Next Article in Journal
ABA and Pre-Harvest Sprouting Differences in Knockout Lines of OsPHS3 Encoding Carotenoid Isomerase via CRISPR/Cas9 in Rice
Next Article in Special Issue
The Establishment of a Highly Efficient In Vitro Regeneration System for Viburnum opulus L. ‘Roseum’
Previous Article in Journal
Function of WAKs in Regulating Cell Wall Development and Responses to Abiotic Stress
Previous Article in Special Issue
Cryopreservation Protocols and the Associated Ultrastructural Changes in Dormant Buds of Vitis amurensis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Integrating Physiology, Transcriptome, and Metabolomics Reveals the Potential Mechanism of Nitric Oxide Concentration-Dependent Regulation of Embryo Germination in Sorbus pohuashanensis

1
State Key Laboratory of Tree Genetics and Breeding, Northeast Forestry University, Harbin 150040, China
2
College of Forestry, Beijing Forestry University, Beijing 100091, China
*
Author to whom correspondence should be addressed.
Plants 2025, 14(3), 344; https://doi.org/10.3390/plants14030344
Submission received: 26 November 2024 / Revised: 31 December 2024 / Accepted: 21 January 2025 / Published: 23 January 2025
(This article belongs to the Special Issue Sexual and Asexual Reproduction in Forest Plants)

Abstract

Nitric oxide (NO) breaks a seed’s dormancy and stimulates germination by signaling. However, the key physiological metabolic pathways and molecular regulatory mechanisms are still unclear. Therefore, this study used physiological, transcriptomic, and metabolomics methods to analyze the key genes and metabolites involved in the NO regulation of plant embryo germination and their potential regulatory mechanisms. The physiological analysis results indicate that the appropriate concentration of NO increased the content of NO and hydrogen peroxide (H2O2) in cells, stimulated the synthesis of ethylene and jasmonic acid (JA), induced a decrease in abscisic acid (ABA) content, antagonistic to the gibberellin (GA3) effect, and promoted embryo germination and subsequent seedling growth. However, the high concentrations of NO caused excessive accumulation of H2O2, destroyed the reactive oxygen species (ROS) balance, and inhibited embryo germination and seedling growth. The combined analysis of transcriptomics and metabolomics showed that the genes related to phenylpropanoid (phenylalanine ammonia-lyase, trans-cinnamate 4-monooxygenase, ferulate-5-hydroxylase, coniferyl-alcohol glucosyltransferase), and flavonoid synthesis (10 genes such as CHS) were significantly up-regulated during embryo germination. The high concentration of exogenous NO inhibited embryo germination by up-regulating the expression of 4-coumaric acid coenzyme A ligase (4CL) and negatively regulating the expression of flavonoid synthesis genes. This suggests that NO concentration-dependently regulates phenylpropanoid and flavonoid biosynthesis, thereby affecting ROS metabolism and hormone levels, and ultimately regulates the dormancy and germination of Sorbus pohuashanensis embryos.

1. Introduction

Sorbus pohuashanensis has a high ornamental value [1]. Its seeds have a deep dormancy [2]. Sodium nitroprusside (SNP) can release NO, which is a potent plant regulatory substance that affects the content and metabolism of ROS and NO in cells under light conditions [3,4,5]. A large number of studies have reported that exogenous NO donor-SNP can relieve seed dormancy and promote germination by increasing NO levels [6,7,8]. However, higher concentrations of exogenous NO may affect the biosynthesis pathway of phenylpropanoids by inhibiting the expression and enzyme activity of some key genes, thereby inhibiting seed germination [9]. Therefore, the concentration of NO is one of the key factors affecting seed dormancy and germination.
NO regulates seed germination with the production of reactive oxygen species (ROS) and reactive nitrogen species (RNS), which is a necessary signal from dormancy to germination [10]. Many studies have confirmed that NO may have dual functions. For example, low concentrations of NO break the embryo dormancy of S. pohuashanensis (Sorbus pohuashanensis) by relying on ethylene synthesis [6]. This hormone-related signaling pathway is closely related to the accumulation of reactive oxygen species and antioxidant defense responses [11,12]. However, a high concentration of NO has a complex effect on seed germination, which can not only promote germination and enhance stress resistance but also may inhibit seed germination due to the high concentration. In addition, the promotion or inhibition of seed germination by NO is related to the role of ROS metabolism-related enzymes [13]. For instance, peroxisomes can produce NO and participate in lipid metabolism, amino acid oxidation, and ROS metabolism [14]. Catalase (CAT) can be activated by phosphorylation, which enhances its catalytic ability to scavenge ROS [15]. The physiological response of seed germination, which is regulated by NO, can be explained by the changes in the transcriptional abundance of enzymatic and non-enzymatic antioxidant defense genes [16,17]. Furthermore, the response and adaptation of plant embryos to NO is a very complex process involving the regulation of numerous genes in different metabolic pathways. NO and ROS can act independently in the same signaling pathway and have similar downstream responses and outcomes, but their internal molecular regulatory mechanisms need to be further investigated [18].
In this work, we used RNA sequencing (RNA-seq) and UPLC-MS/MS technology to provide an integrated map of transcriptomics and metabonomics of S. pohuashanensis embryos to fill the gaps in understanding the gene expression and metabolic regulation during the dormancy release and germination of S. pohuashanensis embryos caused by exogenous NO. We have provided a large body of evidence that the regulation of NO on S. pohuashanensis embryo germination is activated by a combination of gene transcription and metabolic homeostasis, particularly through the regulation of reactive nitrogen species (RNS), ROS, and hormones. These results help us to understand the mechanism of NO concentration-dependent regulation of embryo germination in S. pohuashanensis. It provides a reference for the study of dormancy release and plant seed germination at the multi-omics level.

2. Results

2.1. Phenotypic Concentration-Dependent Response to NO on Embryo Germination of S. pohuashanensis

To help understand how SNP affects the growth of S. pohuashanensis embryos, we used a growth model in which S. pohuashanensis embryos were cultured in 5 mL of a sodium nitroprusside solution (0~100 mmol/L) for 8 days. We used a growth model to culture the embryos of S. pohuashanensis in 5 mL SNP if solution (0~100 mmol/L) for 8 days. The results showed that SNP had a biphasic concentration effect on the dormancy release of S. pohuashanensis seeds. Among them, compared with the control, the 40 mmol/L and 60 mmol/L SNP treatments significantly increased the embryo germination rate of S. pohuashanensis (increased by 28.9% and 39.2%, respectively), while 80 mmol/L and 100 mmol/L SNP treatments decreased by 6.2% and 9.3%, respectively (Figure 1).
At the same time, we also found that, compared with untreated (CK, water), the embryos of S. pohuashanensis treated with 60 mmol/L of SNP (PG for short) germinated faster, the seedlings grew healthily, and the leaves developed well. The embryos of S. pohuashanensis treated with 100 mmol/L of SNP (IG for short) germinated faster in the pre-germination stage, and the seedlings grew poorly and yellowed in the mid-germination stage (Figure 2a). In this study, the germination process was divided into three stages (Figure 2b): pre-germination (0–3 d), mid-germination (3–5 d), and late-germination (5–8 d). During the pre-germination stage, the two cotyledons began to stretch slightly and turned pale green. At the mid-germination stage, the color of the two cotyledons continues to turn green, the opening angle of the cotyledons increases, accompanied by the elongation of the hypocotyl, and the radicle begins to appear. At the late-germination stage, the hypocotyls and radicles elongated rapidly.

2.2. Physiological Response to NO in Embryo Germination of S. pohuashanensis

2.2.1. The Response of NO-Dependent Concentration to RNS During the Embryonic Germination of S. pohuashanensis

To investigate the dynamic changes in physiological responses of S. pohuashanensis embryos during germination, NO content, nitric oxide synthase (NOS), and nitrate reductase activities (NR) were measured at 3 h, 3 d, 5 d, and 8 d after germination. The endogenous NO content increased continuously during the germination of the control embryos (Figure 3a, CK). At the pre-germination and mid-germination stages, the endogenous NO content of the embryos increased after treatment with exogenous NO (PG and IG) (compared to CK) but decreased at the late-germination stage (Figure 3a). At the pre-germination stage (3 h–3 d), PG treatment significantly increased endogenous NOS (Figure 3b) and NR (Figure 3c) activities (compared to CK), and thereafter NOS and NR decreased (but not less than the control). After 3 h of IG treatment, NOS activity was significantly higher than that of CK, and thereafter, there was no significant difference from CK (Figure 3b), while NR activity always showed no significant difference from CK (Figure 3c).

2.2.2. The Response of NO-Dependent Concentration to ROS During the Embryonic Germination of S. pohuashanensis

To investigate the dynamic changes of ROS during germination of the embryo of S. pohuashanensis under different concentrations of NO, the levels of H2O2 and superoxide anions, as well as the activities of the corresponding enzymes, were measured during germination. The content of H2O2 and superoxide anion in CK and PG first increased and then decreased, with PG and IG significantly increasing the content of H2O2 and decreasing the content of superoxide anion in the pre-germination stage (Figure 4a) and the content of H2O2 and superoxide anion in IG was significantly higher than that in CK in the late-germination stage.
During pre-germination, PG significantly increased the activities of enzymes related to reactive oxygen species, such as SOD, POD, and CAT. During the late-germination stage, the activities of POD and CAT were significantly higher in PG-treated embryos than those of CK and IG. In addition to affecting the activity of active oxygen-scavenging enzymes, NO treatment also increased the levels of antioxidant substances (GSH and GSSG) and showed a “ first increasing and then decreasing” trend in the germination process.

