Exenatide and Dapagliflozin Combination Enhances Sertoli Cell Secretion of Key Metabolites for Spermatogenesis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Sertoli Cell Culture
2.3. Experimental Groups
2.4. Cell Proliferation Assay
2.5. MTT Assay
2.6. Reverse Transcriptase Polymerase Chain Reaction
2.7. Protein Extraction
2.8. Intracellular Lactate Dehydrogenase Activity Assay
2.9. Western Blot
2.10. Nuclear Magnetic Resonance Spectroscopy
2.11. Mitochondrial Membrane Potential
2.12. Cellular Glycogen Content Assay
2.13. Oil Red O Staining
2.14. Statistical Analysis
3. Results
3.1. GLP-1 Receptor and SGLT2 Are Expressed by Sertoli Cells
3.2. Exposure to Exenatide and/or Dapagliflozin Affects Neither Sertoli Cell Proliferation Nor Metabolic Viability
3.3. Combined Treatment of Exenatide plus Dapagliflozin Increases Glucose Consumption by Sertoli Cells
3.4. Combined Treatment of Exenatide plus Dapagliflozin Increased Lactate Production in Sertoli Cells
3.5. Combined Exposure to Pharmacological Concentrations of Exenatide and Dapagliflozin Increased Alanine Production and Restored Acetate Production by Sertoli Cells
3.6. Sub-Pharmacological Concentrations of Exenatide Decreased Mitochondrial Membrane Potential in Sertoli Cells
3.7. Exposure to Supra-Pharmacological Concentration of Dapagliflozin Decreases Lipid Accumulation in Sertoli Cells
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Introduction: Standards of Medical Care in Diabetes-2020. Diabetes Care 2020, 43, S1–S2. [CrossRef] [PubMed] [Green Version]
- Riobo Servan, P. Obesity and diabetes. Nutr. Hosp. 2013, 28, 138–143. [Google Scholar] [CrossRef] [PubMed]
- Whitmore, C. Type 2 diabetes and obesity in adults. Br. J. Nurs. 2010, 19, 882–886. [Google Scholar] [CrossRef] [PubMed]
- Meneses, M.J.; Silva, B.M.; Sousa, M.; Sa, R.; Oliveira, P.F.; Alves, M.G. Antidiabetic Drugs: Mechanisms of Action and Potential Outcomes on Cellular Metabolism. Curr. Pharm. Des. 2015, 21, 3606–3620. [Google Scholar] [CrossRef]
- Nakamura, N.; Matsui, T.; Ishibashi, Y.; Yamagishi, S.-I. Insulin stimulates SGLT2-mediated tubular glucose absorption via oxidative stress generation. Diabetol. Metab. Syndr. 2015, 7, 48. [Google Scholar] [CrossRef] [Green Version]
- DeFronzo, R.A.; Hompesch, M.; Kasichayanula, S.; Liu, X.; Hong, Y.; Pfister, M.; Morrow, L.A.; Leslie, B.R.; Boulton, D.W.; Ching, A.; et al. Characterization of renal glucose reabsorption in response to dapagliflozin in healthy subjects and subjects with type 2 diabetes. Diabetes Care 2013, 36, 3169–3176. [Google Scholar] [CrossRef] [Green Version]
- Frías, J.P.; Guja, C.; Hardy, E.; Ahmed, A.; Dong, F.; Öhman, P.; Jabbour, S.A. Exenatide once weekly plus dapagliflozin once daily versus exenatide or dapagliflozin alone in patients with type 2 diabetes inadequately controlled with metformin monotherapy (DURATION-8): A 28 week, multicentre, double-blind, phase 3, randomised controlled trial. Lancet Diabetes Endocrinol. 2016, 4, 1004–1016. [Google Scholar] [CrossRef]
- Yang, W.; Ma, J.; Li, Y.; Li, Y.; Zhou, Z.; Kim, J.H.; Zhao, J.; Ptaszynska, A. Dapagliflozin as add-on therapy in Asian patients with type 2 diabetes inadequately controlled on insulin with or without oral antihyperglycemic drugs: A randomized controlled trial. J. Diabetes 2018, 10, 589–599. [Google Scholar] [CrossRef]
