Virus-Induced Gene Silencing (VIGS) in Hydrangea macrophylla and Functional Analysis of HmF3′5′H
Abstract
1. Introduction
2. Results
2.1. Identification of HmPDS
2.2. Silencing of the PDS Gene in Plantlets of H. macrophylla
2.3. Evaluation of a VIGS System in H. macrophylla Flowes
2.4. Functional Validation of the F3′5′H Gene in H. macrophylla
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. RNA Extraction
4.3. Isolation and Cloning of HmPDS, HmF3′5′H, and HmCHS1
4.4. Multiple Sequence Alignment
4.5. Construction of TRV Plasmids and Agrobacterium Transformation
4.6. Virus-Induced Gene Silencing
4.7. Quantitative Real-Time Fluorescent PCR (RT-qPCR) Analysis
4.8. The Extraction and Measurement of Chlorophyll
4.9. The Extraction and Measurement of Total Anthocyanins
4.10. UPLC-PAD Analysis of Anthocyanins in Sepals
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Geum, N.G.; Eo, H.J.; Kim, H.J.; Park, G.H.; Son, H.J.; Jeong, J.B. Immune-enhancing activity of Hydrangea macrophylla subsp. serrata leaves through TLR4/ROS-dependent activation of JNK and NF-κB in RAW264.7 cells and immunosuppressed mice. J. Funct. Foods 2020, 73, 104139. [Google Scholar] [CrossRef]
- Lee, J.; Kwon, H.; Cho, E.; Jeon, J.; Lee, I.-K.; Cho, W.-S.; Park, S.J.; Lee, S.; Kim, D.H.; Jung, J.W. Hydrangea macrophylla and Thunberginol C Attenuate Stress-Induced Anxiety in Mice. Antioxidants 2022, 11, 234. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Matsuda, H.; Yamashita, C.; Nakamura, S.; Yoshikawa, M. Hydrangeic acid from the processed leaves of Hydrangea macrophylla var. thunbergii as a new type of anti-diabetic compound. Eur. J. Pharmacol. 2009, 606, 255–261. [Google Scholar] [CrossRef] [PubMed]
- Lange, M.; Yellina, A.L.; Orashakova, S.; Becker, A. Virus-Induced Gene Silencing (VIGS) in Plants: An Overview of Target Species and the Virus-Derived Vector Systems. In Virus-Induced Gene Silencing: Methods and Protocols; Becker, A., Ed.; Humana Press: Totowa, NJ, USA, 2013; pp. 1–14. [Google Scholar]
- Purkayastha, A.; Dasgupta, I. Virus-induced gene silencing: A versatile tool for discovery of gene functions in plants. Plant Physiol. Biochem. 2009, 47, 967–976. [Google Scholar] [CrossRef]
- Reid, M.; Chen, J.-C.; Jiang, C.-Z. Virus-Induced Gene Silencing for Functional Characterization of Genes in Petunia. In Petunia: Evolutionary, Developmental and Physiological Genetics; Gerats, T., Strommer, J., Eds.; Springer: New York, NY, USA, 2009; pp. 381–394. [Google Scholar]
- Xie, L.; Zhang, Q.; Sun, D.; Yang, W.; Hu, J.; Niu, L.; Zhang, Y. Virus-induced gene silencing in the perennial woody Paeonia ostii. PeerJ 2019, 7, e7001. [Google Scholar] [CrossRef]
- Tian, J.; Pei, H.; Zhang, S.; Chen, J.; Chen, W.; Yang, R.; Meng, Y.; You, J.; Gao, J.; Ma, N. TRV–GFP: A modified Tobacco rattle virus vector for efficient and visualizable analysis of gene function. J. Exp. Bot. 2014, 65, 311–322. [Google Scholar] [CrossRef]
- Xu, H.; Xu, L.; Yang, P.; Cao, Y.; Tang, Y.; He, G.; Yuan, S.; Lei, J.; Ming, J. Virus-induced Phytoene Desaturase (PDS) Gene Silencing Using Tobacco Rattle Virus in Lilium × formolongi. Hortic. Plant J. 2019, 5, 31–38. [Google Scholar] [CrossRef]