2.2.3. The Concentration-Dependent Hormone Response to NO on Embryo Germination of S. pohuashanensis

The levels of ABA, GA3, ACC, and JA were determined to investigate the concentration-dependent regulation of the hormone balance during germination of the embryo S. pohuashanensis (Figure 5). The ABA content of embryos treated with PG and IG was higher than that of the control. GA3/ABA and JA/ABA of Ig treatment were significantly higher than those of CK and PG. With increasing germination time, JA/ABA of IG treatment first decreased and then increased, while CK and PG first increased and then decreased (consistent with the biphasic concentration–response curve).
The results of the correlation analysis showed (Figure 6) that the NO content of S. pohuashanensis embryos had a significant positive correlation with H2O2 and JA and a significant negative correlation with ABA. There was a significant positive correlation between NO content and H2O2 content in S. pohuashanensis embryos. H2O2 was positively correlated with JA, GA3, and ACC and negatively correlated with ABA.

2.3. Summary of Transcriptome Analysis

In this study, we selected embryos treated with CK, PG, and IG at 3 h and 3 d in the pre-germination stage as experimental materials for transcriptome sequencing analysis. A total of 43,304 differentially expressed genes were identified by RNA-seq analysis (clean reads; q30 ≥ 91.76%; see Table 1 for a summary of RNA sequencing data). The GC contents of these sequences were higher than 45.96%, indicating that the sequencing results were of high quality. By pairwise comparison, the differentially expressed genes DEGs were determined between exogenous NO treatments with different concentrations (Figure 7a). Compared to CK-3h, PG-3h and IG-3h up-regulated 2247 and 1355 genes and down-regulated 3083 and 2440 genes, respectively. Compared to CK-3d, PG-3d and IG-3d up-regulated 85 and 183 genes and down-regulated 911 and 143 genes, respectively. Interestingly, the number of differentially expressed genes was significantly higher 3 h after embryo germination was significantly higher than after 3 days. All DEGs are divided into two categories, one grouped by the DEGs in 3 h and the other by the DEGs in 3 d (Figure 7b).

2.4. Differentially Expressed Genes Analysis

The results of KEGG and GO enrichment showed that the non-overlapping DEGs of NO concentration-dependently promoted the embryonic germination of S. pohuashanensis and were significantly enriched in lipid synthesis and metabolism, carbohydrate metabolism, amino acid biosynthesis, and metabolism, while the non-overlapping DEGs of NO-concentration-dependently inhibited the embryonic germination of S. pohuashanensis and were significantly enriched in plant hormone signal transduction, flavonoid biosynthesis, amino acid metabolism, and other pathways (Supplementary Material Figures S1 and S2). In PG-3d compared to CK-3d and IG-3d compared to CK-3d, the NO-dependent, non-overlapping DEGs that promoted embryo germination were significantly enriched in the MAPK signaling pathway, protein processing in the endoplasmic reticulum and plant hormone signaling, while non-overlapping DEGs that inhibited embryo germination were significantly enriched in fructose and mannose metabolism, pentose and glucuronate interconversions, plant hormone signaling transduction, and other pathways.
In summary, we found that exogenous NO can promote seed germination by regulating lipid metabolism, sugar conversion, and carbohydrate metabolism. The DEGs that inhibit germination regulate embryo germination mainly via plant hormone signaling, sugar conversion, and other metabolic pathways.

2.5. Validation of Differentially Expressed Genes by qRT-PCR

There was no significant difference between RNA-Seq and qRT-PCR data of S. pohuashanensis, and the trend was similar. Therefore, it was confirmed that the RNA-Seq data used in this study were reliable (Figure 8).

2.6. Metabolome Analysis

Using metabolomics analysis, the PCA method was used to compare the metabolite peaks detected between 3 h and 3 d after different concentrations of SNP treatment (Figure 9), and samples were separated into PC1 (58.16%) and PC2 (6.81%). The levels of metabolites in the samples of 3 h and 3 d were separated, indicating that there was a significant difference in metabolism between the samples of 3 h and 3 d. The metabolites of PG, IG, and CK in the 3 d samples were separated from each other, but the content of metabolites in the 3 h samples was summarized, indicating that the germination of seeds at the 3 d level changed significantly at the metabolic level. This shows that the transient effect of NO makes the change in transcriptome faster than the change in metabolite level.
Subsequently, the differentially expressed metabolites were identified by comparing three replicate samples treated with different SNP concentrations for 3 h and 3 d (Figure 10). A total of 229 metabolites (120 up-regulated and 109 down-regulated) were screened between PG-3h and CK-3h, 73 metabolites (34 up-regulated and 39 down-regulated) were screened between PG-3d and CK-3d, 198 metabolites (96 up-regulated and 102 down-regulated) were screened between IG-3h and CK-3h, and 132 metabolites (98 up-regulated and 34 down-regulated) between IG-3d and CK-3d.
To analyze the function of DAMs, the major differentially expressed metabolites of NO that concentration-dependently regulate the dormancy of S. pohuashanensis embryos for 3 h, we compared the differentially expressed metabolites of PG vs. CK and IG vs. CK (Supplementary Material Figure S3). In the non-overlapping-differential metabolites of PG-3h vs. CK-3h and IG-3h vs. CK-3h, the differential metabolites of NO concentration-dependently promoted embryo germination of S. pohuashanensis and were mainly enriched in lipid metabolism, biosynthesis of secondary metabolites and biosynthesis of amino acids. The differential metabolites of NO that concentration-dependently inhibited the embryo germination of S. pohuashanensis were mainly enriched in the biosynthesis of flavone and flavonol biosynthesis, amino acid metabolism, and carbohydrate pathways. It is hypothesized that low concentrations of exogenous NO may promote the germination of S. pohuashanensis embryos through the biosynthesis of amino acids. If the concentration of exogenous NO is too high, it may inhibit embryo germination through amino acid metabolism. This is consistent with the results of transcriptomics. In the non-overlapping differential metabolites of PG-3d vs. CK-3d and IG-3d vs. CK-3d, the differential metabolites of NO that concentration-dependently promoted the embryo germination of S. pohuashanensis were mainly enriched in the biosynthesis of secondary metabolites, while the differential metabolites of NO the concentration-dependently inhibited the embryo germination of S. pohuashanensis were mainly enriched in lipid metabolism, biosynthesis of secondary metabolites, amino acid metabolism, and other metabolic pathways. By analyzing different metabolites between 3 h and 3 d, the results showed that for embryos treated with NO for 3 h, DAMs were significantly enriched in phenylpropane and flavonoid biosynthesis, lipid metabolism, and phenylalanine metabolism (also in a concentration-dependent manner). The DAMs treated for 3 days were significantly enriched in flavonoid and flavonol biosynthesis, phenylalanine metabolism, and other metabolic pathways.
These results suggest that changes in metabolite accumulation are strictly controlled by differential gene expression. Flavonoid biosynthesis and phenylpropanoid biosynthesis are considered to be the major metabolic pathways of exogenous NO affecting embryo germination. Therefore, we analyzed the metabolites and crucial genes involved in NO-related metabolic pathways and investigated the mechanism of NO’s concentration-dependent effect on dormancy selection of dormancy and germination of S. pohuashanensis embryos.

2.7. Comprehensive Metabolome and Transcriptome Analysis of Differential Regulation of Key Genes and Metabolites

To further analyze the DEGs and DAMs, we annotated them in the KEGG database and found many joint common pathways (Figure 11). PG-3h vs. CK-3h was enriched in 45 pathways, while IG-3h vs. CK-3h was enriched in 9 pathways. Among these pathways, the flavonoid biosynthetic pathway and the phenylpropanoid biosynthetic pathway were highly enriched pathways under PG and IG treatments. The correlation coefficients of the nine quadrants showed that the differential expression of genes and metabolites was consistent in the third and seventh quadrants (Figure 12). We conclude that these genes are positively correlated with the regulation of metabolites and that the changes in metabolites may be positively regulated by these genes.

