A Mitochondrion-Targeting Protein (B2) Primes ROS/Nrf2-Mediated Stress Signals, Triggering Apoptosis and Necroptosis in Lung Cancer
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cancer Cell Culture
2.2. Plasmid Constructions
2.3. Cancer Cells Transfected with Polyethyleneimine and Antioxidant Treatment
2.4. Separation of Mitochondria from B2-Gene-Transfected Cancer Cells
2.5. In Vitro Detection of Relative Hydrogen Peroxide Levels by H2DCFDA
2.6. A549 Human Lung Cancer Cell Xenograft Model in NOD/SCID Mice
2.7. Immunostaining with Antibodies for Tumor Markers
2.8. Analysis of qRT-PCR for Tumor Tissues
2.9. Western Blot Analysis
2.10. Statistical Analysis
3. Results
3.1. Use of a Novel Signaling Peptide in Mitochondrial Targeting
3.2. Triggering of Hydrogen Peroxide/Nrf2-Mediated Stress Signals by B2 Targeting In Vitro
3.3. Blockage of B2-Mediated Nrf2 Stress Signals by Antioxidant NAC, Reducing Antioxidant Enzyme Expression in A549 Cells
3.4. Reducing Solid Tumors in NOD/SCID Mice by B2 Expression
3.5. Reducing B2-Triggering Stress Signals in Solid Tumors in NOD/SCID Mice
3.6. Triggering Two Death Types in p53/Bax and the RIPK3-Mediated Cell Death Pathway
3.7. In Vivo Inhibition of Cancer Marker Expression In Vivo B2 Protein
4. Discussion
4.1. B2 Induces Mitochondrion-Mediated Hydrogen Peroxide/Nrf2 Signals in Lung Cancer Cells
4.2. Why Can B2 Trigger Multiple Signals for Death Control In Vivo?
4.3. Can a B2-Triggering ROS/Nrf-2 Stress Response Regulate Stem Cell Marker Expression In Vivo?
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ball, L.A.; Johnson, K.L. Reverse genetics of nodaviruses. Adv. Virus Res. 1999, 53, 229–244. [Google Scholar] [CrossRef] [PubMed]
- Bovo, G.; Nishizawa, T.; Maltese, C.; Borghesan, F.; Mutinelli, F.; Montesi, F.; De Mas, S. Viral encephalopathy and retinopathy of farmed marine fish species in Italy. Virus Res. 1999, 63, 143–146. [Google Scholar] [CrossRef] [PubMed]
- Mori, K.; Nakai, T.; Muroga, K.; Arimoto, M.; Mushiake, K.; Furusawa, I. Properties of a new virus belonging to nodaviridae found in larval striped jack (Pseudocaranx dentex) with nervous necrosis. Virology 1992, 187, 368–371. [Google Scholar] [CrossRef] [PubMed]
- Munday, B.L.; Kwang, J.; Moody, N. Betanodavirus infections of teleost fish: A review. J. Fish Dis. 2002, 25, 14. [Google Scholar] [CrossRef]
- Delsert, C.; Morin, N.; Comps, M. A fish encephalitis virus that differs from other nodaviruses by its capsid protein processing. Arch. Virol. 1997, 142, 2359–2371. [Google Scholar] [CrossRef]
- Wu, H.C.; Chiu, C.S.; Wu, J.L.; Gong, H.Y.; Chen, M.C.; Lu, M.W.; Hong, J.-R. Zebrafish anti-apoptotic protein zfBcl-xL can block betanodavirus protein alpha-induced mitochondria-mediated secondary necrosis cell death. Fish Shellfish Immunol. 2008, 24, 436–449. [Google Scholar] [CrossRef]
- Iwamoto, T.; Mise, K.; Takeda, A.; Okinaka, Y.; Mori, K.I.; Arimoto, M.; Okuno, T.; Nakai, T. Characterization of Striped jack nervous necrosis virus subgenomic RNA3 and biological activities of its encoded protein B2. J. Gen. Virol. 2005, 86 Pt 10, 2807–2816. [Google Scholar] [CrossRef]
- Su, Y.C.; Wu, J.L.; Hong, J.R. Betanodavirus non-structural protein B2: A novel necrotic death factor that induces mitochondria-mediated cell death in fish cells. Virology 2009, 385, 143–154. [Google Scholar] [CrossRef] [Green Version]
- Chen, L.J.; Su, Y.C.; Hong, J.R. Betanodavirus non-structural protein B1: A novel anti-necrotic death factor that modulates cell death in early replication cycle in fish cells. Virology 2009, 385, 444–454. [Google Scholar] [CrossRef] [Green Version]
- Lu, R.; Maduro, M.; Li, F.; Li, H.W.; Broitman-Maduro, G.; Li, W.X.; Ding, S.W. Animal virus replication and RNAi-mediated antiviral silencing in Caenorhabditis elegans. Nature 2005, 436, 1040–1043. [Google Scholar] [CrossRef]
- Wang, X.H.; Aliyari, R.; Li, W.X.; Li, H.W.; Kim, K.; Carthew, R.; Atkinson, P.; Ding, S.-W. RNA interference directs innate immunity against viruses in adult Drosophila. Science 2006, 312, 452–454. [Google Scholar] [CrossRef] [Green Version]
- Su, Y.C.; Hong, J.R. Betanodavirus B2 causes ATP depletion-induced cell death via mitochondrial targeting and complex II inhibition in vitro and in vivo. J. Biol. Chem. 2010, 285, 39801–39810. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Su, Y.C.; Chiu, H.W.; Hung, J.C.; Hong, J.R. Beta-nodavirus B2 protein induces hydrogen peroxide production, leading to Drp1-recruited mitochondrial fragmentation and cell death via mitochondrial targeting. Apoptosis 2014, 19, 1457–1470. [Google Scholar] [CrossRef] [Green Version]
- Nourazarian, A.R.; Kangari, P.; Salmaninejad, A. Roles of oxidative stress in the development and progression of breast cancer. Asian Pac. J. Cancer Prev. 2014, 15, 4745–4751. [Google Scholar] [CrossRef] [PubMed]
- Aggarwal, V.; Tuli, H.S.; Varol, A.; Thakral, F.; Yerer, M.B.; Sak, K.; Varol, M.; Jain, A.; Khan, M.A.; Sethi, G. Role of Reactive Oxygen Species in Cancer Progression: Molecular Mechanisms and Recent Advancements. Biomolecules 2019, 9, 735. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morgan, M.J.; Liu, Z.G. Crosstalk of reactive oxygen species and NF-kappaB signaling. Cell Res. 2011, 21, 103–115. [Google Scholar] [CrossRef] [Green Version]
- Puar, Y.R.; Shanmugam, M.K.; Fan, L.; Arfuso, F.; Sethi, G.; Tergaonkar, V. Evidence for the Involvement of the Master Transcription Factor NF-kappaB in Cancer Initiation and Progression. Biomedicines 2018, 6, 82. [Google Scholar] [CrossRef] [Green Version]
- Forrester, S.J.; Kikuchi, D.S.; Hernandes, M.S.; Xu, Q.; Griendling, K.K. Reactive Oxygen Species in Metabolic and Inflammatory Signaling. Circ. Res. 2018, 122, 877–902. [Google Scholar] [CrossRef]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef]
- Selvarajoo, N.; Stanslas, J.; Islam, M.K.; Sagineedu, S.R.; Ho, K.L.; Lim, J.C.W. Pharmacological Modulation of Apoptosis and Autophagy in the Treatment of Pancreatic Cancer. Mini Rev. Med. Chem. 2022, 22, 2581–2595. [Google Scholar] [CrossRef]
- Kung, G.; Konstantinidis, K.; Kitsis, R.N. Programmed necrosis, not apoptosis, in the heart. Circ. Res. 2011, 108, 1017–1036. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, J.; Kroemer, G. Alternative cell death mechanisms in development and beyond. Genes Dev. 2010, 24, 2592–2602. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, R.; Letai, A.; Sarosiek, K. Regulation of apoptosis in health and disease: The balancing act of BCL-2 family proteins. Nat. Rev. Mol. Cell Biol. 2019, 20, 175–193. [Google Scholar] [CrossRef] [PubMed]
- Teng, X.; Degterev, A.; Jagtap, P.; Xing, X.; Choi, S.; Denu, R.; Yuan, J.; Cuny, G.D. Structure-activity relationship study of novel necroptosis inhibitors. Bioorg. Med. Chem. Lett. 2005, 15, 5039–5044. [Google Scholar] [CrossRef]
- Cho, Y.S.; Park, H.L. Exploitation of necroptosis for treatment of caspase-compromised cancers. Oncol. Lett. 2017, 14, 1207–1214. [Google Scholar] [CrossRef] [Green Version]
- Li, C.M.; Haratipour, P.; Lingeman, R.G.; Perry, J.J.P.; Gu, L.; Hickey, R.J.; Malkas, L.H. Novel Peptide Therapeutic Approaches for Cancer Treatment. Cells 2021, 10, 2908. [Google Scholar] [CrossRef]
- Chiangjong, W.; Chutipongtanate, S.; Hongeng, S. Anticancer peptide: Physicochemical property, functional aspect and trend in clinical application (Review). Int. J. Oncol. 2020, 57, 678–696. [Google Scholar] [CrossRef]
- Xie, M.; Liu, D.; Yang, Y. Anti-cancer peptides: Classification, mechanism of action, reconstruction and modification. Open Biol. 2020, 10, 200004. [Google Scholar] [CrossRef]
- Chiu, H.W.; Su, Y.C.; Hong, J.R. Betanodavirus B2 protein triggers apoptosis and necroptosis in lung cancer cells that suppresses autophagy. Oncotarget 2017, 8, 94129–94141. [Google Scholar] [CrossRef] [Green Version]
- Longo, P.A.; Kavran, J.M.; Kim, M.S.; Leahy, D.J. Transient mammalian cell transfection with polyethylenimine (PEI). Methods Enzymol. 2013, 529, 227–240. [Google Scholar] [CrossRef]
- Yang, W.; Lam, P.; Kitching, R.; Kahn, H.J.; Yee, A.; Aubin, J.E.; Seth, A. Breast cancer metastasis in a human bone NOD/SCID mouse model. Cancer Biol. Ther. 2007, 6, 1289–1294. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chang, C.-C.; Huang, P.-S.; Lin, H.-R.; Lu, C.-H. Transactivation of Protein Expression by Rice HSP101 in Planta and Using Hsp101 as a Selection Marker for Transformation. Plant Cell Physiol. 2007, 48, 1098–1107. [Google Scholar] [CrossRef] [PubMed]
- Herreros-Pomares, A.; de-Maya-Girones, J.D.; Calabuig-Farinas, S.; Lucas, R.; Martinez, A.; Pardo-Sanchez, J.M.; Alonso, S.; Blasco, A.; Guijarro, R.; Martorell, M.; et al. Lung tumorspheres reveal cancer stem cell-like properties and a score with prognostic impact in resected non-small-cell lung cancer. Cell Death Dis. 2019, 10, 660. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barzegar Behrooz, A.; Syahir, A.; Ahmad, S. CD133: Beyond a cancer stem cell biomarker. J. Drug Target. 2019, 27, 257–269. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rege, T.A.; Hagood, J.S. Thy-1 as a regulator of cell-cell and cell-matrix interactions in axon regeneration, apoptosis, adhesion, migration, cancer, and fibrosis. FASEB J. 2006, 20, 1045–1054. [Google Scholar] [CrossRef] [Green Version]
- Sauzay, C.; Voutetakis, K.; Chatziioannou, A.; Chevet, E.; Avril, T. CD90/Thy-1, a Cancer-Associated Cell Surface Signaling Molecule. Front. Cell Dev. Biol. 2019, 7, 66. [Google Scholar] [CrossRef] [Green Version]
- Turner, B.M.; Cagle, P.T.; Sainz, I.M.; Fukuoka, J.; Shen, S.S.; Jagirdar, J. Napsin A, a new marker for lung adenocarcinoma, is complementary and more sensitive and specific than thyroid transcription factor 1 in the differential diagnosis of primary pulmonary carcinoma: Evaluation of 1674 cases by tissue microarray. Arch. Pathol. Lab. Med. 2012, 136, 163–171. [Google Scholar] [CrossRef]
- Yatabe, Y.; Dacic, S.; Borczuk, A.C.; Warth, A.; Russell, P.A.; Lantuejoul, S.; Beasley, M.B.; Thunnissen, E.; Pelosi, G.; Rekhtman, N.; et al. Best Practices Recommendations for Diagnostic Immunohistochemistry in Lung Cancer. J. Thorac. Oncol. 2019, 14, 377–407. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Yi, J. Cancer cell killing via ROS: To increase or decrease, that is the question. Cancer Biol. Ther. 2008, 7, 1875–1884. [Google Scholar] [CrossRef]
- Chio, I.I.C.; Tuveson, D.A. ROS in Cancer: The Burning Question. Trends Mol. Med. 2017, 23, 411–429. [Google Scholar] [CrossRef]
- He, L.; He, T.; Farrar, S.; Ji, L.; Liu, T.; Ma, X. Antioxidants Maintain Cellular Redox Homeostasis by Elimination of Reactive Oxygen Species. Cell Physiol. Biochem. 2017, 44, 532–553. [Google Scholar] [CrossRef] [PubMed]
- Conklin, K.A. Chemotherapy-associated oxidative stress: Impact on chemotherapeutic effectiveness. Integr. Cancer Ther. 2004, 3, 294–300. [Google Scholar] [CrossRef] [PubMed]
- de Sa Junior, P.L.; Camara, D.A.D.; Porcacchia, A.S.; Fonseca, P.M.M.; Jorge, S.D.; Araldi, R.P.; Ferreira, A.K. The Roles of ROS in Cancer Heterogeneity and Therapy. Oxid. Med. Cell. Longev. 2017, 2017, 2467940. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lane, D.P. Cancer. p53, guardian of the genome. Nature 1992, 358, 15–16. [Google Scholar] [CrossRef]
- Prives, C. Signaling to p53: Breaking the MDM2-p53 circuit. Cell 1998, 95, 5–8. [Google Scholar] [CrossRef] [Green Version]
- Kubbutat, M.H.; Jones, S.N.; Vousden, K.H. Regulation of p53 stability by Mdm2. Nature 1997, 387, 299–303. [Google Scholar] [CrossRef]
- Shay, J.W.; Wright, W.E.; Werbin, H. Defining the molecular mechanisms of human cell immortalization. Biochim. Biophys. Acta 1991, 1072, 1–7. [Google Scholar] [CrossRef]
- Nikoletopoulou, V.; Markaki, M.; Palikaras, K.; Tavernarakis, N. Crosstalk between apoptosis, necrosis and autophagy. Biochim. Biophys. Acta 2013, 1833, 3448–3459. [Google Scholar] [CrossRef] [Green Version]
- Prives, C.; Hall, P.A. The p53 pathway. J. Pathol. 1999, 187, 112–126. [Google Scholar] [CrossRef]
- Werness, B.A.; Levine, A.J.; Howley, P.M. Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science 1990, 248, 76–79. [Google Scholar] [CrossRef]
- Marei, H.E.; Althani, A.; Afifi, N.; Hasan, A.; Caceci, T.; Pozzoli, G.; Morrione, A.; Giordano, A.; Cenciarelli, C. p53 signaling in cancer progression and therapy. Cancer Cell Int. 2021, 21, 703. [Google Scholar] [CrossRef] [PubMed]
- Vogelstein, B.; Kinzler, K.W. p53 function and dysfunction. Cell 1992, 70, 523–526. [Google Scholar] [CrossRef] [PubMed]
- Bond, J.; Haughton, M.; Blaydes, J.; Gire, V.; Wynford-Thomas, D.; Wyllie, F. Evidence that transcriptional activation by p53 plays a direct role in the induction of cellular senescence. Oncogene 1996, 13, 2097–2104. [Google Scholar] [PubMed]
- Levine, A.J. p53, the cellular gatekeeper for growth and division. Cell 1997, 88, 323–331. [Google Scholar] [CrossRef] [Green Version]
- Vousden, K.H. p53: Death star. Cell 2000, 103, 691–694. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Levine, A.J.; Hu, W.; Feng, Z. The P53 pathway: What questions remain to be explored? Cell Death Differ. 2006, 13, 1027–1036. [Google Scholar] [CrossRef]
- Gilbertson, R.J.; Rich, J.N. Making a tumour’s bed: Glioblastoma stem cells and the vascular niche. Nat. Rev. Cancer 2007, 7, 733–736. [Google Scholar] [CrossRef]
- Plaks, V.; Kong, N.; Werb, Z. The cancer stem cell niche: How essential is the niche in regulating stemness of tumor cells? Cell Stem Cell 2015, 16, 225–238. [Google Scholar] [CrossRef] [Green Version]
- Zhu, T.S.; Costello, M.A.; Talsma, C.E.; Flack, C.G.; Crowley, J.G.; Hamm, L.L.; He, X.; Hervey-Jumper, S.L.; Heth, J.A.; Muraszko, K.M.; et al. Endothelial cells create a stem cell niche in glioblastoma by providing NOTCH ligands that nurture self-renewal of cancer stem-like cells. Cancer Res. 2011, 71, 6061–6072. [Google Scholar] [CrossRef] [Green Version]
- Prager, B.C.; Xie, Q.; Bao, S.; Rich, J.N. Cancer Stem Cells: The Architects of the Tumor Ecosystem. Cell Stem Cell 2019, 24, 41–53. [Google Scholar] [CrossRef]
- Lim, S.D.; Sun, C.; Lambeth, J.D.; Marshall, F.; Amin, M.; Chung, L.; Petros, J.A.; Arnold, R.S. Increased Nox1 and hydrogen peroxide in prostate cancer. Prostate 2005, 62, 200–207. [Google Scholar] [CrossRef] [PubMed]
- Ghavami, S.; Asoodeh, A.; Klonisch, T.; Halayko, A.J.; Kadkhoda, K.; Kroczak, T.J.; Gibson, S.B.; Booy, E.P.; Naderi-Manesh, H.; Los, M. Brevinin-2R(1) semi-selectively kills cancer cells by a distinct mechanism, which involves the lysosomal-mitochondrial death pathway. J. Cell. Mol. Med. 2008, 12, 1005–1022. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cai, J.; Niu, X.; Chen, Y.; Hu, Q.; Shi, G.; Wu, H.; Wang, J.; Yi, J. Emodin-induced generation of reactive oxygen species inhibits RhoA activation to sensitize gastric carcinoma cells to anoikis. Neoplasia 2008, 10, 41–51. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Perillo, B.; Di Donato, M.; Pezone, A.; Di Zazzo, E.; Giovannelli, P.; Galasso, G.; Castoria, G.; Migliaccio, A. ROS in cancer therapy: The bright side of the moon. Exp. Mol. Med. 2020, 52, 192–203. [Google Scholar] [CrossRef] [PubMed]
- Koren, E.; Fuchs, Y. Modes of Regulated Cell Death in Cancer. Cancer Discov. 2021, 11, 245–265. [Google Scholar] [CrossRef]
- Parga, J.A.; Rodriguez-Perez, A.I.; Garcia-Garrote, M.; Rodriguez-Pallares, J.; Labandeira-Garcia, J.L. NRF2 Activation and Downstream Effects: Focus on Parkinson’s Disease and Brain Angiotensin. Antioxidants 2021, 10, 1649. [Google Scholar] [CrossRef]
- Hu, Q.; Ren, J.; Li, G.; Wu, J.; Wu, X.; Wang, G.; Gu, G.; Ren, H.; Hong, Z.; Li, J. The mitochondrially targeted antioxidant MitoQ protects the intestinal barrier by ameliorating mitochondrial DNA damage via the Nrf2/ARE signaling pathway. Cell Death Dis. 2018, 9, 403. [Google Scholar] [CrossRef] [Green Version]
- Amorim, R.; Cagide, F.; Tavares, L.C.; Simões, R.F.; Soares, P.; Benfeito, S.; Baldeiras, I.; Jones, J.G.; Borges, F.; Oliveira, P.J.; et al. Mitochondriotropic antioxidant based on caffeic acid AntiOxCIN(4) activates Nrf2-dependent antioxidant defenses and quality control mechanisms to antagonize oxidative stress-induced cell damage. Free Radic. Biol. Med. 2022, 179, 119–132. [Google Scholar] [CrossRef]
- Panieri, E.; Pinho, S.A.; Afonso, G.J.M.; Oliveira, P.J.; Cunha-Oliveira, T.; Saso, L. NRF2 and Mitochondrial Function in Cancer and Cancer Stem Cells. Cells 2022, 11, 2401. [Google Scholar] [CrossRef]
Group | No | Agents | Dose | Characteristics of Test Drugs | |
---|---|---|---|---|---|
A | A549 | 5 | 5-FU | 20 mg/kg body weight | |
B | A549 | 4 | 0.9% saline | 50 µL | |
C | A549 | 6 | PEI/Flag | 25 µg/25 µg in 50 µL | Agents (PEI, Flag, Flag b2, or Flag ΔB2) are mixed for 30 min at 40 °C and will be stable for 1–2 h at 4 °C |
D | A549 | 5 | PEI/Flag b2 | 25 µg/25 µg in 50 µL | |
E | A549 | 6 | PEI/Flag ΔB2 | 25 µg/25 µg in 50 µL |
Name | Sequence (5′-3′) |
---|---|
p53 Forward primer | AGGGTTAGTTTACAATCAGC |
p53 Reverse primer | GGTAGGTGCAAATGCC |
Bax Forward primer | GGTGCCTCAGGATGCG |
Bax Reverse primer | GGAGTCTGTGTCCACG |
Actin Forward primer | ATCCGCAAAGACCTGT |
Actin Reverse primer | GGGTGTAACGCAACTAAG |
RGNNV B2 Forward primer | ATGGCAAATCCAACAAGC |
RGNNV B2 Reverse primer | CTAGTCCGTCTCCATCGGCT |
Ripk3 Forward primer | GACTCCCGGCTTAGAAGGACT |
Ripk3 Reverse primer | CTGCTCTTGAGCTGAGACAGG |
Catalase Forward primer | AACTGGGATCTTGTGGGAA |
Catalase Reverse primer | GACAGTTCACAGGTATCTG |
Cu/Zn Forward primer | GCGACGAAGGCCGTGTGCGTTG |
Cu/Zn Reverse primer | TGTGCGGCCAATGATGCAATG |
Mn Forward primer | CGACCTGCCCTACGACTACGG |
Mn Reverse primer | CAAGCCAACCCCAACCTGAGC |
Nrf2 Forward primer | ACACGGTCCACAGCTCATC |
Nrf2 Reverse primer | TGTCAATCAAATCCATGTCCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chiu, H.-W.; Hung, S.-W.; Chiu, C.-F.; Hong, J.-R. A Mitochondrion-Targeting Protein (B2) Primes ROS/Nrf2-Mediated Stress Signals, Triggering Apoptosis and Necroptosis in Lung Cancer. Biomedicines 2023, 11, 186. https://doi.org/10.3390/biomedicines11010186
Chiu H-W, Hung S-W, Chiu C-F, Hong J-R. A Mitochondrion-Targeting Protein (B2) Primes ROS/Nrf2-Mediated Stress Signals, Triggering Apoptosis and Necroptosis in Lung Cancer. Biomedicines. 2023; 11(1):186. https://doi.org/10.3390/biomedicines11010186
Chicago/Turabian StyleChiu, Hsuan-Wen, Shao-Wen Hung, Ching-Feng Chiu, and Jiann-Ruey Hong. 2023. "A Mitochondrion-Targeting Protein (B2) Primes ROS/Nrf2-Mediated Stress Signals, Triggering Apoptosis and Necroptosis in Lung Cancer" Biomedicines 11, no. 1: 186. https://doi.org/10.3390/biomedicines11010186
APA StyleChiu, H.-W., Hung, S.-W., Chiu, C.-F., & Hong, J.-R. (2023). A Mitochondrion-Targeting Protein (B2) Primes ROS/Nrf2-Mediated Stress Signals, Triggering Apoptosis and Necroptosis in Lung Cancer. Biomedicines, 11(1), 186. https://doi.org/10.3390/biomedicines11010186