- Ma, X.; Guan, Y.; Hua, X. Glucagon-like peptide 1-potentiated insulin secretion and proliferation of pancreatic beta-cells. J. Diabetes 2014, 6, 394–402. [Google Scholar] [CrossRef]
- Jabbour, S.A.; Frías, J.P.; Hardy, E.; Ahmed, A.; Wang, H.; Öhman, P.; Guja, C. Safety and efficacy of exenatide once weekly plus dapagliflozin once daily versus exenatide or dapagliflozin alone in patients with type 2 diabetes inadequately controlled with metformin monotherapy: 52-week results of the DURATION-8 randomized controlled trial. Diabetes care 2018, 41, 2136–2146. [Google Scholar]
- Jabbour, S.A.; Frías, J.P.; Guja, C.; Hardy, E.; Ahmed, A.; Öhman, P. Effects of exenatide once weekly plus dapagliflozin, exenatide once weekly, or dapagliflozin, added to metformin monotherapy, on body weight, systolic blood pressure, and triglycerides in patients with type 2 diabetes in the DURATION-8 study. Diabetes Obes. Metab. 2018, 20, 1515–1519. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lundkvist, P.; Sjostrom, C.D.; Amini, S.; Pereira, M.J.; Johnsson, E.; Eriksson, J.W. Dapagliflozin once-daily and exenatide once-weekly dual therapy: A 24-week randomized, placebo-controlled, phase II study examining effects on body weight and prediabetes in obese adults without diabetes. Diabetes Obes. Metab. 2017, 19, 49–60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- La Vignera, S.; Condorelli, R.; Vicari, E.; D’Agata, R.; Calogero, A.E. Diabetes mellitus and sperm parameters. J. Androl. 2012, 33, 145–153. [Google Scholar] [CrossRef] [PubMed]
- Alves, M.G.; Dias, T.R.; Silva, B.M.; Oliveira, P.F. Metabolic cooperation in testis as a pharmacological target: From disease to contraception. Curr. Mol. Pharmacol. 2014, 7, 83–95. [Google Scholar] [CrossRef] [Green Version]
- Braga, P.C.; Pereira, S.C.; Ribeiro, J.C.; Sousa, M.; Monteiro, M.P.; Oliveira, P.F.; Alves, M.G. Late-onset hypogonadism and lifestyle-related metabolic disorders. Andrology 2020, 8, 1530–1538. [Google Scholar] [CrossRef]
- Meneses, M.J.; Bernardino, R.L.; Sa, R.; Silva, J.; Barros, A.; Sousa, M.; Silva, B.M.; Oliveira, P.F.; Alves, M.G. Pioglitazone increases the glycolytic efficiency of human Sertoli cells with possible implications for spermatogenesis. Int. J. Biochem. Cell Biol. 2016, 79, 52–60. [Google Scholar] [CrossRef]
- Alves, M.G.; Martins, A.D.; Vaz, C.V.; Correia, S.; Moreira, P.I.; Oliveira, P.F.; Socorro, S. Metformin and male reproduction: Effects on Sertoli cell metabolism. Br. J. Pharmacol. 2014, 171, 1033–1042. [Google Scholar] [CrossRef] [Green Version]
- Boulton, D.W.; Kasichayanula, S.; Keung, C.F.; Arnold, M.E.; Christopher, L.J.; Xu, X.S.; Lacreta, F. Simultaneous oral therapeutic and intravenous (1)(4)C-microdoses to determine the absolute oral bioavailability of saxagliptin and dapagliflozin. Br. J. Clin. Pharmacol. 2013, 75, 763–768. [Google Scholar] [CrossRef] [Green Version]
- Knop, F.K.; Bronden, A.; Vilsboll, T. Exenatide: Pharmacokinetics, clinical use, and future directions. Expert Opin. Pharmacother. 2017, 18, 555–571. [Google Scholar] [CrossRef] [Green Version]
- Orellana, E.A.; Kasinski, A.L. Sulforhodamine B (SRB) Assay in Cell Culture to Investigate Cell Proliferation. Bio Protoc. 2016, 6, e1984. [Google Scholar] [CrossRef] [Green Version]