2.8. The Role of Differential Genes and Differential Metabolites in Phenylpropanoid Biosynthesis and Flavonoid Biosynthesis Pathways

Considering all the results of the transcriptome and metabolome, we focused on the genes and metabolites that showed significant differences between PG-3h and IG-3h. The results showed that phenylpropanoid and flavonoid genes/metabolites changed significantly after treatment with different concentrations of exogenous NO. We hypothesize that these genes and metabolites may play a different role in the response of PG and IG to pre-embryonic germination.
Therefore, we performed a Pearson correlation analysis on 450 genes and 30 metabolites in the phenylpropanoid and flavonoid biosynthetic pathways and constructed a correlation network diagram of the different genes and the different metabolites. Based on |r| > 0.8, p < 0.05 as the threshold, the regulatory co-expression network was visualized in Cytoscape (Figure 13). The results show that a total of 390 nodes were connected to 1365 edges of PG-3h, and 405 nodes were connected to 1109 edges of IG-3h. In the comparison between PG-3h and CK-3h, there were 62 key gene nodes: 5 key metabolite nodes significantly associated with phenylpropanoid biosynthesis, 11 key gene nodes, 6 key metabolite nodes associated with flavonoid biosynthesis, and 11 key gene nodes involved in both phenylpropanoid biosynthesis and flavonoid biosynthesis. In IG-3h compared to CK-3h, there were 47 key gene nodes: 4 key metabolite nodes related to the phenylpropanoid biosynthetic pathway, 21 key gene nodes, 6 key metabolite nodes involved in flavonoid biosynthesis pathway, and 6 key gene nodes related to both the phenylpropanoid and flavonoid biosynthetic pathway. We hypothesize that these genes and metabolites may play a key role in the response of exogenous NO’s concentration-dependent effects on the release of dormancy in S. pohuashanensis embryos.
Based on the expression patterns of key genes and metabolites, we constructed models for the phenylpropanoid and flavonoid biosynthetic pathways. About 93 key DEGs and 5 DAMs were involved in the phenylpropanoid biosynthetic pathway, and about 37 key DEGs and 6 DAMs were involved in the flavonoid biosynthetic pathway. About 68 major DEGs and 4 DAMs were involved in the phenylpropanoid biosynthetic pathway, and about 27 major DEGs and 6 DAMs were involved in the flavonoid biosynthetic pathway.
Under exogenous NO treatment, a large number of phenylpropanoid biosynthesis genes were upregulated, and their expression levels were significantly higher than those of the control (Figure 14). Compared with CK treatment, PG significantly promoted phenylalanine ammonia-lyase [EC: 4.3.1.24] and trans-cinnamate 4-monooxygenase [EC: 1.14.14.91] in the phenylpropanoid biosynthetic pathway. The expression of ferulate5-hydroxylase [EC: 1.14.-.-] and coniferyl-alcohol glucosyltransferase [EC: 2.4.1.111] was significantly inhibited by IG treatment, while the expression of 4-coumarate-CoA ligase [EC: 6.2.1.12] and coniferyl-alcohol glucosyltransferase [EC: 2.4.1.111] was significantly inhibited by IG treatment. The key metabolites, such as p-coumaric acid, caffeic acid, ferulic acid, and caffeoyl-aldehyde, were down-regulated overall. Therefore, different concentrations of exogenous NO treatment may continue to affect the metabolism of phenylpropanoids. The higher the concentration of exogenous NO, the lower the expression of the metabolites.
Compared to CK-treated embryos, most of the genes involved in flavonoid biosynthesis were upregulated by exogenous NO (Figure 15). With the increase in NO concentration, the expression levels of key genes such as trans-cinnamate 4-monooxygenase, 5-O-(4-coumaroyl)-D-quinate 3‘-monooxygenase, flavonol synthase, and anthocyanidin reductase were decreased. This shows that exogenous NO upregulates the up-regulation of flavonoid synthesis genes, but the higher the concentration, the lower the series of flavonoid synthesis genes.

3. Discussion

3.1. NO Concentration-Dependently Regulates ROS Signaling During Embryo Dormancy Release in S. pohuashanensis

NO is regulated by both environmental and endogenous signaling and has both synergistic and antagonistic effects. It is a free radical that can effectively regulate physiological responses in plant growth and development [19,20,21,22]. Our results showed that PG could promote the embryo germination of S. pohuashanensis, but embryo germination and seedling growth and development were inhibited after IG treatment. This biphasic concentration effect is consistent with previous reports on seed germination in Arabidopsis thaliana (L.) Heynh. [4,23], apple (Malus pumila Mill.) [24], barley (Hordeum vulgare L.) [4], Paulownia elongata S. Y. Hu [25] and many halophytes [26]. At the same time, the NO content in S. pohuashanensis embryos increased after SNP treatment for 3 h, which may be due to the increase in endogenous NO level in embryos by exogenous NO through oxidation or reduction pathway [27] and the increase in NO content may come from enzyme or non-enzyme pathway [28]. The results of Krasuska showed that the transition of apple flowers from dormancy to germination is related to the increase in NOS activity [10]. This is in line with our results. Due to the high activity and instability of NO, the existence of NOS in the context of its synthesis in higher plants is very elusive. Moreover, it is not yet clear at the molecular level how NO concentration regulates embryonic dormancy release and germination [10]. In the stage of pre-germination, in this study, the decrease in nitrate reductase activity caused by high concentrations of nitric oxide may be due to the participation of NR in the synthesis of NO. Exogenous NO controls its production by regulating GSNOR activity and nitrate assimilation to reduce NR activity [19,29,30].
ROS (such as H2O2, superoxide anions, etc.) and NO play a crucial role in regulating the dormancy and germination of plant seeds [31]. Low levels of ROS act as signaling molecules that promote the abrogation of dormancy and trigger seed germination [8]. Excessive accumulation of ROS accumulation can lead to the accumulation of reactive oxygen species in germinated seeds, and the change in the redox state of cells leads to the induction of gene expression [5]. In our results, PG treatment led to a significant increase in hydrogen peroxide content in embryos during embryo dormancy release, which positively regulated embryo germination and seedling morphogenesis. With increasing culture duration, treatment with a high concentration of exogenous NO led to a significantly higher H2O2 content than in the control and PG treatment. In the late stage of germination (8 d), the excessive accumulation of H2O2 in IG-treated S. pohuashanensis embryos destroyed the balance of ROS and affected the growth and development of seedlings in the late stage of seed germination. The ROS content depends not only on the ROS production system but also on the efficiency of the redox feedback mechanism between NO and ROS content [31], such as SOD. Many studies have shown that the activity of antioxidant enzymes increases during seed impregnation [32]. However, in most cases, the activation of the antioxidant system is a late event in the germination process, and the activity of antioxidant enzymes increases in the presence of stress [15]. In our results, the significant increase in SOD, POD, and CAT levels caused by treatment with a high concentration of exogenous NO on day 5 of embryo germination confirmed this point, and the significant changes in POD and CAT activities at the early and late stages of germination depended on the concentration of exogenous NO [14]. It is characterized by the active metabolism of ROS and is a target for NO-mediated PTM [33]. Treatment with PG significantly increased the CAT activity of S. pohuashanensis embryos during germination. Compared with PG, the significant inhibition of CAT by IG might mean that the ability of embryos to remove internal H2O2 is lower, which is closely related to the physiological or adverse processes leading to an increase in oxidative metabolism [14,34]. The effect was significant during embryo dormancy (on the third day of germination). The effect was significant during the dormancy release period of the embryo (the third day of germination). This result is consistent with our previous research results, findings suggesting that NO acts upstream of H2O2, thereby regulating CAT activity [35]. Similar studies in plants have also shown that NO donors can react with superoxide anions and inhibit enzyme activity [14,36].
Studies have shown that the process of cell division depends on the increase in glutathione levels during the transition from germination to seedling growth [37,38,39]. This is consistent with our findings that the appropriate concentration of SNP treatment resulted in an increase in GSH levels during the abrogation of embryonic dormancy. However, the excessive accumulation of GSSG is toxic, and the high concentration of exogenous NO treatment leads to the inhibition of embryonic germination and seedling growth of S. pohuashanensis.

3.2. NO Concentration-Dependently Regulates Hormone Levels During Embryo Dormancy and Germination in S. pohuashanensis

Plant hormones act together with the gas signaling molecules NO and ROS as second messengers to regulate seed germination and seedling growth after germination [5]. Seed germination and dormancy, although mainly dependent on hormone balance, are primarily regulated by abscisic acid, gibberellin, ethylene, and JA by maintaining appropriate ROS/RNS levels [40]. GA3 and ABA are considered to be the most important hormones counteracting the regulation of seed germination [41]. Similar to previous studies, our results also showed that NO concentration regulated ABA content in the embryo throughout seed germination and seedling growth and development. NO significantly promoted embryo germination and seedling growth by causing a decrease in ABA content, which counteracted the effect of GA3. Furthermore, the ABA content of the IG treatment was significantly lower than that of the control, while the GA3 content was significantly higher than that of the control. Our previous study found that NO significantly abolished embryo dormancy in S. pohuashanensis, which was related to the increase in ethylene synthesis [35]. In this experiment, the concentration-dependent effect of NO on endogenous ethylene content was studied. The results showed that IG could significantly promote the increase in ethylene content in the embryo of S. pohuashanensis, which was significantly higher than that of PG treatment. At the same time, in the period of embryonic dormancy, release, seedling growth, and development were significantly higher than that of the control. In this study, it was found that treatment with exogenous NO throughout germination and seedling morphogenesis exogenous NO treatment significantly increased the endogenous JA content of S. pohuashanensis embryos, and the JA content increased with the increase in exogenous NO concentrations. This indicates that NO concentration-dependently stimulated the biosynthesis of JA, which was an important step in the abrogation of embryonic dormancy and late seedling growth and development of S. pohuashanensis by NO. It is well known that JA can regulate multiple adaptive responses of plants to various environmental stresses [42]. In this study, the increase in JA content caused by the high concentration of exogenous NO may be due to the stress response of plants to excessive exogenous NO. However, the JA-mediated protective mechanism of the embryo caused by exogenous NO needs to be further investigated. In addition, in agriculture, plant hormones can regulate the genes encoding NR, NIR, GS, and GOGAT and the activities of corresponding enzymes in the process of NO regulating the absorption and transport of nitrogen by plants, thereby regulating nitrogen assimilation [43].

