Next Article in Journal
Integrated Analysis of microRNAs and Transcription Factor Targets in Floral Transition of Pleioblastus pygmaeus
Previous Article in Journal
Authentication and Quality Control of the Brazilian Traditional Herb ‘Carquejas’ (Baccharis Species) Using Morpho-Anatomy and Microscopy
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Assessing Genetic Variability and Population Structure of Alnus glutinosa (Black Alder) in Kazakhstan Using SSR Markers

1
National Center for Biotechnology, 13/5, Korgalzhyn Road, Astana 010000, Kazakhstan
2
Department of Natural Sciences, Kostanay Regional University, 47 Baytursynov Str., Kostanay 110000, Kazakhstan
*
Author to whom correspondence should be addressed.
Plants 2024, 13(21), 3032; https://doi.org/10.3390/plants13213032
Submission received: 26 August 2024 / Revised: 4 October 2024 / Accepted: 22 October 2024 / Published: 30 October 2024
(This article belongs to the Section Plant Genetics, Genomics and Biotechnology)

Abstract

Alnus glutinosa plays a crucial role in flood control, riverbank stabilization, and water purification. Recognized for its ecological significance, it is listed in the Red Book of Kazakhstan. This study investigated the genetic variability of A. glutinosa populations in Kazakhstan, analyzing 78 trees from seven populations in the Bayanaul mountain forest massif and the northern Turgay regions using 12 SSR markers. The study identified an average of 6.3 alleles and 2.783 effective alleles, as well as observed and expected heterozygosities of 0.570 and 0.562, respectively, reflecting genetic diversity. Among the populations, KS1 (northern Turgay) and PVL3 (Bayanaul) displayed the highest diversity, while PVL5 (Bayanaul) showed slightly lower diversity. The analysis of molecular variance results indicated that 86% of the genetic diversity occurred within populations, with 14% attributed to differences between populations. A UPGMA tree based on Nei’s genetic distance revealed three distinct clusters, suggesting geographically structured genetic variability in A. glutinosa populations.

1. Introduction

The genus Alnus P. Miller (alder) comprises deciduous trees that can reach up to 30 m in height, as well as smaller shrubs (1–1.5 m), all belonging to the Betulaceae family. The species are distributed widely across the temperate forests of the Northern Hemisphere, including Eurasia and North America [1,2].
Currently, over 30 species of the subgenus Alnus are recognized, with Alnus glutinosa (L.) Gaertn. (2n = 28), commonly known as black or sticky alder, being the most well known and widespread. This actinorhizal species thrives particularly well in wet environments [3,4]. A. glutinosa is of particular interest as a pioneer species, often the first to colonize the coastal alluvium of lakes, rivers, and streams, as well as abandoned farmland and rocky outcrops [5,6].
The species plays a significant role in flood control, riverbank stabilization, and maintaining river ecosystem functionality, while also contributing to water filtration and purification [7,8]. Its wood is used in energy production; as fiber for paper and chipboard; and, most profitably, in joinery, where it is employed as solid wood or veneer. However, due to land clearance activity for agriculture, the abundance of A. glutinosa has been declining [9].
Biodiversity loss is a major global concern, and wild plants, as sources of genetic resources, are critically important to national economies. A. glutinosa, which provides vital ecological functions, is a red-listed species in Kazakhstan [10]. The species does not have a wide distribution in the country, and its populations are isolated and scattered. Notably, one of the easternmost edges of A. glutinosa distribution is in the Bayanaul Mountains, which is in the eastern part of Kazakhstan [11]. The population is likely more isolated than others. Additionally, the species is present in the Karkarala and Ereimentau mountain forest massifs (both in the central part of the country) and along the Ilek [12] and Ural Rivers [13] (in the western region of Kazakhstan). It is also found in the northern Turgay strata, a vast steppe plain [14]. Such fragmented populations suggest potential isolation and limited gene flow, which is important to consider when examining the genetic structure of the populations, particularly in comparison with populations in the western and central parts of the range of the species.
Understanding the genetic diversity of A. glutinosa populations is essential for its conservation and breeding efforts [8,15,16]. Forest trees often exhibit high genetic diversity due to their large geographic ranges, outcrossing systems, and seed dispersal mechanisms, which include wind and animals [8]. In such a context, it is critical to assess the genetic diversity of natural populations of A. glutinosa. However, previous studies on the species in Kazakhstan have been limited to phenotypic traits [17,18,19], with no reports on the use of molecular markers to investigate population variability. Consequently, the lack of molecular data restricts efforts to protect, conserve, and exploit the species effectively.
Molecular markers have become invaluable tools for building A. glutinosa germplasm collections, evaluating local diversity, and studying population structure. Simple sequence repeats (SSRs) are widely distributed in genomes, often highly polymorphic, co-dominant, stable, and highly reproducible, making them ideal for genetic studies in woody plants such as poplar, Coffea, and Brazilian cherry [20,21,22].
Earlier work by Mingeot et al. [6] demonstrated that 11 out of 26 SSR primers produced amplification products suitable for studying the genetic structure of natural A. glutinosa populations. Subsequently, Lepais et al. [23] developed and validated 12 polymorphic loci for use in population genetics studies of A. glutinosa. In addition, using SSR primers designed by Mingeot [15], a panel of 14 nuclear SSR loci revealed high allelic diversity and very low differentiation among wild populations of A. glutinosa (Fst = 0.014). Martín et al. [24] also assessed the local genetic diversity of populations and identified potential hybrids resulting from the coexistence of A. glutinosa and Alnus lusitanica in Spain. In recent decades, numerous studies have investigated the genetic variability of various Alnus species, including A. glutinosa [8,15,16,24,25], Alnus cremastogyne [26], Alnus incana [27], and A. lusitanica [28].
In the present study, the genetic diversity and structure of A. glutinosa populations from the eastern part of its natural distribution range were analyzed using 12 SSR markers (Ag01, Ag05, Ag09, Ag10, Ag13, Ag14, Ag20, Ag23, Ag25, Ag27, Ag30, and Ag35). The research aimed to assess intra- and inter-population variability of black alder across different ecological conditions. This is the first molecular-level investigation of A. glutinosa in northern Kazakhstan, which could provide insights into local diversity and the genetic structure of the endangered species.