- van Meerloo, J.; Kaspers, G.J.; Cloos, J. Cell sensitivity assays: The MTT assay. Methods Mol. Biol. 2011, 731, 237–245. [Google Scholar] [CrossRef] [PubMed]
- Alves, M.G.; Machado, N.G.; Sardão, V.A.; Carvalho, R.A.; Oliveira, P.J. Anti-apoptotic protection afforded by cardioplegic celsior and histidine buffer solutions to hearts subjected to ischemia and ischemia/reperfusion. J. Cell. Biochem. 2011, 112, 3872–3881. [Google Scholar] [CrossRef] [PubMed]
- Alves, M.; Neuhaus-Oliveira, A.; Moreira, P.; Socorro, S.; Oliveira, P. Exposure to 2,4-dichlorophenoxyacetic acid alters glucose metabolism in immature rat Sertoli cells. Reprod. Toxicol. 2013, 38, 81–88. [Google Scholar] [CrossRef]
- DuBois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.A.; Smith, F. Colorimetric Method for Determination of Sugars and Related Substances. Anal. Chem. 1956, 28, 350–356. [Google Scholar] [CrossRef]
- Ge, X.; Pan, P.; Jing, J.; Hu, X.; Chen, L.; Qiu, X.; Ma, R.; Jueraitetibaike, K.; Huang, X.; Yao, B. Rosiglitazone ameliorates palmitic acid-induced cytotoxicity in TM4 Sertoli cells. Reprod. Biol. Endocrinol. 2018, 16, 98. [Google Scholar] [CrossRef]
- Martins, A.D.; Monteiro, M.P.; Silva, B.M.; Barros, A.; Sousa, M.; Carvalho, R.A.; Oliveira, P.F.; Alves, M.G. Metabolic dynamics of human sertoli cells are differentially modulated by physiological and pharmacological concentrations of glp-1. Toxicol. Appl. Pharmacol. 2019, 362, 1–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, E.; Xu, F.; Liang, H.; Yan, J.; Xu, H.; Li, Z.; Wen, X.; Weng, J. GLP-1 Receptor Agonist Exenatide Attenuates the Detrimental Effects of Obesity on Inflammatory Profile in Testis and Sperm Quality in Mice. Am. J. Reprod. Immunol. 2015, 74, 457–466. [Google Scholar] [CrossRef]
- Chen, J.; Williams, S.; Ho, S.; Loraine, H.; Hagan, D.; Whaley, J.M.; Feder, J.N. Quantitative PCR tissue expression profiling of the human SGLT2 gene and related family members. Diabetes Ther. 2010, 1, 57–92. [Google Scholar] [CrossRef] [Green Version]
- Cho, N.H.; Shaw, J.E.; Karuranga, S.; Huang, Y.; da Rocha Fernandes, J.D.; Ohlrogge, A.W.; Malanda, B. IDF Diabetes Atlas: Global estimates of diabetes prevalence for 2017 and projections for 2045. Diabetes Res. Clin. Pract. 2018, 138, 271–281. [Google Scholar] [CrossRef]
- Li, X.; Zhao, Z.; Li, L.; Zhou, T.; Lu, W. Pharmacokinetics, in vitro and in vivo correlation, and efficacy of exenatide microspheres in diabetic rats. Drug Deliv. 2015, 22, 86–93. [Google Scholar] [CrossRef] [Green Version]
- Kokk, K.; Veräjänkorva, E.; Wu, X.; Tapfer, H.; Poldoja, E.; Pöllänen, P. Immunohistochemical detection of glucose transporters class I subfamily in the mouse, rat and human testis. Medicina 2004, 40, 156–160. [Google Scholar] [PubMed]
- Alves, M.G.; Socorro, S.; Silva, J.; Barros, A.; Sousa, M.; Cavaco, J.E.; Oliveira, P.F. In vitro cultured human Sertoli cells secrete high amounts of acetate that is stimulated by 17beta-estradiol and suppressed by insulin deprivation. Biochim. Biophys. Acta 2012, 1823, 1389–1394. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martins, A.D.; Moreira, A.C.; Sá, R.; Monteiro, M.P.; Sousa, M.; Carvalho, R.A.; Silva, B.M.; Oliveira, P.F.; Alves, M.G. Leptin modulates human Sertoli cells acetate production and glycolytic profile: A novel mechanism of obesity-induced male infertility? Biochim. Biophys. Acta 2015, 1852, 1824–1832. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cao, Y.-Y.; Chen, Z.-W.; Gao, Y.-H.; Wang, X.-X.; Ma, J.-Y.; Chang, S.-F.; Qian, J.-Y.; Ge, J.-B. Exenatide reduces tumor necrosis factor-α-induced apoptosis in cardiomyocytes by alleviating mitochondrial dysfunction. Chin. Med. J. 2015, 128, 3211. [Google Scholar] [CrossRef] [PubMed]
- Danielpur, L.; Sohn, Y.S.; Karmi, O.; Fogel, C.; Zinger, A.; Abu-Libdeh, A.; Israeli, T.; Riahi, Y.; Pappo, O.; Birk, R.; et al. GLP-1-RA Corrects Mitochondrial Labile Iron Accumulation and Improves beta-Cell Function in Type 2 Wolfram Syndrome. J. Clin. Endocrinol. Metab. 2016, 101, 3592–3599. [Google Scholar] [CrossRef]
- O’Donnell, J.M.; Kudej, R.K.; LaNoue, K.F.; Vatner, S.F.; Lewandowski, E.D. Limited transfer of cytosolic NADH into mitochondria at high cardiac workload. Am. J. Physiol. Heart Circ. Physiol. 2004, 286, H2237–H2242. [Google Scholar] [CrossRef] [Green Version]
- Oliveira, P.F.; Martins, A.D.; Moreira, A.C.; Cheng, C.Y.; Alves, M.G. The Warburg effect revisited--lesson from the Sertoli cell. Med. Res. Rev. 2015, 35, 126–151. [Google Scholar] [CrossRef] [Green Version]
- Petersen, C.; Nielsen, M.D.; Andersen, E.S.; Basse, A.L.; Isidor, M.S.; Markussen, L.K.; Viuff, B.M.; Lambert, I.H.; Hansen, J.B.; Pedersen, S.F. MCT1 and MCT4 Expression and Lactate Flux Activity Increase During White and Brown Adipogenesis and Impact Adipocyte Metabolism. Sci. Rep. 2017, 7, 13101. [Google Scholar] [CrossRef]
- Dimmer, K.S.; Friedrich, B.; Lang, F.; Deitmer, J.W.; Bröer, S. The low-affinity monocarboxylate transporter MCT4 is adapted to the export of lactate in highly glycolytic cells. Biochem. J. 2000, 350, 219–227. [Google Scholar] [CrossRef]
- Regueira, M.; Rindone, G.M.; Galardo, M.N.; Pellizzari, E.H.; Cigorraga, S.B.; Meroni, S.B.; Riera, M.F. Germ cells regulate 3-hydroxybutyrate production in rat Sertoli cells. Gen. Comp. Endocrinol. 2017, 248, 5–15. [Google Scholar] [CrossRef] [Green Version]
- Nishitani, S.; Fukuhara, A.; Shin, J.; Okuno, Y.; Otsuki, M.; Shimomura, I. Metabolomic and microarray analyses of adipose tissue of dapagliflozin-treated mice, and effects of 3-hydroxybutyrate on induction of adiponectin in adipocytes. Sci. Rep. 2018, 8, 8805. [Google Scholar] [CrossRef] [PubMed]
- Liebich, H.M. Gas chromatographic profiling of ketone bodies and organic acids in diabetes. J. Chromatogr. B Biomed. Sci. Appl. 1986, 379, 347–366. [Google Scholar] [CrossRef]
- Burke, K.R.; Schumacher, C.A.; Harpe, S.E. SGLT2 Inhibitors: A Systematic Review of Diabetic Ketoacidosis and Related Risk Factors in the Primary Literature. Pharmacotherapy 2017, 37, 187–194. [Google Scholar] [CrossRef] [PubMed]
- Chou, Y.M.; Seak, C.J.; Goh, Z.N.L.; Seak, J.C.; Seak, C.K.; Lin, C.C. Euglycemic diabetic ketoacidosis caused by dapagliflozin: A case report. Medicine 2018, 97, e11056. [Google Scholar] [CrossRef] [PubMed]
- Laffel, L. Ketone bodies: A review of physiology, pathophysiology and application of monitoring to diabetes. Diabetes/Metab. Res. Rev. 1999, 15, 412–426. [Google Scholar] [CrossRef]