3.3. NO Concentration-Dependently Regulated the Changes of Key Genes and Metabolites in the Biosynthesis Pathway of Phenylpropanoid and Flavonoid in the Early Stage of Embryo Germination of S. pohuashanensis

We performed a comprehensive analysis of transcriptomes and metabolomes to determine the metabolites and metabolic pathways significantly affected by exogenous NO concentration-dependent regulation at the early stage of S. pohuashanensis embryo germination, especially phenylpropane and flavonoid biosynthesis related to seed germination [44]. Phenylpropanoids make an important contribution to NO regulation of S. pohuashanensis embryo germination. The flavonoids produced by phenylpropanoids have a strong antioxidant capacity and can scavenge ROS [45], protect seeds from oxidative damage, and play an important role in seed germination. Similarly, in our results, the differentially expressed genes in NO concentration-dependently promoted/inhibited embryo germination of S. pohuashanensis and were significantly enriched in the phenylpropanoid biosynthetic pathway. By comparing the nonoverlap of differential genes and differential metabolites in PG-3h vs. CK-3h and IG-3h vs. CK-3h, the specific metabolic pathways of NO’s concentration-dependent regulation of S. pohuashanensis embryos were determined. Our results showed that the differential genes of NO concentration-dependently promoted Sorbus embryo germination and were significantly enriched in the phenylpropanoid and flavonoid biosynthetic pathways. The differential genes of NO that concentration-dependently inhibited embryo germination of S. pohuashanensis were significantly enriched in phenylalanine metabolism and flavonoid and flavonol biosynthesis. The phenylpropanoid biosynthetic pathway begins with phenylalanine metabolism, so a high concentration of exogenous NO in embryo treatment can inhibit the upstream pathway of the phenylpropanoid biosynthetic pathway, thereby inhibiting embryo germination.
The genes related to phenylpropanoid biosynthesis (PAL, CYP73A, F5H, UGT72E) were significantly upregulated by an appropriate concentration of exogenous NO (PG) during the regulation of embryo germination of S. pohuashanensis. PAL is the first step of the phenylpropanoid pathway involved in the synthesis of phenolic compounds, such as phenolic acids, lignin, flavonoids, etc. It plays an important role in the formation of the cell wall and the connection between cells in the process of exogenous NO regulation of germination of S. pohuashanensis embryos [46]. UGT72E is mainly involved in the glycosylation process of phenylpropanoid compounds. In this study, UGT72E was significantly upregulated under PG treatment, but there was no significant difference under IG treatment, suggesting that an appropriate concentration of exogenous NO may affect the structure and function of the cell wall by regulating the glycosylation process and promote the embryo germination of S. pohuashanensis embryo. 4CL (4-coumaric acid-CoA ligase) is an important gene in phenylpropanoid biosynthesis, which affects the biosynthesis of flavonoids and plays an important role in plant physiology and plant protection [46]. In this study, we found that the expression of 4CL was significantly upregulated during embryonic germination of S. pohuashanensis, which is regulated by a high concentration of NO, in contrast to an appropriate concentration of exogenous NO, and that a high concentration of exogenous NO can inhibit embryonic germination by impairing the high expression of 4CL. In conjunction with our previous studies, we found that exogenous NO could significantly increase the ROS content in S. pohuashanensis embryos, suggesting that the reduction of p-coumaric acid, caffeic acid, ferulic acid, and caffeyl-aldehyde can stimulate the accumulation of ROS in S. pohuashanensis embryos, thereby inhibiting the germination of S. pohuashanensis embryos treated with high concentrations of exogenous NO.
Flavonoids are widely distributed secondary metabolites. In this study, embryo germination was influenced by the concentration of key genes and metabolites involved in the flavonoid biosynthetic pathway. CHS is the first reaction step responsible for catalyzing the flavonoid pathway. It is significantly upregulated in NO, dependent on concentration, to promote S. pohuashanensis embryo germination, but the difference is not significant under IG treatment, suggesting that the appropriate concentration of exogenous NO promotes the accumulation of the CHS gene family to promote seed germination. Similar to our results, the abrogation of seed dormancy of Polygonatum sibiricum significantly promoted the germination of the flavonoid biosynthetic pathway [47]. Most of the flavonoid biosynthetic genes were upregulated in the embryos of S. pohuashanensis treated with exogenous NO (Figure 13). However, with increasing NO concentration, the expression of key genes such as CYP73A, C3H, FLS, and ANR decreased. It is suggested that although exogenous NO causes upregulation of flavonoid synthesis genes, the higher the concentration, the lower the expression of a number of flavonoid synthesis genes decreases as the concentration increases. Flavonoids and phenylpropanoids play an important role in the elimination of ROS [48,49]. In this study, the appropriate concentration of exogenous NO treatment could promote germination by upregulating the accumulation of flavonoids and regulating the ROS content, while the higher concentration of exogenous NO negatively regulates the synthesis of flavonoid synthesis genes, thereby inhibiting embryo germination. Interestingly, our analysis of the metabolic results showed that metabolites associated with this pathway were significantly downregulated.

4. Materials and Methods

4.1. Plant Material

In October 2018, ripe berries were collected from adult mother trees of S. pohuashanensis in Maoershan Experimental Forest Farm (127°30′–127°34′ E, 45°21′–45°25′ N) in Shangzhi City, Heilongjiang Province, and the seeds were processed by water selection [50]. The plump, pure, and ripe seeds with a harmless moisture content (9–10%) were put into plastic bags and stored at 0–5 °C. The weight of 1000 seeds, water content, and viability were measured before the experiment and then imbibed in distilled water at 20 °C ± 5 °C for 48 h. After imbibition, the seeds were stirred and soaked in 0.2% (v/v) NaCl solution for 10 min, washed with clean water, and the seed coat was peeled off on ice (S. pohuashanensis is an endosperm-free seed) to obtain the naked embryo out for the experiment [6].

4.2. SNP Pretreatment and Embryo Germination Conditions

A Petri dish with a diameter of 35 mm was placed in the large Petri dish, and a filter paper completely soaked with 5 mL of 0.05 mol·L−1 Hepes-KOH (pH 7.0) was placed on top; 30 stripped embryos were placed on it. Then, the Petri dish with 5 mL of SNP solution (0, 40, 60, 80, or 100 mmol/L) was added to the same Petri dish, and, finally, the large Petri dish was sealed with a preservation film, and each treatment was repeated three times. Gaseous NO is released directly from the donor dish and acts on the embryos in the recipient dish. The embryos were irradiated with 25 °C and 60 μ mol·m−2·S−1 light for 3 h and germinated at16 h of light/8 h of darkness. The germination rate was calculated to determine the optimal SNP concentration after 8 days of germination in the culture room for 8 days. The standard for germination standard is that the cotyledons turn green, and the hypocotyl radicle elongation reaches 2 mm [5]. The calculation method of germination rate was based on the percentage of seed germination to the total number of tested seeds [6].

4.3. Determination of Related Indexes of Active Nitrogen and Active Oxygen

Tissue samples were taken 3 h and 1–8 days after SNP treatment. The relevant indicators of RNS are based on the method of Wang (2023) [6]. A total of 0.1 g fresh samples of embryos or seedlings were extracted and analyzed for RNS and ROS content.

4.4. Determination of Hormone Content (ABA, GA3, ACC, and JA)

Hormone levels (ABA, GA3, ACC, and JA) were detected by enzyme-linked immunosorbent assay (ELISA) with double antibody and one-step sandwich method. The absorbance (OD value) was determined at a wavelength of 450 nm, and the sample concentration was calculated [6,51].

4.5. Transcriptome Analysis

Total RNA was extracted from S. pohuashanensis embryos by ethanol precipitation and the CTAB-PBIOZOL method. After the library construction and detection were qualified, the DNB (DNA Nano Ball) was prepared and then loaded onto the sequencing chip to be sequenced with the high-throughput sequencer. The offline data was filtered to obtain clean data [52], which was sequenced with the reference genome of S. pohuashanensis.

4.6. Metabolomic Analysis

Using vacuum freeze-drying technology, the embryos of S. pohuashanensis were placed in a freeze-drying machine (Scientz-100 F, Scientz Group, Ningbo, China), and the samples were crushed into powder by (MM 400, Retsch, Haan, Germany) type pulverizer. Then, 50 mg of the sample powder was weighed using an electronic balance (MS105DΜ), and 1200 μL of −20 °C pre-cooled 70% methanolic aqueous internal standard extract was added (less than 50 mg at a rate of 1200 μL extractant per 50 mg sample). It was shaken once every 30 min for 30 s, for a total of 6 times. The treated samples were centrifuged and filtered for UPLC-MS/MS analysis.
The subsequent data processing was implemented by the statistical functions prcomp, cor, ComplexHeatmap 2.8.0, and MetaboAnalystR 1.0.1 in the software package R 3.5.1 (www.r-project.org).