- Zulfiqar, S.; Farooq, M.A.; Zhao, T.; Wang, P.; Tabusam, J.; Wang, Y.; Xuan, S.; Zhao, J.; Chen, X.; Shen, S.; et al. Virus-Induced Gene Silencing (VIGS): A Powerful Tool for Crop Improvement and Its Advancement towards Epigenetics. Int. J. Mol. Sci. 2023, 24, 5608. [Google Scholar] [CrossRef]
- Liu, N.; Xie, K.; Jia, Q.; Zhao, J.; Chen, T.; Li, H.; Wei, X.; Diao, X.; Hong, Y.; Liu, Y. Foxtail Mosaic Virus-Induced Gene Silencing in Monocot Plants. Plant Physiol. 2016, 171, 1801–1807. [Google Scholar] [CrossRef]
- Murai, H.; Mochizuki, T. Virus-Induced Gene Silencing in Chrysanthemum seticuspe Using the Tomato Aspermy Virus Vector. Plants 2022, 11, 430. [Google Scholar] [CrossRef]
- Cheng, G.; Shu, X.; Wang, Z.; Wang, N.; Zhang, F. Establishing a Virus-Induced Gene Silencing System in Lycoris chinensis. Plants 2023, 12, 2458. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.; Chen, X.; Chen, J.; Zheng, P.; Liu, S.; Tan, X.; Sun, B. Virus-Induced Gene Silencing in the Tea Plant (Camellia sinensis). Plants 2023, 12, 3162. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Niu, N.; Li, S.; Liu, Y.; Xue, C.; Wang, H.; Liu, M.; Zhao, J. Virus-Induced Gene Silencing (VIGS) in Chinese Jujube. Plants 2023, 12, 2115. [Google Scholar] [CrossRef] [PubMed]
- Peng, K.; Xue, C.; Huang, X. Enhancing virus-induced gene silencing efficiency in tea plants (Camellia sinensis L.) and the functional analysis of CsPDS. Sci. Hortic.-Amst. 2024, 337, 113585. [Google Scholar] [CrossRef]
- Melgar, A.E.; Palacios, M.B.; Tosar, L.J.M.; Zelada, A.M. A novel and efficient Apple latent spherical virus-based gene silencing method for functional genomic studies in Chenopodium quinoa. Sci. Hortic. 2024, 333, 113258. [Google Scholar] [CrossRef]
- Chen, G.; Song, J.; Zhang, Y.; Guo, X.; Shen, X. Development and application of virus-induced gene silencing (VIGS) for studying ApTT8 gene function in Agapanthus praecox ssp. orientalis. Sci. Hortic. 2024, 324, 112595. [Google Scholar] [CrossRef]
- Chen, H.; Wang, X.; Xu, L.F. Identification and Bioinformatics Analysis of ABC Transporter Gene Family in Hydrangea Under Aluminum Stress. Mol. Plant Breed. 2022, 13. [Google Scholar] [CrossRef]
- Qi, H.; Zhang, G.; Chu, Z.; Liu, C.; Yuan, S. Identification of Seven Key Structural Genes in the Anthocyanin Biosynthesis Pathway in Sepals of Hydrangea macrophylla. Curr. Issues Mol. Biol. 2022, 44, 4167–4180. [Google Scholar] [CrossRef]
- Li, Z.; Lyu, T.; Lyu, Y. The Molecular Biology Analysis for the Growing and Development of Hydrangea macrophylla ‘Endless Summer’ Under Different Light and Temperature Conditions. Horticulturae 2024, 10, 586. [Google Scholar] [CrossRef]
- Liu, Y.; Lyu, T.; Lyu, Y. Study on the Flower Induction Mechanism of Hydrangea macrophylla. Int. J. Mol. Sci. 2023, 24, 7691. [Google Scholar] [CrossRef]
- Zhu, Y.; Zeng, X.; Zhu, T.; Jiang, H.; Lei, P.; Zhang, H.; Chen, H. Plant Hormone Pathway Is Involved in Regulating the Embryo Development Mechanism of the Hydrangea macrophylla Hybrid. Int. J. Mol. Sci. 2024, 25, 7812. [Google Scholar] [CrossRef] [PubMed]
- Gong, J.; Wang, Y.; Xue, C.; Wu, L.; Sheng, S.; Wang, M.; Peng, J.; Cao, S. Regulation of blue infertile flower pigmentation by WD40 transcription factor HmWDR68 in Hydrangea macrophylla ‘forever summer’. Mol. Biol. Rep. 2024, 51, 328. [Google Scholar] [CrossRef] [PubMed]