2. Results

2.1. Genetic Diversity of A. glutinosa Populations

The genetic diversity of natural Alnus glutinosa populations was assessed using 12 microsatellite loci: Ag01, Ag05, Ag09, Ag10, Ag13, Ag14, Ag20, Ag23, Ag25, Ag27, Ag30, and Ag35. The analysis revealed a high level of genetic diversity. The amplification of 78 samples from seven populations yielded a total of 76 alleles across 12 SSR loci (Table S1). Markers Ag01 and Ag05 displayed high genetic diversity, with Ag05 exhibiting the highest observed heterozygosity (0.837) and gene flow (Nm = 3.499), indicating significant population mixing. Ag09 also showed good diversity with adequate gene flow (Nm = 2.511). In contrast, Ag10 had lower diversity and gene flow (Nm = 0.850), suggesting restricted migration. Ag13 and Ag14 exhibited strong genetic diversity; however, Ag14’s low heterozygosity (0.304) could indicate selection or drift. Ag20 had very low diversity but high gene flow (Nm = 5.807), indicating population homogeneity. Other markers, such as Ag23 and Ag25, showed moderate diversity, while Ag27 and Ag30 demonstrated both good diversity and strong gene flow. Ag35 also showed strong diversity with moderate gene flow. Therefore, the average number of alleles per locus was 6.3, and the effective number of alleles per locus was 2.783. The observed heterozygosity (Ho = 0.570) was not significantly different from the expected heterozygosity (He = 0.562).
In total, 76 alleles were identified across the seven populations, 13 of which were private alleles (Table 1). The unique alleles were detected in five out of the seven populations: KS1, PVL3, PVL4, PVL5, and PVL6. In the KS1 population (northern Turgay), eight unique alleles were observed at loci Ag01, Ag05, Ag13, Ag14, Ag20, and Ag35, and they were found exclusively within this population. Similarly, in the Bayanaul mountain forest massif, unique alleles were detected in PVL3 (Ag13), PVL4 (Ag14), PVL5 (Ag20, Ag30), and PVL6 (Ag35).
Genetic diversity across the seven populations of A. glutinosa is summarized in Table 2. The KS1 population (northern Turgay) exhibited the highest Na value (5.000), while the PVL6 population (Bayanaul mountain forest massif) had the lowest (Na = 3.583). In terms of effective alleles, KS1 had the highest Ne (3.246), whereas PVL5 (Bayanaul mountain forest massif) had the lowest Ne (2.469). Ho across populations ranged from 0.491 to 0.681, while He varied from 0.504 to 0.634, with overall mean values of 0.570 and 0.562, respectively. Slightly higher uHe values compared to Ho were observed across all seven populations, suggesting that random mating is the dominant system, with limited inbreeding within A. glutinosa populations. Although uHe values were consistently higher than Ho values across all seven populations, the considerable variation in sample size (N) calls for caution when interpreting the differences. The elevated uHe values may reflect the predominance of random mating and limited inbreeding within A. glutinosa populations. However, the trend is likely influenced by the disparity in sample sizes across the studied populations.
Unbiased expected heterozygosity (uHe) and Ho ranged from 0.029 to 0.761 and 0.029 to 0.837, respectively, with mean values of 0.592 and 0.570 (Table 2). The Ag05 and Ag35 loci exhibited the highest uHe (0.761 and 0.759, respectively), as well as the greatest number of different alleles (Na = 9) and effective alleles (Ne = 3.675 and 3.888, respectively). Among the 12 SSR loci, Ag14 had a lower Ho than uHe, while Ag01, Ag05, Ag09, Ag10, Ag27, and Ag30 exhibited slightly higher Ho compared to uHe. Overall, the mean Ho was nearly equal to the mean uHe, indicating a predominantly random mating system within A. glutinosa populations. Shannon’s Information Index across all loci was 1.053, indicating moderate genetic diversity in the populations studied. Loci Ag05, Ag13, and Ag35 exhibited the highest diversity, whereas Ag10 and Ag20 had the lowest diversity, reflecting differences in allele distribution and heterozygosity among the loci.
Shannon’s Information Index (I) across populations indicated varying levels of genetic diversity, with KS1 showing the highest diversity and PVL5 the lowest. The average I across all populations was 1.053, suggesting moderate overall genetic diversity in the studied A. glutinosa populations, which is consistent with the range of effective allele counts and observed heterozygosity values across the populations.
In conclusion, the overall genetic diversity within A. glutinosa populations was relatively high, with the KS1 (northern Turgay) and PVL3 (Bayanaul mountain forest massif) populations exhibiting the greatest diversity. In contrast, the PVL5 population (Bayanaul mountain forest massif) showed slightly lower levels of genetic diversity.