4.7. Quantitative Real-Time PCR

To further verify the reliability of the differential expression results of each treatment group in S. pohuashanensis samples, we randomly selected 10 genes for qRT-PCR to verify gene expression changes. Using the actin gene of S. pohuashanensis as an internal reference, 13 target gene (Table 2 for primer information) primers were designed using Primer 6 software, and the relative expression was expressed by 2−ΔΔCt.

4.8. Statistical Analyses

Data from three biological replicates were analyzed using GraphPad Prism 9, Excel 2019, and SPSS 20.0 and are expressed as mean ± SD. Using one-way ANOVA, p < 0.05 was considered significant.

5. Conclusions

This study showed that exogenous NO concentrations affect embryo dormancy and germination of S. pohuashanensis in a biphasic concentration-dependent effect. In seed germination and seedling morphogenesis, appropriate NO concentrations promoted seed germination by increasing NO and H2O2 content, reducing ABA content, and increasing ethylene and JA content in S. pohuashanensis embryos. However, high concentrations of NO can increase the content of NO in S. pohuashanensis embryos. However, high concentrations of NO inhibited the activity of antioxidant enzymes in the embryo of S. pohuashanensis, disrupted the hormone balance of the embryo of S. pohuashanensis, and inhibited seed germination. A comprehensive multi-omics analysis revealed that NO concentration-dependently regulated S. pohuashanensis embryo germination, which was mainly regulated by biological pathways such as phenylpropanoid and flavonoid biosynthesis. Moreover, the biological events that occurred at the transcriptional level were consistent with the phenotype, hormone characteristics, and qRT-PCR analysis. This study provides the major target genes and metabolites of NO in regulating embryo germination of S. pohuashanensis and provides an important basis for the molecular mechanism of NO in seed germination of other Rosaceae plants.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants14030344/s1, Figure S1. KEGG analysis of DEGs during NO-dependent concentration regulation of embryo germination of Sorbus pohuashanensis. (a) KEGG enrichment statistics of PG-3h vs. CK-3h in non-overlapping DEGs of PG-3h vs. CK-3h and IG-3h vs. CK-3h. (b) KEGG enrichment statistics of IG-3h vs. CK-3h in non-overlapping DEGs of PG-3h vs. CK-3h and IG-3h vs. CK-3h. (c) KEGG enrichment statistics of PG-3h vs. CK-3h in non-overlapping DEGs of PG-3h vs. CK-3h and PG-3d vs. CK-3d. (d) KEGG enrichment statistics of PG-3d vs. CK-3d in non-overlapping DEGs of PG-3h vs. CK-3h and PG-3d vs. CK-3d. (e) KEGG enrichment statistics of IG-3h vs. CK-3h in IG-3h vs. CK-3h and IG-3d vs. CK-3d non-overlapping DEGs. (f) KEGG enrichment statistics of IG-3d vs. CK-3d in non-overlapping DEGs of IG-3h vs. CK-3h and IG-3d vs. CK-3d. (g) KEGG enrichment statistics of PG-3d vs. CK-3d in non-overlapping DEGs of PG-3d vs. CK-3d and IG-3d vs. CK-3d. (h) KEGG enrichment statistics of IG-3d vs. CK-3d in non-overlapping DEGs of PG-3d vs. CK-3d and IG-3d vs. CK-3d. Figure S2. GO analysis of DEGs during NO-dependent concentration regulation of embryo germination of Sorbus pohuashanensis. Figure S3. KEGG enrichment analysis of metabonomics in NO-dependent concentration regulation of Sorbus pohuashanensis embryo process.

Author Contributions

L.Y. made the research plan, C.Z. wrote the main manuscript text and prepared Figures, C.Z. and Y.Z. review and editing. L.Y. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work is supported by the National Natural Science Foundation of China (Grant No. 32071757).

Data Availability Statement

The datasets supporting the conclusions of this article are included within the article and its Supplementary Files. All RNA-seq reads were deposited at NCBI (PRJNA1153935).