- Peng, J.; Dong, X.; Xue, C.; Liu, Z.; Cao, F. Exploring the Molecular Mechanism of Blue Flower Color Formation in Hydrangea macrophylla cv. Forever Summer. Front. Plant Sci. 2021, 12, 585665. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Sun, W.; Zeng, S.; Huang, W.; Liu, D.; Hu, W.; Shen, X.; Wang, Y. Virus-induced gene silencing in two novel functional plants, Lycium barbarum L. and Lycium ruthenicum Murr. Sci. Hortic. 2014, 170, 267–274. [Google Scholar] [CrossRef]
- Ye, J.; Qu, J.; Bui, H.T.; Chua, N.H. Rapid analysis of Jatropha curcas gene functions by virus-induced gene silencing. Plant Biotechnol. J. 2009, 7, 964–976. [Google Scholar] [CrossRef]
- Wege, S.; Scholz, A.; Gleissberg, S.; Becker, A. Highly Efficient Virus-induced Gene Silencing (VIGS) in California Poppy (Eschscholzia californica): An Evaluation of VIGS as a Strategy to Obtain Functional Data from Non-model Plants. Ann. Bot. 2007, 100, 641–649. [Google Scholar] [CrossRef]
- Liu, E.; Page, J.E. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods 2008, 4, 5. [Google Scholar] [CrossRef]
- Rammohan, A.; Reddy, J.S.; Sravya, G.; Rao, C.N.; Zyryanov, G.V. Chalcone synthesis, properties and medicinal applications: A review. Environ. Chem. Lett. 2020, 18, 433–458. [Google Scholar] [CrossRef]
- Tanaka, Y.; Brugliera, F. Flower colour and cytochromes P450. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2013, 368, 20120432. [Google Scholar] [CrossRef]
- Ito, D.; Shinkai, Y.; Kato, Y.; Kondo, T.; Yoshida, K. Chemical Studies on Different Color Development in Blue- and Red-Colored Sepal Cells of Hydrangea macrophylla. Biosci. Biotechnol. Biochem. 2009, 73, 1054–1059. [Google Scholar] [CrossRef]
- Ito, T.; Oyama, K.-i.; Yoshida, K. Direct Observation of Hydrangea Blue-Complex Composed of 3-O-Glucosyldelphinidin, Al3+ and 5-O-Acylquinic Acid by ESI-Mass Spectrometry. Molecules 2018, 23, 1424. [Google Scholar] [CrossRef] [PubMed]
- Schreiber, H.D.; Jones, A.H.; Lariviere, C.M.; Mayhew, K.M.; Cain, J.B. Role of aluminum in red-to-blue color changes in Hydrangea macrophylla sepals. BioMetals 2011, 24, 1005–1015. [Google Scholar] [CrossRef] [PubMed]
- Schreiber, H.D.; Swink, A.M.; Godsey, T.D. The chemical mechanism for Al3+ complexing with delphinidin: A model for the bluing of hydrangea sepals. J. Inorg. Biochem. 2010, 104, 732–739. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.; Qi, H.; Yang, S.; Chu, Z.; Zhang, G.; Liu, C. Role of delphinidin-3-glucoside in the sepal blue color change among Hydrangea macrophylla cultivars. Sci. Hortic. 2023, 313, 111902. [Google Scholar] [CrossRef]
- Broderick, S.R.; Jones, M.L. An Optimized Protocol to Increase Virus-Induced Gene Silencing Efficiency and Minimize Viral Symptoms in Petunia. Plant Mol. Biol. Report. 2014, 32, 219–233. [Google Scholar] [CrossRef]
- Muruganantham, M.; Moskovitz, Y.; Haviv, S.; Horesh, T.; Fenigstein, A.; Preez, J.; Stephan, D.; Burger, J.T.; Mawassi, M. Grapevine virusA-mediated gene silencing in Nicotiana benthamiana and Vitis vinifera. J. Virol. Methods 2009, 155, 167–174. [Google Scholar] [CrossRef]
- Bélanger, S.; Kramer, M.C.; Payne, H.A.; Hui, A.Y.; Slotkin, R.K.; Meyers, B.C.; Staub, J.M. Plastid dsRNA transgenes trigger phased small RNA-based gene silencing of nuclear-encoded genes. Plant Cell 2023, 35, 3398–3412. [Google Scholar] [CrossRef]
- Li, X.; Tao, N.; Xu, B.; Xu, J.; Yang, Z.; Jiang, C.; Zhou, Y.; Deng, M.; Lv, J.; Zhao, K. Establishment and application of a root wounding-immersion method for efficient virus-induced gene silencing in plants. Front. Plant Sci. 2024, 15, 1336726. [Google Scholar] [CrossRef]
- Ren, C.; Liu, Y.; Guo, Y.; Duan, W.; Fan, P.; Li, S.; Liang, Z. Optimizing the CRISPR/Cas9 system for genome editing in grape by using grape promoters. Hortic. Res. 2021, 8, 52. [Google Scholar] [CrossRef]
- Luo, S.; Li, Y.; Wan, Y.; Fan, Y.; Liu, C.; Yuan, S. Identification of Key Candidate Genes Involved in Aluminum Accumulation in the Sepals of Hydrangea macrophylla. Horticulturae 2024, 10, 1180. [Google Scholar] [CrossRef]
- Ramegowda, V.; Senthil-kumar, M.; Udayakumar, M.; Mysore, K.S. A high-throughput virus-induced gene silencing protocol identifies genes involved in multi-stress tolerance. BMC Plant Biol. 2013, 13, 193. [Google Scholar] [CrossRef] [PubMed]
- Zhang, G.; Yuan, S.; Qi, H.; Chu, Z.; Liu, C. Identification of Reliable Reference Genes for the Expression of Hydrangea macrophylla ‘Bailmer’ and ‘Duro’ Sepal Color. Horticulturae 2022, 8, 835. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Arnon, D.I. Copper Enzymes in Isolated Chloroplasts. Polyphenoloxidase in Beta Vulgaris. Plant Physiol. 1949, 24, 1–15. [Google Scholar] [CrossRef]
Gene | Primer Sequence (5′-3′) | Product Size (bp) |
---|---|---|
HmPDS | F:GTGGCAGGGTCAGTATTGCTGG R:CAGACAACGCTTGCCTCAACTAG | 1829 |
HmCHS1 | F:GGGCACGTGATTCTTAGCTACCAC R:AAGGGACGGAATGCCTCAACTAGACTCG | 849 |
HmF3′5′H | F:CACATGTACATACACACAACACTTGCAC R:TCGTGGACGTGGTTGAATGG | 1594 |
Gene | Primer Sequence (5′-3′) | Product Size (bp) |
---|---|---|
HmPDS | F: CTGTGAGTAAGGTTACCGGCTATGCCAAACAAGC R: GAGACGCGTGAGCTCGCGGAGGATTACCATCTAA | 382 |
HmCHS1 | F: CTGTGAGTAAGGTTACCGATGGTGACCGTCGAGG R: TCGAGACGCGTGAGCTCGGTGGCTGCTTCTTTGCCTAG | 332 |
HmF3′5′H | F: CTGTGAGTAAGGTTACCGCCGAGACCCGGATGTTTG R: TCGAGACGCGTGAGCTCGCGTGGACGTGGTTGAATG | 340 |
Gene | Forward Primers (5′-3′) | Reverse Primers (5′-3′) |
---|---|---|
HmEF1-β | CGCAGCTGTTTTAGGGAAGCC | GCGAGCTGCGAAGACACAGA |
Coat Protein | TTACGACGAACCAAGGGAGTACTA | CGGTGCAGATGAACTAGCAGCTG |
HmPDS | GCCAATGCAATGCAATGAGCTG | GGCAGACATCCATCCTTGGTCTTG |
HmCHS1 | AATTTCAGCGCATGTGTGACAATT | CCACCACCATGTCTTGTCTAGC |
HmF3′5′H | AGGGCAAGCCGGACTTTCTT | CCGGCAGTGAACAAATTCAAGAGTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Q.; Fan, Y.; Luo, S.; Liu, C.; Yuan, S. Virus-Induced Gene Silencing (VIGS) in Hydrangea macrophylla and Functional Analysis of HmF3′5′H. Plants 2024, 13, 3396. https://doi.org/10.3390/plants13233396
Yang Q, Fan Y, Luo S, Liu C, Yuan S. Virus-Induced Gene Silencing (VIGS) in Hydrangea macrophylla and Functional Analysis of HmF3′5′H. Plants. 2024; 13(23):3396. https://doi.org/10.3390/plants13233396
Chicago/Turabian StyleYang, Qiyu, Youwei Fan, Shuwen Luo, Chun Liu, and Suxia Yuan. 2024. "Virus-Induced Gene Silencing (VIGS) in Hydrangea macrophylla and Functional Analysis of HmF3′5′H" Plants 13, no. 23: 3396. https://doi.org/10.3390/plants13233396
APA StyleYang, Q., Fan, Y., Luo, S., Liu, C., & Yuan, S. (2024). Virus-Induced Gene Silencing (VIGS) in Hydrangea macrophylla and Functional Analysis of HmF3′5′H. Plants, 13(23), 3396. https://doi.org/10.3390/plants13233396