- Kurinami, N.; Sugiyama, S.; Yoshida, A.; Hieshima, K.; Miyamoto, F.; Kajiwara, K.; Jinnouch, K.; Jinnouchi, T.; Jinnouchi, H. Dapagliflozin significantly reduced liver fat accumulation associated with a decrease in abdominal subcutaneous fat in patients with inadequately controlled type 2 diabetes mellitus. Diabetes Res. Clin. Pract. 2018, 142, 254–263. [Google Scholar] [CrossRef]
- Rato, L.; Alves, M.G.; Duarte, A.I.; Santos, M.S.; Moreira, P.I.; Cavaco, J.E.; Oliveira, P.F. Testosterone deficiency induced by progressive stages of diabetes mellitus impairs glucose metabolism and favors glycogenesis in mature rat Sertoli cells. Int. J. Biochem. Cell Biol. Title 2015, 66, 1–10. [Google Scholar] [CrossRef]
- Alves, M.G.; Martins, A.D.; Cavaco, J.E.; Socorro, S.; Oliveira, P.F. Diabetes, insulin-mediated glucose metabolism and Sertoli/blood-testis barrier function. Tissue Barriers 2013, 1, e23992. [Google Scholar] [CrossRef] [Green Version]
- Rato, L.; Alves, M.G.; Socorro, S.; Duarte, A.I.; Cavaco, J.E.; Oliveira, P.F. Metabolic regulation is important for spermatogenesis. Nat. Rev. Urol. 2012, 9, 330–338. [Google Scholar] [CrossRef]
- Gorga, A.; Rindone, G.M.; Regueira, M.; Pellizzari, E.H.; Camberos, M.C.; Cigorraga, S.B.; Riera, M.F.; Galardo, M.N.; Meroni, S.B. PPARgamma activation regulates lipid droplet formation and lactate production in rat Sertoli cells. Cell Tissue Res. 2017, 369, 611–624. [Google Scholar] [CrossRef]
- Koska, J.; Sands, M.; Burciu, C.; D’Souza, K.M.; Raravikar, K.; Liu, J.; Truran, S.; Franco, D.A.; Schwartz, E.A.; Schwenke, D.C.; et al. Exenatide Protects Against Glucose- and Lipid-Induced Endothelial Dysfunction: Evidence for Direct Vasodilation Effect of GLP-1 Receptor Agonists in Humans. Diabetes 2015, 64, 2624–2635. [Google Scholar] [CrossRef] [PubMed] [Green Version]








| mRNA | Sequence (5′-3′) | AT (°C) | Amplicon (bp) | Cycles | 
|---|---|---|---|---|
| GLP-1 receptor NM_021332.2 | Sense: GATGCTGCCCTCAAGTGGAT Anti-sense: TAACGAACAGCAGCGGAACT | 61 | 253 | 37 | 
| SGLT2 NM_133254.3 | Sense: ATGGAGCAACACGTAGAGGC Anti-sense: ATGACCAGCAGGAAATAGGCA | 63 | 104 | 35 | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ribeiro, J.C.; Martins, A.D.; Jarak, I.; Carvalho, R.A.; Alves, M.G.; Oliveira, P.F. Exenatide and Dapagliflozin Combination Enhances Sertoli Cell Secretion of Key Metabolites for Spermatogenesis. Biomedicines 2022, 10, 1115. https://doi.org/10.3390/biomedicines10051115
Ribeiro JC, Martins AD, Jarak I, Carvalho RA, Alves MG, Oliveira PF. Exenatide and Dapagliflozin Combination Enhances Sertoli Cell Secretion of Key Metabolites for Spermatogenesis. Biomedicines. 2022; 10(5):1115. https://doi.org/10.3390/biomedicines10051115
Chicago/Turabian StyleRibeiro, João C., Ana D. Martins, Ivana Jarak, Rui A. Carvalho, Marco G. Alves, and Pedro F. Oliveira. 2022. "Exenatide and Dapagliflozin Combination Enhances Sertoli Cell Secretion of Key Metabolites for Spermatogenesis" Biomedicines 10, no. 5: 1115. https://doi.org/10.3390/biomedicines10051115
APA StyleRibeiro, J. C., Martins, A. D., Jarak, I., Carvalho, R. A., Alves, M. G., & Oliveira, P. F. (2022). Exenatide and Dapagliflozin Combination Enhances Sertoli Cell Secretion of Key Metabolites for Spermatogenesis. Biomedicines, 10(5), 1115. https://doi.org/10.3390/biomedicines10051115
 
         
                                                






 
       