Acknowledgments

We thank the editors and reviewers for their careful reading and valuable comments. We also thank Kombi Kaviriri David of Northeast Forestry University for proofreading.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Yang, J.; Li, Y.; Li, J.; Yuan, J.; Wang, S.; Zhou, L.; Zhou, L.; Kang, C.; Guo, L. High-throughput Screening of Secondary Metabolites by Sorbus pohuashanensis Cells under Environmental Stress using UHPLC-QTOF Combined with AntDAS. Physiol. Plant. 2021, 173, 2216–2225. [Google Scholar] [CrossRef] [PubMed]
  2. Yang, L.; Liu, C.P.; Shen, H.L. Effect of Cold Stratification Durations and Germination Temperatures on Seed Germination of Sorbus pohuashanensis. Seed 2008, 27, 20–22+25. [Google Scholar] [CrossRef]
  3. Bethke, P.C.; Libourel, I.G.L.; Vitecek, J.; Jones, R.L. Nitric Oxide Methods in Seed Biology in Seed Dormancy. Biochem. Mol. Biol. 2011, 773, 385–400. [Google Scholar] [CrossRef]
  4. Bethke, P.C.; Gubler, F.; Jacobsen, J.V.; Jones, R.L. Dormancy of Arabidopsis seeds and barley grains can be broken by nitric oxide. Planta 2004, 219, 847–885. [Google Scholar] [CrossRef]
  5. Gniazdowska, A.; Krasuska, U.; Czajkowska, K.; Bogatek, R. Nitric oxide, hydrogen cyanide and ethylene are required in the control of germination and undisturbed development of young apple seedlings. Plant Growth Regul. 2010, 61, 75–84. [Google Scholar] [CrossRef]
  6. Wang, Y.T.; Zhao, C.H.; Wang, X.D.; Shen, H.L.; Yang, L. Exogenous Ethylene Alleviates the Inhibition of Sorbus pohuashanensis Embryo Germination in a Saline-Alkali Environment (NaHCO3). Int. J. Mol. Sci. 2023, 24, 4244. [Google Scholar] [CrossRef]
  7. Yang, L.; Shen, H.L.; Liang, L.D.; Liu, C.P. Changes in endogenous hormone content in seeds of Sorbus pohuashanensis (Hance) Hedl. during artificial drying and cold stratification. Plant Physiol. Commun. 2008, 44, 682–688. [Google Scholar]
  8. Li, W.; Niu, Y.; Zheng, Y.; Wang, Z. Advances in the Understanding of Reactive Oxygen Species-Dependent Regulation on Seed Dormancy, Germination, and Deterioration in Crops. Front. Plant Sci. 2022, 13, 826809. [Google Scholar] [CrossRef]
  9. Zhou, Y.B.; Yun, Y.; Su, B.L.; Chen, Z.J.; Liu, L.W. Effects of Exogenous Nitric Oxide Donor on Seed Germination and Seedling Growth of Several Plant Species. Plant Physiol. Commun. 2009, 41, 316–318. [Google Scholar]
  10. Krasuska, U.; Ciacka, K.; Orzechowski, S.; Fettke, J.; Bogatek, R.; Gniazdowska, A. Modification of the endogenous NO level influences apple embryos dormancy by alterations of nitrated and biotinylated protein patterns. Planta 2016, 244, 877–891. [Google Scholar] [CrossRef]
  11. Zhang, Y.; Wang, R.; Wang, X.; Zhao, C.; Shen, H.; Yang, L. Nitric Oxide Regulates Seed Germination by Integrating Multiple Signalling Pathways. Int. J. Mol. Sci. 2023, 24, 9052. [Google Scholar] [CrossRef] [PubMed]
  12. Ciacka, K.; Staszek, P.; Sobczynska, K.; Krasuska, U.; Gniazdowska, A. Nitric Oxide in Seed Biology. Int. J. Mol. Sci. 2022, 23, 14951. [Google Scholar] [CrossRef] [PubMed]
  13. Trapet, P.; Kulik, A.; Lamotte, O.; Jeandroz, S.; Bourque, S.; Nicolas-Francès, V.; Rosnoblet, C.; Besson-Bard, A.; Wendehenne, D. NO signaling in plant immunity: A tale of messengers. Phytochemistry 2015, 112, 72–79. [Google Scholar] [CrossRef] [PubMed]
  14. Corpas, F.J.; del Río, L.A.; Palma, J.M. Impact of Nitric Oxide (NO) on the ROS Metabolism of Peroxisomes. Plants 2019, 8, 37. [Google Scholar] [CrossRef]
  15. Bailly, C. The signalling role of ROS in the regulation of seed germination and dormancy. Biochem. J. 2019, 476, 3019–3032. [Google Scholar] [CrossRef]
  16. González-Gordo, S.; Bautista, R.; Claros, M.G.; Cañas, A.; Palma, J.M.; Corpas, F.J. Nitric oxide-dependent regulation of sweet pepper fruit ripening. J. Exp. Bot. 2019, 70, 4557–4570. [Google Scholar] [CrossRef]
  17. Corpas, F.J.; Freschi, L.; Rodríguez-Ruiz, M.; Mioto, P.T.; González-Gordo, S.; Palma, J.M. Nitro-oxidative metabolism during fruit ripening. J. Exp. Bot. 2018, 69, 3449–3463. [Google Scholar] [CrossRef]
  18. Rodríguez-Ruiz, M.; González-Gordo, S.; Cañas, A.; Campos, M.J.; Paradela, A.; Corpas, F.J.; Palma, J.M. Sweet Pepper (Capsicum annuum L.) Fruits Contain an Atypical Peroxisomal Catalase That Is Modulated by Reactive Oxygen and Nitrogen Species. Antioxidants 2019, 8, 374. [Google Scholar] [CrossRef]
  19. Corpas, F.J.; González-Gordo, S.; Palma, J.M. Protein nitration: A connecting bridge between nitric oxide (NO) and plant stress. Plant Stress 2021, 2, 100026. [Google Scholar] [CrossRef]
  20. Jiang, J.L.; Ren, X.M.; Li, L.; Hou, R.P.; Sun, W.; Jiao, C.J.; Yang, N.; Dong, Y.X. H2S Regulation of Metabolism in Cucumber in Response to Salt-Stress Through Transcriptome and Proteome Analysis. Front. Plant Sci. 2020, 11, 1283. [Google Scholar] [CrossRef]
  21. Goyal, V.; Jhanghel, D.; Mehrotra, S. Emerging Warriors against Salinity in Plants—Nitric Oxide and Hydrogen Sulphide. Physiol. Plant. 2021, 171, 896–908. [Google Scholar] [CrossRef] [PubMed]
  22. Arc, E.; Galland, M.; Godin, B.; Cueff, G.; Rajjou, L. Nitric oxide implication in the control of seed dormancy and germination. Front. Plant Sci. 2013, 4, 346. [Google Scholar] [CrossRef] [PubMed]
  23. Libourel, I.G.L.; Bethke, P.C.; De Michele, R.; Jones, R.L. Nitric oxide gas stimulates germination of dormant Arabidopsis seeds: Use of a flow-through apparatus for delivery of nitric oxide. Planta 2006, 223, 813–820. [Google Scholar] [CrossRef] [PubMed]
  24. Andryka-Dudek, P.; Ciacka, K.; Wiśniewska, A.; Bogatek, R.; Gniazdowska, A. Nitric Oxide-Induced Dormancy Removal of Apple Embryos Is Linked to Alterations in Expression of Genes Encoding ABA and JA Biosynthetic or Transduction Pathways and RNA Nitration. Int. J. Mol. Sci. 2019, 20, 1007. [Google Scholar] [CrossRef] [PubMed]
  25. Liu, J.; Xue, T.; Shen, Y. Effect of Nitric Oxide on Seed Germination and Dormancy in Empress Trees. HortTechnology Hortte 2019, 29, 271–275. [Google Scholar] [CrossRef]
  26. Hussain, S.; Nisar, F.; Bhatt, A.; Nielsen, B.L.; Gul, B.; Hameed, A. Redox priming alleviates dormancy and improves salinity tolerance of seeds and seedlings of medicinal halophyte Zygophyllum simplex L. J. Appl. Res. Med. Aromat. Plants 2022, 30, 100384. [Google Scholar] [CrossRef]
  27. Gupta, K.J.; Fernie, A.R.; Kaiser, W.M.; van Dongen, J.T. On the origins of nitric oxide. Trends Plant Sci. 2011, 16, 160–168. [Google Scholar] [CrossRef]
  28. Ciacka, K.; Krasuska, U.; Otulak-Kozieł, K.; Gniazdowska, A. Dormancy removal by cold stratification increases glutathione and S-nitrosoglutathione content in apple seeds. Plant Physiol. Biochem. 2019, 138, 112–120. [Google Scholar] [CrossRef]
  29. Lopes-Oliveira, P.J.; Oliveira, H.C.; Kolbert, Z.; Freschi, L. The light and dark sides of nitric oxide: Multifaceted roles of NO in plant responses to light. J. Exp. Bot. 2020, 72, 885–903. [Google Scholar] [CrossRef]
  30. Jahnová, J.; Luhová, L.; Petřivalský, M. S-Nitrosoglutathione Reductase—The Master Regulator of Protein S-Nitrosation in Plant NO Signaling. Plants 2019, 8, 48. [Google Scholar] [CrossRef]
  31. Albertos, P.; Tatematsu, K.; Mateos, I.; Sánchez-Vicente, I.; Fernández-Arbaizar, A.; Nakabayashi, K.; Nambara, E.; Godoy, M.; Franco, J.M.; Solano, R.; et al. Redox feedback regulation of ANAC089 signaling alters seed germination and stress response. Cell Rep. 2021, 35, 109263. [Google Scholar] [CrossRef] [PubMed]
  32. Artur, M.A.S.; Faria, J.M.R.; José, A.C.; Lira, J.M.S.; Souza, K.R.D.; Nery, F.C.; Alvarenga, A.A. Dormancy breaking and biochemical processes associated with germination of Erythrina falcata Benth. seeds. CERNE 2023, 29, e-103170. [Google Scholar] [CrossRef]
  33. Sehrawat, A.; Sougrakpam, Y.; Deswal, R. Cold modulated nuclear S-nitrosoproteome analysis indicates redox modulation of novel Brassicaceae specific, myrosinase and napin in Brassica juncea. Environ. Exp. Bot. 2019, 161, 312–333. [Google Scholar] [CrossRef]
  34. Chaki, M.; De Morales, P.Á.; Ruiz, C.; Begara-Morales, J.C.; Barroso, J.B.; Corpas, F.J.; Palma, J.M. Ripening of pepper (Capsicum annuum) fruit is characterized by an enhancement of protein tyrosine nitration. Ann. Bot. 2015, 116, 637–647. [Google Scholar] [CrossRef]
  35. Wang, H.; Tang, S.; Wang, J.; Shen, H.; Yang, L. Interaction between reactive oxygen species and hormones during the breaking of embryo dormancy in Sorbus pohuashanensis by exogenous nitric oxide. J. For. Res. 2022, 33, 435–444. [Google Scholar] [CrossRef]
  36. Clark, D.; Durner, J.; Navarre, D.A.; Klessig, D.F. Nitric Oxide Inhibition of Tobacco Catalase and Ascorbate Peroxidase. Mol. Plant-Microbe Interact. 2000, 13, 1380–1384. [Google Scholar] [CrossRef]
  37. Li, J.; Liu, Y.; Zhang, M.; Xu, H.; Ning, K.; Wang, B.; Chen, M. Melatonin increases growth and salt tolerance of Limonium bicolor by improving photosynthetic and antioxidant capacity. BMC Plant Biol. 2022, 22, 16. [Google Scholar] [CrossRef]
  38. Srivastava, A.K.; Singh, D. Assessment of malathion toxicity on cytophysiological activity, DNA damage and antioxidant enzymes in root of Allium cepa model. Sci. Rep. 2020, 10, 886. [Google Scholar] [CrossRef]
  39. Hussain, Q.; Zheng, M.; Hänninen, H.; Bhalerao, R.P.; Riaz, M.W.; Sajjad, M.; Zhang, R.; Wu, J. Effect of the photoperiod on bud dormancy in Liriodendron chinense. J. Plant Physiol. 2022, 279, 153835. [Google Scholar] [CrossRef]
  40. Bykova, N.V.; Hu, J.; Ma, Z.; Igamberdiev, A.U. The Role of Reactive Oxygen and Nitrogen Species in Bioenergetics, Metabolism, and Signaling During Seed Germination. Agrofor. Syst. 2015, 23, 177–195. [Google Scholar] [CrossRef]
  41. Li, W.; Li, W.F.; Yang, S.J.; Ma, Z.H.; Zhou, Q.; Mao, J.; Han, S.Y.; Chen, B. Transcriptome and Metabolite Conjoint Analysis Reveals that Exogenous Methyl Jasmonate Regulates Monoterpene Synthesis in Grape Berry Skin. J. Agric. Food Chem. 2020, 68, 5270–5281. [Google Scholar] [CrossRef] [PubMed]
  42. Rahman, M.M.; Mostofa, M.G.; Keya, S.S.; Ghosh, P.K.; Abdelrahman, M.; Anik, T.R.; Gupta, A.; Tran, L.P. Jasmonic acid priming augments antioxidant defense and photosynthesis in soybean to alleviate combined heat and drought stress effects. Plant Physiol. Biochem. 2024, 206, 108193. [Google Scholar] [CrossRef] [PubMed]
  43. Xing, J.; Cao, X.; Zhang, M.; Wei, X.; Zhang, J.; Wan, X. Plant nitrogen availability and crosstalk with phytohormones signallings and their biotechnology breeding application in crops. Plant Biotechnol. J. 2023, 21, 1320–1342. [Google Scholar] [CrossRef]
  44. Tong, Y.; Liu, S.Y.; Yi, S.C.; Qiu, Z.X.; Wang, Y.H.; Zeng, D.Q.; Tang, W.W. Bruceine D, the main active ingredient of Brucea javanica (L.) residue inhibits the germination of Bidens pilosa L. seeds by suppressing phenylpropanoid biosynthesis. Ind. Crops Prod. 2021, 172, 114079. [Google Scholar] [CrossRef]
  45. Agati, G.; Brunetti, C.; Di Ferdinando, M.; Ferrini, F.; Pollastri, S.; Tattini, M. Functional roles of flavonoids in photoprotection: New evidence, lessons from the past. Plant Physiol. Biochem. 2013, 72, 35–45. [Google Scholar] [CrossRef]
  46. Chen, X.T.; Zhao, G.Y.; Li, Y.L.; Wei, S.M.; Dong, Y.H.; Jiao, R.Z. Integrative Analysis of the Transcriptome and Metabolome Reveals the Mechanism of Chinese Fir Seed Germination. Forests 2023, 14, 676. [Google Scholar] [CrossRef]
  47. Liu, H.; Chen, X.X.; Chen, H.X.; Lu, J.; Chen, D.L.; Luo, C.; Cheng, X.; Jia, Y.; Huang, C.L. Transcriptome and Metabolome Analyses of the Flowers and Leaves of Chrysanthemum dichrum. Front. Genet. 2021, 12, 716163. [Google Scholar] [CrossRef]
  48. Ahmed, U.; Rao, M.J.; Qi, C.; Xie, Q.; Noushahi, H.A.; Yaseen, M.; Shi, X.; Zheng, B. Expression Profiling of Flavonoid Biosynthesis Genes and Secondary Metabolites Accumulation in Populus under Drought Stress. Molecules 2021, 26, 5546. [Google Scholar] [CrossRef]
  49. Gao, Q.; Li, X.; Xiang, C.; Li, R.; Xie, H.; Liu, J.; Li, X.; Zhang, G.; Yang, S.; Liang, Y.; et al. EbbHLH8o Enhances Salt Responses by Up-Regulating Flavonoid Accumulation and Modulating ROS Levels. Int. J. Mol. Sci. 2023, 24, 11080. [Google Scholar] [CrossRef]
  50. Yang, L.; Shen, H.L. Effect of electrostatic field on seed germination and seedling growth of Sorbus pohuashanesis. J. For. Res. 2011, 22, 27–34. [Google Scholar] [CrossRef]
  51. Wang, X.D.; Shen, H.L.; Yang, L. The Response of Hormones, Reactive Oxygen Species and Nitric Oxide in the Polyethylene-Glycol-Promoted, Salt-Alkali-Stress-Induced Embryo Germination of Sorbus pohuashanensis. Int. J. Mol. Sci. 2024, 25, 5128. [Google Scholar] [CrossRef] [PubMed]
  52. Zhao, D.; Zhang, Y.; Lu, Y.; Fan, L.; Zhang, Z.; Zheng, J.; Chai, M. Genome sequence and transcriptome of Sorbus pohuashanensis provide insights into population evolution and leaf sunburn response. J. Genet. Genom. 2022, 49, 547–558. [Google Scholar] [CrossRef]
Figure 1. Effect of different concentrations of SNP on the embryo germination rate of Sorbus pohuashanensis. (Note: ns means p > 0.05, ** means p ≤ 0.01, **** means p ≤ 0.0001).
Figure 1. Effect of different concentrations of SNP on the embryo germination rate of Sorbus pohuashanensis. (Note: ns means p > 0.05, ** means p ≤ 0.01, **** means p ≤ 0.0001).
Plants 14 00344 g001
Figure 2. Germination model of an embryo of Sorbus pohuashanensis. (a) The phenotype of Sorbus pohuashanensis embryos cultured to day 8 after treatment with different SNP concentrations; (b) There are three stages of embryo germination of Sorbus pohuashanensis: 0–3 d is pre-germination, 3–5 d is mid-germination, and 5–8 d is late-germination.
Figure 2. Germination model of an embryo of Sorbus pohuashanensis. (a) The phenotype of Sorbus pohuashanensis embryos cultured to day 8 after treatment with different SNP concentrations; (b) There are three stages of embryo germination of Sorbus pohuashanensis: 0–3 d is pre-germination, 3–5 d is mid-germination, and 5–8 d is late-germination.
Plants 14 00344 g002
Figure 3. Effect of different concentrations of SNP treatment on the RNA content of Sorbus pohuashanensis embryos. (a) NO content. (b) NOS. (c) NR. Note: Different small letters in the figure indicate significant differences between the different treatments (p < 0.05).
Figure 3. Effect of different concentrations of SNP treatment on the RNA content of Sorbus pohuashanensis embryos. (a) NO content. (b) NOS. (c) NR. Note: Different small letters in the figure indicate significant differences between the different treatments (p < 0.05).
Plants 14 00344 g003
Figure 4. Effect of different SNP concentrations on the content of reactive oxygen species in the embryos of Sorbus pohuashanensis. (a) H2O2 content. (b) superoxide anion formation rate. (c) malondialdehyde content. (d) SOD content. (e) POD content. (f) CAT content. (g) soluble protein content. (h) glutathione (i) glutathione (oxidized). Note: Different small letters in the figure indicate significant differences between the different treatments (p < 0.05).
Figure 4. Effect of different SNP concentrations on the content of reactive oxygen species in the embryos of Sorbus pohuashanensis. (a) H2O2 content. (b) superoxide anion formation rate. (c) malondialdehyde content. (d) SOD content. (e) POD content. (f) CAT content. (g) soluble protein content. (h) glutathione (i) glutathione (oxidized). Note: Different small letters in the figure indicate significant differences between the different treatments (p < 0.05).
Plants 14 00344 g004
Figure 5. Effect of different concentrations of SNP treatment on the hormone content of Sorbus pohuashanensis embryos. (a) ABA content. (b) GA3/ABA. (c) ACC/ABA. (d) JA/ABA. Note: Different small letters in the figure indicate significant differences between the different treatments (p < 0.05).
Figure 5. Effect of different concentrations of SNP treatment on the hormone content of Sorbus pohuashanensis embryos. (a) ABA content. (b) GA3/ABA. (c) ACC/ABA. (d) JA/ABA. Note: Different small letters in the figure indicate significant differences between the different treatments (p < 0.05).
Plants 14 00344 g005
Figure 6. Correlation analysis of RNS, ROS, and hormones. Note, the diagonal represents the sample name. The color from blue to red indicates the change of correlation from negative to positive. The larger the figure of the upper and lower triangular regions, the greater the correlation, and vice versa.
Figure 6. Correlation analysis of RNS, ROS, and hormones. Note, the diagonal represents the sample name. The color from blue to red indicates the change of correlation from negative to positive. The larger the figure of the upper and lower triangular regions, the greater the correlation, and vice versa.
Plants 14 00344 g006
Figure 7. Effects of different concentrations of NO treatment on the transcriptome changes of Sorbus pohuashanensis embryos. (a) The number of differential genes in Sorbus pohuashanensis. (b) Differential enrichment analysis of Sorbus pohuashanensis.
Figure 7. Effects of different concentrations of NO treatment on the transcriptome changes of Sorbus pohuashanensis embryos. (a) The number of differential genes in Sorbus pohuashanensis. (b) Differential enrichment analysis of Sorbus pohuashanensis.
Plants 14 00344 g007
Figure 8. Verification of differential genes by qRT-PCR.
Figure 8. Verification of differential genes by qRT-PCR.
Plants 14 00344 g008
Figure 9. (a) PCA scores were detected in Sorbus pohuashanensis embryos at 3 h and 3 d after different concentrations of SNP treatment. PCA scores were derived from all metabolites detected in the three replicate samples under each treatment. (b) Venn diagram of DAMs among various pair-wise comparisons.
Figure 9. (a) PCA scores were detected in Sorbus pohuashanensis embryos at 3 h and 3 d after different concentrations of SNP treatment. PCA scores were derived from all metabolites detected in the three replicate samples under each treatment. (b) Venn diagram of DAMs among various pair-wise comparisons.
Plants 14 00344 g009
Figure 10. Difference analysis of gene expression after treatment with different concentrations of SNP. (a) PG-3h vs. CK-3h; (b) PG-3d vs. CK-3d; (c) IG-3h vs. CK-3h; (d) IG-3d vs. CK-3d.
Figure 10. Difference analysis of gene expression after treatment with different concentrations of SNP. (a) PG-3h vs. CK-3h; (b) PG-3d vs. CK-3d; (c) IG-3h vs. CK-3h; (d) IG-3d vs. CK-3d.
Plants 14 00344 g010
Figure 11. KEGG pathways of DEGS and DAMs. (a) PG-3h vs. CK-3h. (b) IG-3h vs. CK-3h.
Figure 11. KEGG pathways of DEGS and DAMs. (a) PG-3h vs. CK-3h. (b) IG-3h vs. CK-3h.
Plants 14 00344 g011
Figure 12. Transcriptome and metabolome combined analysis of nine quadrants. The black dotted line, from left to right, from top to bottom, is divided into 1-9 quadrants. (a) PG-3h vs. CK-3h, (b) IG-3h vs. CK-3h.
Figure 12. Transcriptome and metabolome combined analysis of nine quadrants. The black dotted line, from left to right, from top to bottom, is divided into 1-9 quadrants. (a) PG-3h vs. CK-3h, (b) IG-3h vs. CK-3h.
Plants 14 00344 g012
Figure 13. Regulatory co-expression network of different genes and different metabolites related to the biosynthesis of phenylpropanoids and flavonoids. The Cytoscape software (version 3.10.0) was used to visualize the network. (a) PG-3h vs. CK-3h, (b) IG-3h vs. CK-3h.
Figure 13. Regulatory co-expression network of different genes and different metabolites related to the biosynthesis of phenylpropanoids and flavonoids. The Cytoscape software (version 3.10.0) was used to visualize the network. (a) PG-3h vs. CK-3h, (b) IG-3h vs. CK-3h.
Plants 14 00344 g013
Figure 14. Phenylpropanoid biosynthetic pathway. (a) NO concentration-dependent regulation of phenylpropanoid biosynthesis signaling pathway during embryo germination of Sorbus pohuashanensis. The blue frame indicates PG-3h vs. CK-3h, and the yellow frame indicates that IG-3h vs. CK-3h influences the pathway of phenylpropanoid biosynthesis compared to PG-3h vs. CK-3h. Red indicates upregulated genes/metabolites, blue indicates upregulated and downregulated genes/metabolites, and green indicates downregulated genes/metabolites. (b) Heatmap of gene and metabolite expression levels. Note, PAL, phenylalanine ammonia-lyase; CYP73A, trans-cinnamate 4-monooxygenase; 4CL, 4-coumarate-CoA ligase; CCR, cinnamoyl-CoA reductase; HCT, shikimate O-hydroxycinnamoyltransferase; CSE, caffeoylshikimate esterase; COMT, caffeic acid 3-O-methyltransferase/acetylserotonin O-methyltransferase; CYP98A(C3′H), 5-O-(4-coumaroyl)-D-quinate 3′-monooxygenase; K22395, cinnamyl-alcohol dehydrogenase; POD, peroxidase; UGT72E, coniferyl-alcohol glucosyltransferase; CAD, cinnamyl-alcohol dehydrogenase; REF1, coniferyl-aldehyde dehydrogenase; CYP84A (F5H), ferulat-5-hydroxylase.
Figure 14. Phenylpropanoid biosynthetic pathway. (a) NO concentration-dependent regulation of phenylpropanoid biosynthesis signaling pathway during embryo germination of Sorbus pohuashanensis. The blue frame indicates PG-3h vs. CK-3h, and the yellow frame indicates that IG-3h vs. CK-3h influences the pathway of phenylpropanoid biosynthesis compared to PG-3h vs. CK-3h. Red indicates upregulated genes/metabolites, blue indicates upregulated and downregulated genes/metabolites, and green indicates downregulated genes/metabolites. (b) Heatmap of gene and metabolite expression levels. Note, PAL, phenylalanine ammonia-lyase; CYP73A, trans-cinnamate 4-monooxygenase; 4CL, 4-coumarate-CoA ligase; CCR, cinnamoyl-CoA reductase; HCT, shikimate O-hydroxycinnamoyltransferase; CSE, caffeoylshikimate esterase; COMT, caffeic acid 3-O-methyltransferase/acetylserotonin O-methyltransferase; CYP98A(C3′H), 5-O-(4-coumaroyl)-D-quinate 3′-monooxygenase; K22395, cinnamyl-alcohol dehydrogenase; POD, peroxidase; UGT72E, coniferyl-alcohol glucosyltransferase; CAD, cinnamyl-alcohol dehydrogenase; REF1, coniferyl-aldehyde dehydrogenase; CYP84A (F5H), ferulat-5-hydroxylase.
Plants 14 00344 g014
Figure 15. The pathway of flavonoid biosynthesis pathway. (a) NO concentration-dependent regulation of flavonoid biosynthesis signaling pathway during embryo germination of Sorbus pohuashanensis. The blue outer frame indicates PG-3h compared to CK-3h, and the grey outer frame indicates IG-3h compared to CK-3h. (b) Heatmap of gene and metabolite expression levels. Note, CHI, chalcone isomerase; CHS, chalcone synthase, FLS, flavonol synthase; NAC, naringenin chalcone; CYP75B1, flavonoid 3′-monooxygenase; CYP73A, trans-cinnamate 4-monooxygenase; HCT, shikimate O-hydroxycinnamoyl transferase; CYP98A(C3′H), 5-O-(4-coumaroyl)-D-quinate 3′-monooxygenase; ANR, anthocyanidin reductase; PTG1, phlorizin synthase.
Figure 15. The pathway of flavonoid biosynthesis pathway. (a) NO concentration-dependent regulation of flavonoid biosynthesis signaling pathway during embryo germination of Sorbus pohuashanensis. The blue outer frame indicates PG-3h compared to CK-3h, and the grey outer frame indicates IG-3h compared to CK-3h. (b) Heatmap of gene and metabolite expression levels. Note, CHI, chalcone isomerase; CHS, chalcone synthase, FLS, flavonol synthase; NAC, naringenin chalcone; CYP75B1, flavonoid 3′-monooxygenase; CYP73A, trans-cinnamate 4-monooxygenase; HCT, shikimate O-hydroxycinnamoyl transferase; CYP98A(C3′H), 5-O-(4-coumaroyl)-D-quinate 3′-monooxygenase; ANR, anthocyanidin reductase; PTG1, phlorizin synthase.
Plants 14 00344 g015
Table 1. The RNA-seq information of samples.
Table 1. The RNA-seq information of samples.
SampleRaw ReadsClean ReadsQ20 (%)Q30 (%)GC Content (%)
CK-3h-156,725,51055,160,66297.8293.1446.34
CK-3h-254,750,69053,237,13897.8993.3746.41
CK-3h-353,956,55852,231,74897.993.3946.29
CK-3d-164,708,80662,885,71497.993.3746.8
CK-3d-270,509,06868,250,26897.8493.1846.83
CK-3d-362,635,84060,728,0209893.7246.79
PG-3h-158,613,94256,862,70897.893.0646.1
PG-3h-280,612,59078,953,44298.4895.8645.96
PG-3h-362,406,36060,066,06697.9293.4446.08
PG-3d-151,615,17650,409,01497.3591.7646.67
PG-3d-255,948,15254,195,68297.9993.6746.77
PG-3d-358,913,91657,146,26897.8793.346.8
IG-3h-163,467,17661,660,99097.9393.4746.07
IG-3h-265,084,92663,275,68697.7993.0646.15
IG-3h-375,233,13672,775,19497.8293.0946.23
IG-3d-167,369,07665,026,24497.8393.1546.79
IG-3d-258,658,80656,981,02497.7993.0546.73
IG-3d-361,788,88860,412,01698.0193.7146.81
Table 2. qRT-PCR primers for candidate genes.
Table 2. qRT-PCR primers for candidate genes.
Gene_idForward PrimersReverse Primers
Spβ-actinTGGATGGCTGGAAGAGGAGAGCGGGAAATTGTGAGG
Sp01G012390GGAAAGCAGCCGAAATCTTCTCCCACACACCGAAGT
Sp02G002460GATGTGTATTGCCCTCCTTCTCTTTACCACCGTTGA
Sp02G017590GGGTCGGGTTACAAGCGGGGCAAGAAAACTCGGTG
Sp02G022750AGGGTCCTCCCCCATACACGCTCTCCTTAGCAGTCA
Sp03G004740CAACCATCCCAAGCCACAAAACTCCTCCCCTCCTCC
Sp03G012770CCGTTTATTCCGCCATCAGGCGTCCCTTTCTTCTCTT
Sp04G014660GCACGGAGAGGCTAGAGAGTTGCAGCGAACAATGGT
Sp05G009470CTGTTCCATTCCTATCCCCAAAACCCAGTACCCATC
Sp13G007860TTCTCCGTGTTCGTCCAAACCGCCTCCTGTCATTCC
Sp14G022200GCGGCGAACAAATAGGGTTGGCGGATAAGGAACGGA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhao, C.; Zhang, Y.; Yang, L. Integrating Physiology, Transcriptome, and Metabolomics Reveals the Potential Mechanism of Nitric Oxide Concentration-Dependent Regulation of Embryo Germination in Sorbus pohuashanensis. Plants 2025, 14, 344. https://doi.org/10.3390/plants14030344

AMA Style

Zhao C, Zhang Y, Yang L. Integrating Physiology, Transcriptome, and Metabolomics Reveals the Potential Mechanism of Nitric Oxide Concentration-Dependent Regulation of Embryo Germination in Sorbus pohuashanensis. Plants. 2025; 14(3):344. https://doi.org/10.3390/plants14030344

Chicago/Turabian Style

Zhao, Caihong, Yue Zhang, and Ling Yang. 2025. "Integrating Physiology, Transcriptome, and Metabolomics Reveals the Potential Mechanism of Nitric Oxide Concentration-Dependent Regulation of Embryo Germination in Sorbus pohuashanensis" Plants 14, no. 3: 344. https://doi.org/10.3390/plants14030344

APA Style

Zhao, C., Zhang, Y., & Yang, L. (2025). Integrating Physiology, Transcriptome, and Metabolomics Reveals the Potential Mechanism of Nitric Oxide Concentration-Dependent Regulation of Embryo Germination in Sorbus pohuashanensis. Plants, 14(3), 344. https://doi.org/10.3390/plants14030344

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop