. Cancer 2016, 16, 619–634. [Google Scholar] [CrossRef] [Green Version]
- van der Veen, J.N.; Kennelly, J.P.; Wan, S.; Vance, J.E.; Vance, D.E.; Jacobs, R.L. The Critical Role of Phosphatidylcholine and Phosphatidylethanolamine Metabolism in Health and Disease. Biochim. Biophys. Acta Biomembr. 2017, 1859, 1558–1572. [Google Scholar] [CrossRef]
- Yousf, S.; Sardesai, D.M.; Mathew, A.B.; Khandelwal, R.; Acharya, J.D.; Sharma, S.; Chugh, J. Metabolic Signatures Suggest O-Phosphocholine to UDP-N-Acetylglucosamine Ratio as a Potential Biomarker for High-Glucose and/or Palmitate Exposure in Pancreatic β-Cells. Metabolomics 2019, 15, 55. [Google Scholar] [CrossRef] [PubMed]
- Jones, R.; Morris, M. Monocarboxylate Transporters: Therapeutic Targets and Prognostic Factors in Disease. Clin. Pharmacol. Ther. 2016, 100, 454–463. [Google Scholar] [CrossRef] [Green Version]
- Parik, S.; Fernández-García, J.; Lodi, F.; De Vlaminck, K.; Derweduwe, M.; De Vleeschouwer, S.; Sciot, R.; Geens, W.; Weng, L.; Bosisio, F.M.; et al. GBM Tumors Are Heterogeneous in Their Fatty Acid Metabolism and Modulating Fatty Acid Metabolism Sensitizes Cancer Cells Derived from Recurring GBM Tumors to Temozolomide. Front. Oncol. 2022, 12, 988872. [Google Scholar] [CrossRef] [PubMed]
- Duman, C.; Di Marco, B.; Nevedomskaya, E.; Ulug, B.; Lesche, R.; Christian, S.; Alfonso, J. Targeting Fatty Acid Oxidation via Acyl-CoA Binding Protein Hinders Glioblastoma Invasion. Cell Death Dis. 2023, 14, 296. [Google Scholar] [CrossRef] [PubMed]
- Pike, L.S.; Smift, A.L.; Croteau, N.J.; Ferrick, D.A.; Wu, M. Inhibition of Fatty Acid Oxidation by Etomoxir Impairs NADPH Production and Increases Reactive Oxygen Species Resulting in ATP Depletion and Cell Death in Human Glioblastoma Cells. Biochim. Biophys. Acta Bioenerg. 2011, 1807, 726–734. [Google Scholar] [CrossRef] [Green Version]
Gene | Protein | Primer Forward | Primer Reverse | |
---|---|---|---|---|
Glucose-dependent pathways | HK2 | HKII | GGAGAGGGGACTTTGATATCG | CGCATCTCTTCCATGTAGCAG |
G6PD | G6PD | GGCAACAGATACAAGAACGTGAAG | GCAGAAGACGTCCAGGATGAG | |
PDHA1 | PDHA | GCTAACCAGGGCCAGATATTC | CTTGTAGTAATCAGTGCTGGC | |
SLC2A1 | GLUT1 | CACGGCCTTCACTGTCGTG | GGACATCCAGGGTAGCTGC | |
SLC16A1 | MCT1 | GCTGGGCAGTGGTAATTGGA | CAGTAATTGATTTGGGAAATGCA | |
SLC16A4 | MCT4 | CACAAGTTCTCCAGTGCCATTG | CGCATCCAGGAGTTTGCCTC | |
Glutamine-dependent pathways | GLS | GLS1 | CTTCTACTTCCAGCTGTGCTC | CACCAGTAATTGGGCAGAAACC |
GLUL | GLNS | GAATGGTCTGAAGTACATCGAGG | GTTAGACGTCGGGCATTGTC | |
SLC1A2 | GLT-1 | GGGATGAACGTCTTAGGTCTG | GGGGAGAGTACCACATGATC | |
SLC1A3 | GLAST | CACCGCTGTCATTGTGGGTAC | CCGCCATTCCTGTGACAAG | |
SLC7A5 | LAT1 | CATCCTCCAGGCTCTTCTTC | CGTCATCACACACGTGAACAC | |
SLC38A1 | SNAT1 | CATTCTATGACAACGTGCAGTCC | CAGCAACAATGACAGCCAGC | |
SLC38A2 | SNAT2 | CTGAGCAATGCGATTGTGGG | CTCCTTCATTGGCAGTCTTC | |
SLC38A3 | SNAT3 | CACAGACAGCATACACCATCC | GACAGGTTGGAGATGTGCTGC | |
Acetoacetate metabolism | OXCT1 | SCOT | GGCCGCTCTTGAGTTTGAGG | CGTGGATATGGACCCAAACC |
ACAT1 | ACAT1 | GTATTGGGTGCAGGCTTACC | CATTGGACATGCTCTCCATCC | |
Lipid metabolism | ACADS | SCAD | CCCTCGATTGTGCTGTGAAC | GCCAACTTGAACTGGATGACC |
ACADM | MCAD | GCTACTTGTAGAGCACCAAGC | CCAAGCTGCTCTCTGGTAAC | |
FASN | FAS | GCTCGGCATGGCTATCTTC | GGAACACCGTGCACTTGAGG | |
Housekeeping | HPRT | HPRT | TGACACTGGCAAAACAATGCA | GGTCGTTTTTCACCAGCAAGCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martins, F.; van der Kellen, D.; Gonçalves, L.G.; Serpa, J. Metabolic Profiles Point Out Metabolic Pathways Pivotal in Two Glioblastoma (GBM) Cell Lines, U251 and U-87MG. Biomedicines 2023, 11, 2041. https://doi.org/10.3390/biomedicines11072041
Martins F, van der Kellen D, Gonçalves LG, Serpa J. Metabolic Profiles Point Out Metabolic Pathways Pivotal in Two Glioblastoma (GBM) Cell Lines, U251 and U-87MG. Biomedicines. 2023; 11(7):2041. https://doi.org/10.3390/biomedicines11072041
Chicago/Turabian StyleMartins, Filipa, David van der Kellen, Luís G. Gonçalves, and Jacinta Serpa. 2023. "Metabolic Profiles Point Out Metabolic Pathways Pivotal in Two Glioblastoma (GBM) Cell Lines, U251 and U-87MG" Biomedicines 11, no. 7: 2041. https://doi.org/10.3390/biomedicines11072041
APA StyleMartins, F., van der Kellen, D., Gonçalves, L. G., & Serpa, J. (2023). Metabolic Profiles Point Out Metabolic Pathways Pivotal in Two Glioblastoma (GBM) Cell Lines, U251 and U-87MG. Biomedicines, 11(7), 2041. https://doi.org/10.3390/biomedicines11072041