2.2. Genetic Differentiation of A. glutinosa Populations

Genetic differentiation among the seven A. glutinosa populations, measured based on G’st (Nei), ranged from 0.217 (Ag10) to −0.003 (Ag20) across the 12 loci, with a mean of 0.078 (Table S2). This indicates that 7.8% of the genetic variation existed among the populations, while the remaining 92.2% was found within populations, highlighting that genetic variation within populations was the primary source of overall diversity.
Nm across the 12 SSR loci averaged 2.565, which is slightly higher than 1, aligning with the moderate level of genetic differentiation observed among populations (Table S2). This suggests a moderate degree of gene flow among the seven A. glutinosa populations. Additionally, Ho was generally similar to He or uHe in all populations, further supporting moderate heterozygosity levels.
Positive values for Wright’s F-statistics confirm sufficient heterozygosity at the population level (Table S2). The FST values ranged from 0.041 at the Ag20 locus to 0.227 at the Ag10 locus, with an average FST of 0.110, indicating significant genetic differentiation between populations.
Pairwise comparisons of populations (Table S3) revealed that the greatest contribution to this high interpopulation differentiation stemmed from differences between population KS2 (northern Turgay) and populations PVL3, PVL4, PVL5, and PVL7 (Bayanaul mountain forest massif). Population KS2, located in the Kostanay region, is approximately 1020 km away from the Pavlodar region populations (PVL3, PVL4, PVL5, and PVL7), highlighting the influence of geographic distance on genetic differentiation.
The pairwise FST values for these populations ranged from 0.041 to 0.106, with an average FST of 0.068. Among the pairwise comparisons, the highest FST (0.106) was found between populations KS2 (northern Turgay) and PVL3 (Bayanaul mountain forest massif), while the lowest FST (0.041) was observed between PVL4 and PVL7 (both in the Bayanaul mountain forest massif). Correspondingly, gene flow (Nm) ranged from 0.850 to 5.807, with most values exceeding 1, indicating a relatively high level of gene flow between paired populations.
The heatmap (Figure 1) reveals moderate genetic differentiation among A. glutinosa populations. The relatively low Fst values between PVL populations suggested greater genetic cohesion, whereas the higher values between KS populations and PVL populations highlighted greater genetic differentiation. Understanding the trends is critical for formulating effective conservation and management strategies to ensure the preservation of genetic diversity in the species.
An analysis of molecular variance (AMOVA) conducted using 12 SSR loci (Figure 2) revealed that 86% of the genetic variation was within populations, while 14% was between populations (summarizing table available in Supplementary Table S3). This result aligns with the G’st (Nei) value of 0.078 calculated from the F-statistic (Table S1), reinforcing the conclusion that the majority of genetic variability in A. glutinosa exists within populations.

2.3. Genetic Structure of the A. glutinosa Population

The UPGMA tree constructed based on Nei’s genetic distance values revealed that the seven populations of A. glutinosa could be divided into three distinct clusters: (KS1, KS2); (PVL4, PVL3, and PVL7); and (PVL5, PVL6). The KS1 and KS2 populations were located in northern Turgay (Kostanay region), while the PVL3, PVL4, PVL5, PVL6, and PVL7 populations were from the Bayanaul mountain forest massif (Pavlodar region). This clustering pattern suggests that the genetic variation in A. glutinosa populations is geographically structured. The second cluster can be divided further into two subgroups: one consisting solely of PVL4 and the other comprising PVL3 and PVL7. However, the subgroups did not exhibit clear geographical differentiation (Figure 3).
Principal coordinate analysis (PCoA) was conducted to visualize the genetic relationships among seven A. glutinosa populations, labeled as KS1, KS2, PVL3, PVL4, PVL5, PVL6, and PVL7 (Figure 4). Each point on the plot represents an individual, and the clustering of points indicates genetic similarity. Populations KS1 (blue) and KS2 (orange) showed distinct separation from the other populations along the first principal coordinate, indicating substantial genetic differentiation. In contrast, populations PVL3, PVL4, PVL5, PVL6, and PVL7 exhibited greater overlap, suggesting that the populations had more genetic similarities or had experienced gene flow. The second principal coordinate (PCoA 2) accounted for additional variation, but the most prominent genetic separation was along the first coordinate.
Overall, the results highlighted significant genetic diversity among some populations, particularly KS1 and KS2, while the others were more genetically interconnected. The information could facilitate the formulation of conservation strategies and understanding of population structure within the species.

3. Discussion

3.1. Population Genetic Structure and Geographical Variation in A. glutinosa

This study investigated the genetic diversity of seven A. glutinosa populations growing in two regions of northern Kazakhstan: the Kostanay and Pavlodar regions. In the northern Turgay (Kostanay region), 27 trees were sampled from two populations (KS1 and KS2), while 51 trees were sampled from five populations in the Bayanaul mountain forest massif (Pavlodar region; PVL3, PVL4, PVL5, PVL6, and PVL7).
To assess genetic diversity, we used 12 nuclear microsatellite markers. The results are consistent with the findings of previous studies that have employed microsatellites or other DNA markers to evaluate genetic diversity and hybridization within A. glutinosa populations [8,15,16,24,25].
Our findings reveal significant genetic differentiation and structure among the two regional populations, as well as within the populations in each region. Both regions exhibited comparable levels of genetic variation, with a large number of common alleles and several unique alleles.
All seven A. glutinosa populations demonstrated relatively high genetic diversity, with Na = 6.3 and uHe = 0.592 across the 12 SSR loci. Populations KS1 (northern Turgay) and PVL3 (Bayanaul mountain forest massif) showed the highest levels of genetic diversity.
The genetic diversity observed in Kazakhstan’s A. glutinosa populations was comparable to that in populations from Latvia (Na = 10.07, uHe = 0.636) [16], as well as the genetic diversity in Irish, Scottish, and French populations (Na = 6.61, He = 0.64) [8]. Additionally, the genetic diversity of populations along the borders of Belgium, Luxembourg, and France (Na = 7.34, He = 0.64) [15], as well as that of A. cremastogyne (Na = 5.83, He = 0.630) [26], as determined by SSR markers, was similar to that of A. glutinosa.
The FST value for A. glutinosa (Fst = 0.110) indicates relatively high genetic differentiation, which is higher than that observed in A. glutinosa populations on the Belgium–Luxembourg–France border (Fst = 0.014) [28] and in A. cremastogyne populations (Fst = 0.021) [25] but similar to A. maritima populations (Fst = 0.107) [29]. This elevated differentiation could be attributed to the fragmented and isolated nature of the eastern populations, which likely restricts gene flow. Nonetheless, the gene flow estimate (Nm = 2.565) suggests moderate levels of gene flow among populations, though this may vary depending on the degree of population isolation across the species’ range.
The classification of A. glutinosa populations into three clusters supports the presence of geographically structured genetic variability. Cluster 1 includes the populations from northern Turgay (KS1, KS2), which also show distinct separation from other populations in the PCoA, indicating substantial genetic differentiation. Cluster 2 comprises populations PVL3, PVL4, and PVL7 from the Bayanaul mountain forest massif, and Cluster 3 includes populations PVL5 and PVL6 from the same region. Interestingly, while the PCoA reveals genetic overlap among the Bayanaul populations, the cluster analysis separates them into two groups. This genetic overlap may be due to the species’ preference for riparian habitats and the lightweight nature of its seeds, which facilitate dispersal via regional water systems, such as the Mayozek River, Lake Toraigyr, and various springs. The PCoA results support the view that gene flow has occurred among these, despite geographic distances (Figure 1). A. glutinosa seeds are dispersed primarily by running water rather than wind, with dispersal typically limited to around 30 m from the parent trees [30]. Consequently, the species tends to form linear stands along streams and rivers.
Additionally, significant isolation by altitude was observed in the genetic structure of the A. glutinosa populations. As the altitudinal differences between populations increased, genetic distance also increased. Populations in Cluster 2 (PVL3, PVL4, and PVL7) were situated along a similar altitudinal gradient, while those in Cluster 3 (PVL5 and PVL6) were located at lower elevations (Table S1). The heatmap (Figure 1) shows moderate genetic differentiation between populations, with lower Fst values among PVL populations, indicating higher genetic cohesion. In contrast, higher Fst values between KS and PVL populations highlight greater genetic differentiation, likely due to geographic isolation. The patterns emphasize the need to account for geographic barriers in conservation strategies.
In conclusion, positive correlations between genetic and geographic distances, as evidenced by the statistically significant Mantel test result (Mantel statistic = 1.0000, p-value = 0.0010), suggest that the observed genetic differentiation could be attributed to isolation by both distance and altitude. This implies that geographical separation, possibly amplified by altitudinal barriers, has likely limited gene flow between populations, leading to the patterns of genetic diversity observed in the present study.

3.2. Genetic Improvement of A. glutinosa

A. glutinosa is one of the most important forest tree species globally, thriving in damp habitats and exhibiting significant sensitivity to fluctuations in groundwater levels. Its seeds are dispersed primarily by water, leading to the species’ characteristic growth in linear stands along streams and rivers. However, the distribution exhibits no specific correlation with river catchments.
Human activity is increasingly disrupting the natural habitats of A. glutinosa, posing a significant threat to its survival. Despite its high potential for long-distance seed dispersal via water, the species’ expansion is constrained by its intolerance to shade, which limits seed germination and seedling survival in areas already populated by other trees [9,15].
Additionally, A. glutinosa faces a severe threat from the fungal disease Phytophthora alni, which has led to significant die-offs and population declines across Europe [6,31].
Considering the advanced stage of the disease, in situ conservation has become increasingly challenging, making the conservation of the remaining populations imperative. To protect A. glutinosa, priority should be given to ex situ conservation efforts, including the establishment of germplasm collections from the most genetically significant populations across different ecological zones. This can be achieved through vegetative propagation, micropropagation, and cryopreservation of seeds [32,33,34]. Populations such as KS1, PVL3, PVL4, PVL5, and PVL6, which exhibit the highest genetic diversity, should be prioritized for ex situ conservation efforts.

4. Materials and Methods

4.1. Plant Material

The study area encompassed the northern Kazakhstan Bayanaul mountain forest massif (Pavlodar region) and northern Turgay (Kostanay region). A total of seven natural populations of alder forests were sampled, consisting of five populations from the Bayanaul mountain forest massif and two populations from northern Turgay, which were located along riverbanks (Table 3, Figure 5). Plant material was collected from 78 trees across the regions. Within each population, samples were collected with a minimum spacing of 15 m between trees.
The geographic coordinates and elevation of each specimen were recorded using a Garmin GPS MAP 60 CX Navigator (Olathe, KS, USA). The locations of the populations are displayed in Figure 6. Trees within each population were sequentially numbered. Leaf samples were gathered, transported to the laboratory, and stored at −30 °C until further analysis.

4.2. DNA Extraction and Amplification

Genomic DNA was extracted using a modified CTAB method [35]. The concentration and purity of the extracted DNA were evaluated using a NanoDrop 1000 ultraviolet spectrophotometer (Thermo Scientific, Wilmington, NC, USA). The study employed SSR primers developed by Lepais et al. [24], as detailed in Table 2. PCR reactions were conducted in a total volume of 25 µL, which included 60 ng of template DNA, 12.5 µL of BioMaster HS-qPCR (2×) (Biolabmix, Novosibirsk, Russia), 1 µL of each primer (10 pmol), and 7.5 µL of ddH2O. PCR amplification was carried out in a SimpliAmp™ Thermal Cycler (Thermo Fisher Scientific Inc., Waltham, MA, USA) with the following cycling parameters: initial denaturation at 95 °C for 5 min; followed by 30 cycles of 95 °C for 20 s, 58 °C for 3 min, and 72 °C for 30 s; with a final extension at 60 °C for 30 min.
The amplified fragments were separated on an ABI3730xl automated genetic analyzer (Applied Biosystems, Tokyo, Japan) using POP7 polymer and GeneScan™ 500 LIZ® size standard. Fragment sizes were analyzed using GeneMapper 6.5 software (Applied Biosystems). The sizing of the amplified fragments was performed with GeneMarker® v2.2.0 software (SoftGenetics, State College, PA, USA). The forward primers used in the study were labeled fluorescently, as listed in Table 4. We used two multiplex mixes for PCR amplification. Mix 1 included the following loci: Ag05, Ag09, Ag10, Ag13, Ag14, Ag20, Ag25, and Ag30. Mix 2 comprised the following loci: Ag01, Ag23, Ag27, and Ag35. The device was calibrated for the corresponding dyes using the CS5 matrix standard (COrDIS, Russia).

4.3. Data Analysis

To characterize the 12 SSRs and assess the genetic diversity, the GenAlex 6.5 software [36], operating within MS Excel (Microsoft Corp., Redmond, WA, USA), was employed. The genetic diversity and structure of A. glutinosa across the seven populations were assessed using the following parameters: total number of alleles (Na) per locus, effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), unbiased expected heterozygosity (uHe), gene flow (Nm), Nei’s genetic differentiation (G’st), and unique alleles across the populations. The genetic diversity of the 78 sampled trees was further analyzed by calculating additional metrics across the seven populations, including sample size (N), allelic diversity (Na), the effective number of alleles (Ne), heterozygosity measures (Ho, He, and uHe), and Shannon’s Information Index (I).
Population differentiation was evaluated using F-statistics across the 12 SSR loci to quantify the proportion of genetic variance among populations relative to the total variance. An AMOVA was conducted to partition the genetic variance within and among the seven populations, providing insight into the distribution of genetic diversity. To further examine the genetic structure and relationships among the populations, a UPGMA phylogenetic tree was constructed based on Nei’s genetic distance. The tree was generated using the matplotlib.pyplot and scipy.cluster.hierarchy libraries in Python. Genetic analyses were performed using Python libraries. A heatmap of pairwise Fst values between populations was generated using seaborn and customized with matplotlib. Principal Coordinate analysis (PCoA) was conducted using scikit-learn for dimensionality reduction, and plots were created with matplotlib. The Mantel test, assessing the correlation between genetic and geographic distances, was performed with the pingouin library using 999 permutations.

5. Conclusions

This study represents the first investigation of A. glutinosa populations in Kazakhstan using SSR markers to assess genetic diversity and structure. The findings reveal that the seven A. glutinosa populations exhibit a high level of genetic diversity and relatively strong gene flow among them. The populations are grouped into three clusters, each reflecting distinct geographic distribution patterns. The insights gained from this study could contribute to the conservation efforts and formulation of genetic enhancement strategies for A. glutinosa, a species of significant ecological importance listed in the Red Book of Kazakhstan.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants13213032/s1, Table S1: Characterization of 12 simple sequence repeat loci in Alnus glutinosa based on 78 trees representing 7 populations, Table S2: F-statistics for all populations for each locus, Table S3: Summary AMOVA (Analysis of Molecular Variance) table for the populations studied.

Author Contributions

Conceptualization, A.K.; methodology, A.N., A.S., S.K. and O.B.; software, A.N. and A.S.; validation, A.K., A.N. and D.D.; formal analysis, S.I. and I.S.; investigation, A.K.; resources, A.K.; data curation, A.N.; writing—original draft preparation, A.K.; writing—review and editing, A.K. and A.N.; visualization, A.N.; supervision, A.K.; project administration, A.K.; funding acquisition, A.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was carried out within the framework of the target funding program of Ministry of Science and Higher Education BR18574125 “Studying the current state of species diversity of vascular plants of Kazakhstan using modern methods of botany, molecular genetics and bioinformatics” (2023–2024).

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Furlow, J.J. The systematics of the American species of Alnus (Betulaceae). Rhodora 1979, 81, 1–121. [Google Scholar]
  2. Chen, Z.D. Phylogeny and phytogeography of the Betulaceae (cont.). Acta Phytotax. Sin. 1994, 32, 101–153. [Google Scholar]
  3. Pliura, A. Possibilities for adaptation of Alnus glutinosa L. to changing environment. Biologija 2004, 50, 6–12. [Google Scholar]
  4. Perez, J.; Basaguren, A.; López-Rojo, N.; Tonin, A.M.; Correa-Araneda, F.; Boyero, L. The role of key plant species on litter decomposition in streams: Alder as experimental model. The ecology of plant litter decomposition in stream ecosystems. In The Ecology of Plant Litter Decomposition in Stream Ecosystems; Swan, C.M., Boyero, L., Canhoto, C., Eds.; Springer: Cham, Switzerland, 2021; pp. 143–161. [Google Scholar]
  5. Koblanova, S.A. The problem of landscaping recreational areas (on the example of Kostanay). Bull. Sci. KSTU Named Z. Aldamzhar 2020, 1, 10–12. (In Russian) [Google Scholar]
  6. Mingeot, D.; Baleux, R.; Watillon, B. Characterization of microsatellite markers for black alder (Alnus glutinosa [L.] Gaertn). Conserv. Genet. Resour. 2010, 2, 269–271. [Google Scholar] [CrossRef]
  7. Bibalani, G.H.; Bazhrang, Z.; Mohsenifar, H.; Joodi, L. The side roots pulling effect of alder (Alnus glutinosa) on river bank soil strong in North Iran. Int. J. Bot. 2008, 4, 290–296. [Google Scholar] [CrossRef]
  8. Cubry, P.; Gallagher, E.; O’Connor, E.; Kelleher, C.T. Phylogeography and population genetics of black alder (Alnus glutinosa (L.) Gaertn.) in Ireland: Putting it in a European context. Tree Genet. Genomes 2015, 11, 99. [Google Scholar] [CrossRef]
  9. Claessens, H.; Oosterbaan, A.; Savill, P.; Rondeux, J. A review of the characteristics of black alder (Alnus glutinosa (L.) Gaertn.) and their implications for silvicultural practices. Forestry 2010, 83, 163–175. [Google Scholar] [CrossRef]
  10. Resolution of the Government of the Republic of Kazakhstan Dated October 31, 2006 On Approval of the Lists of Rare and Endangered Species of Animals and Plants. Available online: https://adilet.zan.kz/rus/archive/docs/P060001034_/31.10.2006 (accessed on 15 August 2024).
  11. Makulbekova, G.B. Changes in alder forests of the Bayanaul mountain range. News Acad. Sci. Kazakh SSR 1996, 5, 21–24. (In Russian) [Google Scholar]
  12. Milkov, F.N. On the black alder forests of the middle Ilek. Geoscience 1950, 3, 124–127. (In Russian) [Google Scholar]
  13. Ivanov, V.V. Black alder in the Ural River valley. Priroda 1953, 2, 111–112. (In Russian) [Google Scholar]
  14. Sarsekova, D.N.; Boranbay, J.T.; Aishuk, E.J. Assessment of botanical and geographical growth and reproduction of some woody plants. Forestry 2022, 86, 250–253. (In Russian) [Google Scholar]
  15. Mingeot, D.; Husson, C.; Mertens, P.; Watillon, B.; Bertin, P.; Druart, P. Genetic diversity and genetic structure of black alder (Alnus glutinosa [L.] Gaertn) in the Belgium-Luxembourg-France cross-border area. Tree Genet. Genomes 2016, 12, 1–12. [Google Scholar] [CrossRef]
  16. Jurkšienė, G.; Tamošaitis, S.; Kavaliauskas, D.; Buchovska, J.; Danusevičius, D.; Baliuckas, V. Identification of Alnus glutinosa L. and A. incana (L.) Moench. Hybrids in Natural Forests Using Nuclear DNA Microsatellite and Morphometric Markers. Forests 2021, 12, 1504. [Google Scholar] [CrossRef]
  17. Koblanova, S.A. Intrapopulation variability of black alder of Northern Turgai. Res. Results 2008, 2, 22–124. (In Russian) [Google Scholar]
  18. Koblanova, S.A. Protection and rational use of alder forests of Northern Turgai. Sci. J. Bull. Sci. Kazakh Agrotech. Univ. Named S.Seifullin 2008, 145–148. (In Russian) [Google Scholar]
  19. Kadenova, A.B.; Kamkin, V.A.; Erzhanov, N.T.; Kamkina, E.V. Flora and vegetation of the Bayanaul State National Nature Park; Monograph: Pavlodar, Kazakhstan, 2008. (In Russian) [Google Scholar]
  20. Zhou, A.; Zong, D.; Gan, P.; Zhang, Y.; Li, D.; He, C. Genetic diversity and population structure of populus yunnanensis revealed by SSR markers. Pak. J. Bot. 2020, 52, 2147–2155. [Google Scholar] [CrossRef]
  21. Poncet, V.; Rondeau, M.; Tranchant, C.; Cayrel, A.; Hamon, S.; De Kochko, A.; Hamon, P. SSR mining in coffee tree EST databases: Potential use of EST–SSRs as markers for the Coffea genus. Mol. Genet. Genom. 2006, 276, 436–449. [Google Scholar] [CrossRef]
  22. Ferreira-Ramos, R.; Laborda, P.R.; de Oliveira Santos, M.; Mayor, M.S.; Mestriner, M.A.; de Souza, A.P.; Alzate-Marin, A.L. Genetic analysis of forest species Eugenia uniflora L. through of newly developed SSR markers. Conserv. Genet. 2008, 9, 1281–1285. [Google Scholar] [CrossRef]
  23. Lepais, O.; Bacles, C.F.E. De novo discovery and multiplexed amplification of microsatellite markers for black alder (Alnus glutinosa) and related species using SSR-enriched shotgun pyrosequencing. J. Hered. 2011, 102, 627–632. [Google Scholar] [CrossRef]
  24. Martín, M.A.; Moreno, R.; Die, J.V.; Cabrera, A.; Castro, P.; Pérez, M.D.; Solla, A. Distribution, diversity and genetic structure of alders (Alnus lusitanica and A. glutinosa) in Spain. For. Ecol. Manag. 2024, 562, 121922. [Google Scholar] [CrossRef]
  25. Drašnarová, A.; Krak, K.; Vít, P.; Doudová, J.; Douda, J.; Hadincová, V.; Mandák, B. Cross-amplification and multiplexing of SSR markers for Alnus glutinosa and A. incana. Tree Genet. Genomes 2014, 10, 865–873. [Google Scholar] [CrossRef]
  26. Guo, H.Y.; Wang, Z.L.; Huang, Z.; Chen, Z.; Yang, H.B.; Kang, X.Y. Genetic diversity and population structure of Alnus cremastogyne as revealed by microsatellite markers. Forests 2019, 10, 278. [Google Scholar] [CrossRef]
  27. Poljak, I.; Idžojtić, M.; Šapić, I.; Korijan, P.; Vukelić, J. Diversity and Structure of Croatian Continental and Alpine-Dinaric Populations of Grey Alder (Alnus incana/L./Moench Subsp. Incana); Isolation by Distance and Environment Explains Phenotypic Divergence. Šumarski List. 2018, 142, 19–31. [Google Scholar]
  28. Gomes Marques, I.; Vieites-Blanco, C.; Barrento, M.J.; Semedo, J.N.; Rodrigues, A.P.; Scotti-Campos, P.; Rodríguez-González, P.M. Phenotypic variation and genetic diversity in European Alnus species. For. An. Int. J. For. Res. 2024, 142, cpae039. [Google Scholar] [CrossRef]
  29. Jones, J.M.; Gibson, J.P. Population genetic diversity and structure within and among disjunct populations of Alnus maritima (seaside alder) using microsatellites. Conserv. Genet. 2011, 12, 1003–1013. [Google Scholar] [CrossRef]
  30. McVean, D.N. Alnus glutinosa (L.) Gaertn. J. Ecol. 1953, 41, 447–466. [Google Scholar] [CrossRef]
  31. Brasier, C.M.; Kirk, S.A.; Delcan, J.; Cooke, D.L.; Jung, T.; In’t Veld, M. Phytophthora alni sp nova и ее варианты: Oбoзначение группы нoвых гетерoплoидных гибридных патoгенoв. Mycol. Res. 2004, 108, 1172–1184. [Google Scholar] [CrossRef]
  32. José, M.C.S.; Valladares, S.; Janeiro, L.V.; Corredoira, E. Cryopreservation of in vitro-grown shoot tips of Alnus glutinosa (L.) Gaertn. Acta Physiol. Plant. 2014, 36, 109–116. [Google Scholar] [CrossRef]
  33. San José, M.D.C.; Janeiro, L.V.; Martínez, M.T.; Valladares, S.; Cernadas, M.J.; Montenegro, R.; Corredoira, E. Biotechnological Approaches for the Improvement and Conservation of Alnus glutinosa (L.) Gaertner. Plant Tissue Cult. Propag. Conserv. Crop Improv. 2016, 467–486. [Google Scholar]
  34. Buiteveld, J.; Copini, P.; Hendriks, C.M.A. Conservation and Sustainable Use of Forest Genetic Resources for Food and Agriculture: Country Report of the Netherlands for the Second State of the World’s Forest Genetic Resources for Food and Agriculture; No. 54; Wageningen University & Research, Centre for Genetic Resources (CGN): Wageningen, The Netherlands, 2021. [Google Scholar]
  35. Doyle, J.J. A rapid total DNA preparation procedure for fresh plant tissue. Focus 1990, 12, 13–15. [Google Scholar]
  36. Peakall, R.; Smouse, P. GENALEX 6: Genetic analysis in excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
Figure 1. Heatmap of paired Fst values among A. glutinosa populations.
Figure 1. Heatmap of paired Fst values among A. glutinosa populations.
Plants 13 03032 g001
Figure 2. Results of analysis of molecular variance (AMOVA) of seven populations of A. glutinosa.
Figure 2. Results of analysis of molecular variance (AMOVA) of seven populations of A. glutinosa.
Plants 13 03032 g002
Figure 3. Population genetic structure: UPGMA cluster analysis of seven A. glutinosa populations based on Nei’s genetic distance.
Figure 3. Population genetic structure: UPGMA cluster analysis of seven A. glutinosa populations based on Nei’s genetic distance.
Plants 13 03032 g003
Figure 4. Principal coordinate analysis of seven A. glutinosa populations.
Figure 4. Principal coordinate analysis of seven A. glutinosa populations.
Plants 13 03032 g004
Figure 5. A. glutinosa growing in the Bayanaul mountain forest massif and northern Turgay of northern Kazakhstan: (a) A. glutinosa growing in the Bayanaul mountain forest massif; (b) A. glutinosa growing in northern Turgay.
Figure 5. A. glutinosa growing in the Bayanaul mountain forest massif and northern Turgay of northern Kazakhstan: (a) A. glutinosa growing in the Bayanaul mountain forest massif; (b) A. glutinosa growing in northern Turgay.
Plants 13 03032 g005
Figure 6. Collection site of seven populations of A. glutinosa in the Bayanaul mountain forest massif and northern Turgay in northern Kazakhstan.
Figure 6. Collection site of seven populations of A. glutinosa in the Bayanaul mountain forest massif and northern Turgay in northern Kazakhstan.
Plants 13 03032 g006
Table 1. Number of individuals carrying unique alleles by population.
Table 1. Number of individuals carrying unique alleles by population.
LocusAllele SizePopulation
KS1PVL3PVL4PVL5PVL6
Ag011352----
Ag051591----
Ag132595----
283-1---
Ag1429310----
2951----
3152----
325--2--
Ag20311---1-
3132----
Ag30102---1-
Ag35183----1
2093----
Table 2. Genetic diversity of 78 A. glutinosa trees representing seven populations in northern Turgay and Bayanaul mountain forest massif based on 12 microsatellite loci.
Table 2. Genetic diversity of 78 A. glutinosa trees representing seven populations in northern Turgay and Bayanaul mountain forest massif based on 12 microsatellite loci.
PopulationNNaNeHoHeuHeI
KS1215.0003.2460.5830.6340.6491.248
KS263.6672.6290.6810.5420.5910.998
PVL3103.6672.8340.5330.5860.6171.068
PVL4113.7502.8230.5610.5540.5801.038
PVL593.6672.4690.4910.5040.5340.948
PVL693.5832.7080.5830.5570.5891.019
PVL7123.9172.7750.5560.5580.5831.051
Mean11.1433.8932.7830.5700.5620.5921.053
N: number of alleles; Na: number of different alleles; Ne: number of effective alleles; Ho: observed heterozygosity; He: expected heterozygosity; uHe: unbiased expected heterozygosity; I: Shannon’s Information Index.
Table 3. Locations and numbers of trees sampled in seven A. glutinosa populations.
Table 3. Locations and numbers of trees sampled in seven A. glutinosa populations.
PopulationLocationLatitude (N)Longitude (E)Elevation (m)Sample Size
KS1Northern Turgay52°32′39″64°46′46″130–16014
KS252°32′22″64°45′44″120–16013
PVL3Bayanaul mountain forest massif50°48′354″75°42′893″483–49810
PVL450°49′595″75°39′729″477–50411
PVL550°50′745″75°32′345″381–3889
PVL650°51′698″75°34′315″401–4069
PVL750°48′640″75°45′450″459–46712
Table 4. Characteristics of 12 microsatellite primers (SSRs) used in this study.
Table 4. Characteristics of 12 microsatellite primers (SSRs) used in this study.
LociPrimer SequencesDye
Ag01F: CAGTCTATCTGCTACAAGCGTGGTFAM
R: GACGTTTTCAACGACCAAAAACAC
Ag05F: AAGCAAAATCCCAAGGTATCCAGTFAM
R: GGGGTTCCAACCAATTTATTCTTC
Ag09F: GATGGTAATGTGACGTGAGCAAAAROX
R: CCTATTCTCATCGTTTAAAGCCCC
Ag10F: AACTTGTCTTATTGTGCACTTGCGFAM
R: ACATTTACGGCTAAACAGCATTCC
Ag13F: CAAGCGAAATAGATTCGTGGTCTTR6S
R: CTTCCATTTGGAGCCTTAAAACAC
Ag14F: CAACCAACAAGGAGACAGAAACAAFAM
R: TAAAATCTAACACCCCAAACGAGG
Ag20F: GGTTCCAAGTGGTAAGGGGAGTTATAMRA
R: GAGTGTGAGAATGTGGTTCACGAG
Ag23F: GGTTGGGCGAAAGTTTTATTTACACR6G
R:CCAGAAACGAACTAAGGCTAAGAAGA
Ag25F: GGATAAGAAGATAAAGGTGCATGGCROX
R: CTGTATATCCCCACCACACCTGA
Ag27F: CATTTGGTGTATGTGTTGCCAGTTROX
R: AATCAACAACTGCCAGGTAGAGGA
Ag30F: GGAACTCTGGAAACAGAAACAACGFAM
R: AGCAAGGTAAAACTTCAGTAGCCG
Ag35F: CACGTTCAGCTTCATTGTGACTTCROX
R: TAATAGGGTTTGGGCCAACTTACC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Nurtaza, A.; Dyussembekova, D.; Shevtsov, A.; Islamova, S.; Samatova, I.; Koblanova, S.; Borodulina, O.; Kakimzhanova, A. Assessing Genetic Variability and Population Structure of Alnus glutinosa (Black Alder) in Kazakhstan Using SSR Markers. Plants 2024, 13, 3032. https://doi.org/10.3390/plants13213032

AMA Style

Nurtaza A, Dyussembekova D, Shevtsov A, Islamova S, Samatova I, Koblanova S, Borodulina O, Kakimzhanova A. Assessing Genetic Variability and Population Structure of Alnus glutinosa (Black Alder) in Kazakhstan Using SSR Markers. Plants. 2024; 13(21):3032. https://doi.org/10.3390/plants13213032

Chicago/Turabian Style

Nurtaza, Aidana, Damira Dyussembekova, Alexandr Shevtsov, Symbat Islamova, Indira Samatova, Saule Koblanova, Olga Borodulina, and Almagul Kakimzhanova. 2024. "Assessing Genetic Variability and Population Structure of Alnus glutinosa (Black Alder) in Kazakhstan Using SSR Markers" Plants 13, no. 21: 3032. https://doi.org/10.3390/plants13213032

APA Style

Nurtaza, A., Dyussembekova, D., Shevtsov, A., Islamova, S., Samatova, I., Koblanova, S., Borodulina, O., & Kakimzhanova, A. (2024). Assessing Genetic Variability and Population Structure of Alnus glutinosa (Black Alder) in Kazakhstan Using SSR Markers. Plants, 13(21), 3032. https://doi.org/10.3390/plants13213032

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop