A Comparison of DNA-Methylation during Protoplast Culture of Ponkan Mandarin (Citrus reticulata Blanco) and Tobacco (Nicotiana tabacum L.)
Abstract
1. Introduction
2. Results
2.1. DNA Methylation Changes during Protoplast Isolation and Culture Process
2.1.1. Observations during Protoplast Culture and Selection of MSAP Analysis Nodes
2.1.2. Analysis of Genomic DNA Methylation Levels during Protoplast Isolation and Culture Process
2.1.3. Analysis of DNA Methylation Patterns during Protoplast Isolation and Culture Process
2.2. Specific Methylation Modification Site Sequence Analysis
3. Discussion
4. Materials and Methods
4.1. Experimental Materials
4.2. Experimental Methods
4.2.1. Isolation and Culture of Protoplasts
4.2.2. Genomic DNA Extraction
4.2.3. Genomic MSAP Analysis
Restrictive Enzyme Digestion
Joint Connection
Pre-Amplification and Selective Amplification
Non-Denaturing Polyacrylamide Gel Electrophoresis
4.2.4. Methylation-Specific Fragment Recovery, Cloning, and Sequencing
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Mahmoud, L.M.; Killiny, N.; Holden, P.; Gmitter, F.G.; Grosser, J.W.; Dutt, M. Physiological and Biochemical Evaluation of Salt Stress Tolerance in a Citrus Tetraploid Somatic Hybrid. Horticulturae 2023, 9, 1215. [Google Scholar] [CrossRef]
- Xu, Y.; Li, R.; Luo, H.; Wang, Z.; Li, M.W.; Lam, H.M.; Huang, C. Protoplasts: Small cells with big roles in plant biology. Trends Plant Sci. 2022, 27, 828–829. [Google Scholar] [CrossRef] [PubMed]
- Shao, J.; Peng, B.; Zhang, Y.; Yan, X.; Yao, X.; Hu, X.; Li, L.; Fu, X.; Zheng, H.; Tang, K. A high-efficient protoplast transient system for screening gene editing elements in Salvia miltiorrhiza. Plant Cell Rep. 2024, 43, 45. [Google Scholar] [CrossRef]
- Su, W.; Xu, M.; Radani, Y.; Yang, L. Technological Development and Application of Plant Genetic Transformation. Int. J. Mol. Sci. 2023, 24, 10646. [Google Scholar] [CrossRef]
- Ning, Y.; Hu, B.; Yu, H.; Liu, X.; Jiao, B.; Lu, X. Optimization of Protoplast Preparation and Establishment of Genetic Transformation System of an Arctic-Derived Fungus Eutypella sp. Front. Microbiol. 2022, 13, 769008. [Google Scholar] [CrossRef]
- Wang, P.; Pu, Y.; Abid, M.A.; Kang, L.; Ye, Y.; Zhang, M.; Liang, C.; Wei, Y.; Zhang, R.; Meng, Z. A Rapid and Efficient Method for Isolation and Transformation of Cotton Callus Protoplast. Int. J. Mol. Sci. 2022, 23, 8368. [Google Scholar] [CrossRef]
- Wang, J.; Wang, Y.; Lu, T.; Yang, X.; Liu, J.; Dong, Y.; Wang, Y. An Efficient and Universal Protoplast Isolation Protocol Suitable for Transient Gene Expression Analysis and Single-Cell RNA Sequencing. Int. J. Mol. Sci. 2022, 23, 3419. [Google Scholar] [CrossRef] [PubMed]
- Han, X.; Rong, H.; Feng, Y.; Xin, Y.; Luan, X.; Zhou, Q.; Xu, M.; Xu, L.A. Protoplast isolation and transient transformation system for Ginkgo biloba L. Front. Plant Sci. 2023, 14, 1145754. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Xu, L.; Liu, X.; Xin, L.; Wu, S.; Chen, X. Development of potent promoters that drive the efficient expression of genes in apple protoplasts. Hortic. Res. 2021, 8, 211. [Google Scholar] [CrossRef]
- Chen, S.; Tao, L.; Zeng, L.; Vega-Sanchez, M.E.; Umemura, K.; Wang, G.L. A highly efficient transient protoplast system for analyzing defence gene expression and protein-protein interactions in rice. Mol. Plant Pathol. 2006, 7, 417–427. [Google Scholar] [CrossRef]
- Xing, S.; Wallmeroth, N.; Berendzen, K.W.; Grefen, C. Techniques for the Analysis of Protein-Protein Interactions in Vivo. Plant Physiol. 2016, 171, 727–758. [Google Scholar] [CrossRef] [PubMed]
- Priyadarshani, S.; Hu, B.; Li, W.; Ali, H.; Jia, H.; Zhao, L.; Ojolo, S.P.; Azam, S.M.; Xiong, J.; Yan, M.; et al. Simple protoplast isolation system for gene expression and protein interaction studies in pineapple (Ananas comosus L.). Plant Methods 2018, 14, 95. [Google Scholar] [CrossRef] [PubMed]
- Struk, S.; Jacobs, A.; Sanchez Martin-Fontecha, E.; Gevaert, K.; Cubas, P.; Goormachtig, S. Exploring the protein-protein interaction landscape in plants. Plant Cell Environ. 2019, 42, 387–409. [Google Scholar] [CrossRef]
- Gilliard, G.; Huby, E.; Cordelier, S.; Ongena, M.; Dhondt-Cordelier, S.; Deleu, M. Protoplast: A Valuable Toolbox to Investigate Plant Stress Perception and Response. Front. Plant Sci. 2021, 12, 749581. [Google Scholar] [CrossRef]
- Eeckhaut, T.; Lakshmanan, P.S.; Deryckere, D.; Van Bockstaele, E.; Van Huylenbroeck, J. Progress in plant protoplast research. Planta 2013, 238, 991–1003. [Google Scholar] [CrossRef]
- Xing, T.; Wang, X. Protoplasts in plant signaling analysis: Moving forward in the omics era. Botany 2015, 93, 325–332. [Google Scholar] [CrossRef]
- Reyna-Llorens, I.; Ferro-Costa, M.; Burgess, S.J. Plant protoplasts in the age of synthetic biology. J. Exp. Bot. 2023, 74, 3821–3832. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.X.; Du, Q.W.; Tian, C.H.; Wang, Y.; Jiao, Y.L. Stochastic gene expression drives mesophyll protoplast regeneration. Sci. Adv. 2021, 7, eabg8466. [Google Scholar] [CrossRef] [PubMed]
- Reed, K.M.; Bargmann, B.O.R. Protoplast Regeneration and Its Use in New Plant Breeding Technologies. Front. Genome Ed. 2021, 3, 734951. [Google Scholar] [CrossRef]
- Fossi, M.; Amundson, K.; Kuppu, S.; Britt, A.; Comai, L. Regeneration of Solanum tuberosum Plants from Protoplasts Induces Widespread Genome Instability. Plant Physiol. 2019, 180, 78–86. [Google Scholar] [CrossRef]
- Yue, J.J.; Yuan, J.L.; Wu, F.H.; Yuan, Y.H.; Cheng, Q.W.; Hsu, C.T.; Lin, C.S. Protoplasts: From Isolation to CRISPR/Cas Genome Editing Application. Front. Genome Ed. 2021, 3, 717017. [Google Scholar] [CrossRef] [PubMed]
- Klimek-Chodacka, M.; Kadluczka, D.; Lukasiewicz, A.; Malec-Pala, A.; Baranski, R.; Grzebelus, E. Effective callus induction and plant regeneration in callus and protoplast cultures of Nigella damascena L. Plant Cell Tissue Organ Cult. PCTOC 2020, 143, 693–707. [Google Scholar] [CrossRef]
- Jeong, Y.Y.; Lee, H.Y.; Kim, S.W.; Noh, Y.S.; Seo, P.J. Optimization of protoplast regeneration in the model plant Arabidopsis thaliana. Plant Methods 2021, 17, 21. [Google Scholar] [CrossRef]
- Papadakis, A.K.; Roubelakis-Angelakis, K.A. Oxidative stress could be responsible for the recalcitrance of plant protoplasts. Plant Physiol. Biochem. 2002, 40, 549–559. [Google Scholar] [CrossRef]
- Xu, X.; Xie, G.; He, L.; Zhang, J.; Xu, X.; Qian, R.; Liang, G.; Liu, J.-H. Differences in oxidative stress, antioxidant systems, and microscopic analysis between regenerating callus-derived protoplasts and recalcitrant leaf mesophyll-derived protoplasts of Citrus reticulata Blanco. Plant Cell Tissue Organ Cult. PCTOC 2013, 114, 161–169. [Google Scholar] [CrossRef]
- Vining, K.; Pomraning, R.K.; Wilhelm, J.L.; Ma, C.; Pellegrini, M.; Di, Y.M.; Mockler, C.T.; Freitag, M.; Steven, H.S. Methylome reorganization during in vitro dedifferentiation and regeneration of Populus trichocarpa. BMC Plant Biol. 2013, 13, 92. [Google Scholar] [CrossRef]
- Lee, S.; Park, Y.S.; Rhee, J.H.; Chu, H.; Frost, J.M.; Choi, Y. Insights into plant regeneration: Cellular pathways and DNA methylation dynamics. Plant Cell Rep. 2024, 43, 120. [Google Scholar] [CrossRef]
- Cápal, P.; Ondřej, V. Expression and epigenetic profile of protoplast cultures (Cucumis sativus L.). Vitr. Cell. Dev. Biol. Plant 2014, 50, 789–794. [Google Scholar] [CrossRef]
- Pavla, M.; Vladan, O.; Božena, N.; Lenka, L. Changes of DNA methylation and hydroxymethylation in plant protoplast cultures. Actia Biochim. Pol. 2013, 60, 33–36. [Google Scholar]
- Gupta, V.; Bijo, A.J.; Kumar, M.; Reddy, C.R.; Jha, B. Detection of epigenetic variations in the protoplast-derived germlings of Ulva reticulata using methylation sensitive amplification polymorphism (MSAP). Mar. Biotechnol. 2012, 14, 692–700. [Google Scholar] [CrossRef]
- Groote, L.d.M.; Verschure, J.P.; Rots, G.M. Epigenetic Editing: Targeted rewriting of epigenetic marks to modulate expression of selected target genes. Nucleic Acids Res. 2012, 40, 10596–10613. [Google Scholar] [CrossRef] [PubMed]
- Kungulovski, G.; Jeltsch, A. Epigenome Editing: State of the Art, Concepts, and Perspectives. Trends Genet. 2016, 32, 101–113. [Google Scholar] [CrossRef] [PubMed]
- Nadakuduti, S.S.; Starker, C.G.; Ko, D.K.; Jayakody, T.B.; Buell, C.R.; Voytas, D.F.; Douches, D.S. Evaluation of Methods to Assess in vivo Activity of Engineered Genome-Editing Nucleases in Protoplasts. Front. Plant Sci. 2019, 10, 110. [Google Scholar] [CrossRef] [PubMed]
- Scintilla, S.; Salvagnin, U.; Giacomelli, L.; Zeilmaker, T.; Malnoy, M.A.; Rouppe van der Voort, J.; Moser, C. Regeneration of non-chimeric plants from DNA-free edited grapevine protoplasts. Front. Plant Sci. 2022, 13, 1078931. [Google Scholar] [CrossRef]
- Zheng, B.; Liu, J.; Gao, A.; Chen, X.; Gao, L.; Liao, L.; Luo, B.; Ogutu, C.O.; Han, Y. Epigenetic reprogramming of H3K27me3 and DNA methylation during leaf-to-callus transition in peach. Hortic. Res. 2022, 9, uhac132. [Google Scholar] [CrossRef]
- Guo, W.W.; Xiao, S.X.; Deng, X.X. Somatic cybrid production via protoplast fusion for citrus improvement. Sci. Hortic. 2013, 163, 20–26. [Google Scholar] [CrossRef]
- Kaushal, V.; Banerjee, D.; Kumar, S.; Wani, A.W.; Gurung, N.; Verma, A.; Kumar, S.; Mhaske, T.; Qureshi, D.S.N. Somatic hybridization on different horticultural crops: A review. Int. J. Adv. Biochem. Res. 2024, 8, 4–13. [Google Scholar] [CrossRef]
- Tiwari, J.K.; Rawat, S.; Luthra, S.K.; Zinta, R.; Sahu, S.; Varshney, S.; Kumar, V.; Dalamu, D.; Mandadi, N.; Kumar, M.; et al. Genome sequence analysis provides insights on genomic variation and late blight resistance genes in potato somatic hybrid (parents and progeny). Mol. Biol. Rep. 2021, 48, 623–635. [Google Scholar] [CrossRef]
- Kumari, P.; Singh, K.P.; Kumar, S.; Yadava, D.K. Development of a Yellow-Seeded Stable Allohexaploid Brassica through Inter-Generic Somatic Hybridization With a High Degree of Fertility and Resistance to Sclerotinia sclerotiorum. Front. Plant Sci. 2020, 11, 575591. [Google Scholar] [CrossRef]
- Tusa, N.; Ferrauto, G.; Calderaro, E. Investigations on protoplast regeneration from leaves of monoembryonic and polyembryonic citrus species. In Proceedings of the International Citrus Congress, Acireale, Italy, 8–13 March 1992; pp. 180–182. [Google Scholar]
- Guarino, F.; Heinze, B.; Castiglione, S.; Cicatelli, A. Epigenetic Analysis through MSAP-NGS Coupled Technology: The Case Study of White Poplar Monoclonal Populations/Stands. Int. J. Mol. Sci. 2020, 21, 7393. [Google Scholar] [CrossRef]
- Gonzalez-Benito, M.E.; Ibanez, M.A.; Pirredda, M.; Mira, S.; Martin, C. Application of the MSAP Technique to Evaluate Epigenetic Changes in Plant Conservation. Int. J. Mol. Sci. 2020, 21, 7459. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Wang, W.; Lu, X.; Zhang, T.; Wu, J.; Fang, Y.; Ma, L.; Pu, Y.; Yang, G.; Wang, W.; et al. Methyl-Sensitive Amplification Polymorphism (MSAP) Analysis Provides Insights into the DNA Methylation Changes Underlying Adaptation to Low Temperature of Brassica rapa L. Plants 2024, 13, 1748. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.B.; Xu, Q.; Liu, C.C.; Liu, B.H.; Deng, C.L.; Chen, C.W.; Wei, Z.M.; Ahmad, H.M.; Peng, K.; Wen, H.; et al. Downregulated expression of S2-RNase attenuates self-incompatibility in “Guiyou No. 1” pummelo. Hortic. Res. 2021, 8, 199. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, J.P.d.M.; Sanglard, N.A.; Ferreira, A.; Clarindo, W.R. Genomic Methylated Cytosine Level during the Dedifferentiation and Cellular Competence in Coffea arabica Lines: Insights about the Different In Vitro Responses. Forests 2021, 12, 1536. [Google Scholar] [CrossRef]
- Stroud, H.; Ding, B.; Simon, S.A.; Feng, S.; Bellizzi, M.; Pellegrini, M.; Wang, G.L.; Meyers, B.C.; Jacobsen, S.E. Plants regenerated from tissue culture contain stable epigenome changes in rice. elife 2013, 2, e00354. [Google Scholar] [CrossRef]
- Ghosh, A.; Igamberdiev, A.U.; Debnath, S.C. Tissue culture-induced DNA methylation in crop plants: A review. Mol. Biol. Rep. 2021, 48, 823–841. [Google Scholar] [CrossRef]
- Ibanez, S.; Carneros, E.; Testillano, P.S.; Perez-Perez, J.M. Advances in Plant Regeneration: Shake, Rattle and Roll. Plants 2020, 9, 897. [Google Scholar] [CrossRef]
- Zhang, H.; Lang, Z.; Zhu, J.K. Dynamics and function of DNA methylation in plants. Nat. Rev. Mol. Cell Biol. 2018, 19, 489–506. [Google Scholar] [CrossRef]
- Zhang, X.Y.; Yazaki, J.; Sundaresan, A.; Cokus, S.; Chan, W.S.; Chen, H.M.; Henderson, R.I.; Shinn, P.; Pellegrini, M.; Jacobsen, E.S.; et al. Genome wide high resolution mapping and functional analysis of DNA methylaiton in Arabidopisis. Cell 2006, 126, 1189–1201. [Google Scholar] [CrossRef]
- Teixeira, F.K.; Colot, V. Gene body DNA methylation in plants: A means to an end or an end to a means? EMBO J. 2009, 28, 997–998. [Google Scholar] [CrossRef]
- Zilberman, D.; Henikoff, S. Genome-wide analysis of DNA methylation patterns. Development 2007, 134, 3959–3965. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.M.; Zilberman, D. DNA methylation as a system of plant genomic immunity. Trends Plant Sci. 2014, 19, 320–326. [Google Scholar] [CrossRef] [PubMed]
- Espada, J.; Esteller, M. DNA methylation and the functional organization of the nuclear compartment. Semin. Cell Dev. Biol. 2010, 21, 238–246. [Google Scholar] [CrossRef] [PubMed]
- Stoccoro, A.; Coppede, F. Mitochondrial DNA Methylation and Human Diseases. Int. J. Mol. Sci. 2021, 22, 4594. [Google Scholar] [CrossRef] [PubMed]
- Umen, J.G.; Goodenough, U.W. Chloroplast DNA methylation and inheritance in Chlamydomonas. Genes Dev. 2001, 15, 2585–2597. [Google Scholar] [CrossRef]
- Shaikh, A.; Chachar, S.; Chachar, M.; Ahmed, N.; Guan, C.; Zhang, P. Recent Advances in DNA Methylation and Their Potential Breeding Applications in Plants. Horticulturae 2022, 8, 562. [Google Scholar] [CrossRef]
- Cheng, Y.J.; Yi, H.L.; Pang, X.M.; Guo, W.W.; Deng, X.X. An efficient method for genomic DNA extraction from woody fruit plants. J. Huazhong Agric. Univ. 2001, 21, 481–483. [Google Scholar]
- Hao, Y.J. In Vitro Conservation and Genetic Variation of Important Fruit Crops; Huazhong Agricuture University: Wuhan, China, 2000. [Google Scholar]
Samples | Total Fragments | Non-Methylation CCGG Sites | Methylation CCGG Site | ||
---|---|---|---|---|---|
Half Methylation Site | Full Methylation Site | Total | |||
L | 1004 | 741 | 68 (6.77%) | 195 (19.42%) | 263 (26.20%) |
LP0 | 1004 | 701 | 71 (7.07%) | 232 (23.11%) | 303 (30.18%) |
LP3 | 1004 | 732 | 63 (6.27%) | 209 (20.82%) | 272 (27.09%) |
LP6 | 1004 | 696 | 72 (7.17%) | 236 (23.51%) | 308 (30.68%) |
C | 972 | 688 | 55 (5.66%) | 229 (23.56%) | 284 (29.22%) |
CP0 | 972 | 705 | 57 (5.86%) | 210 (21.60%) | 267 (27.47%) |
CP4 | 972 | 702 | 61 (6.28%) | 209 (21.50%) | 270 (27.78%) |
CP8 | 972 | 724 | 43 (4.42%) | 205 (21.09%) | 248 (23.51%) |
TL | 558 | 380 | 40 (7.71%) | 195 (24.73%) | 178 (31.90%) |
TLP0 | 558 | 393 | 42 (7.53%) | 232 (22.04%) | 165 (29.57%) |
TLP1 | 558 | 398 | 50 (8.96%) | 209 (20.25%) | 160 (28.67%) |
TLP2 | 558 | 396 | 45 (8.06%) | 236 (20.97%) | 162 (29.30%) |
No. | Fragment Length (bp) | BLASTn Homolog Sequence Annotation | Similarity % | E Value |
---|---|---|---|---|
P8 | 111 | Linoleate 13S-lipoxygenase 3-1, chloroplastic | 65/65 (100%) | 1 × 10−29 |
P9 | 124 | CBL-interacting serine/threonine–protein kinase 14, regulatory pathway | 123/123 (100%) | 3 × 10−64 |
P14 | 90 | Hypothetical protein | 75/88 (85%) | 2 × 10−12 |
P15 | 48 | Xylem cysteine proteinase 1, chymopapain, papaya proteinase 4, caricain, papain, oryzain alpha chain | 46/48 (95%) | 3 × 10−15 |
P20 | 295 | Putative uncharacterized protein Sb01g000365 (fragment) | 293/293 (100%) | 1 × 10−165 |
P23 | 92 | E3 ubiquitin–protein ligase RNF12-B, E3 ubiquitin–protein ligase RLIM, putative RING-H2 finger protein ATL53 | 90/90 (100%) | 9 × 10−45 |
P25 | 121 | Putative uncharacterized protein Sb03g046360, NAD kinase 2, chloroplastic, probable NAD kinase 2, chloroplastic | 119/121 (98%) | 2 × 10−58 |
P28 | 97 | Calcium-dependent protein kinase isoform 2, calcium-dependent protein kinase 33 | 37/37 (100% | 4 × 10−13 |
P19 | 112 | LRR receptor-like serine/threonine–protein kinase FLS2, | 112/112 (100%) | 9 × 10−58 |
P30 | 45 | chain A, three-dimensional structure of an RNA polymerase II binding protein | 44/44 (100%) | 1 × 10−17 |
P32 | 294 | Hydroxycinnamoyl CoA shikimate/quinate hydroxycinnamoyltransferase-like protein (fragment), | 248/249 (99%) | 1 × 10−137 |
P39 | 51 | Myosin-J heavy chain | 51/51 (100%) | 8 × 10−22 |
P46 | 229 | U micrococcal nuclease, protein parB, probable endonuclease LCL3, nuclease (SNase domain-containing protein) (precursor) | 228/229 (99%) | 1 × 10−125 |
P53 | 86 | Leucine-rich repeat containing protein, putative, putative disease resistance protein RGA3 | 81/82 (98%) | 1 × 10−37 |
P55 | 46 | Glycoside hydrolase family 28 protein/polygalacturonase (pectinase) family protein | 46/46 (100%) | 7 × 10−19 |
Adaptor and Primer (5′→3′) | Sequence (5′→3′) | Adaptor and Primer (5′→3′) | Sequence (5′→3′) |
---|---|---|---|
EcoR I adapter-5 | CTCGTAGACTGCGTACC | H+M+TAT | ATCATGAGTCCTGCTCGGTAT |
EcoRI adapter-3 | AATTGGTACGCAGTCTAC | H+M+TCT | ATCATGAGTCCTGCTCGGTCT |
Hpa II- Msp I adapter-5 | GATCATGAGTCCTGCT | H+M+TGT | ATCATGAGTCCTGCTCGGTGT |
Hpa II- Msp I adapter-3 | CGAGCAGGACTCATGA | EA01 | GACTGCGTACCAATTCATC |
H+M+T | ATCATGAGTCCTGCTCGGT | EA02 | GACTGCGTACCAATTCATG |
EA00 | GACTGCGTACCAATTCA | EA03 | GACTGCGTACCAATTCACC |
H+M+TAC | ATCATGAGTCCTGCTCGGTAC | EA04 | GACTGCGTACCAATTCAGG |
H+M+TAG | ATCATGAGTCCTGCTCGGTAG | EA05 | GACTGCGTACCAATTCAAC |
H+M+TTC | ATCATGAGTCCTGCTCGGTTC | EA06 | GACTGCGTACCAATTCAAG |
H+M+TTG | ATCATGAGTCCTGCTCGGTTG | EA07 | GACTGCGTACCAATTCACT |
H+M+TCC | ATCATGAGTCCTGCTCGGTCC | EA08 | GACTGCGTACCAATTCAGT |
H+M+TGG | ATCATGAGTCCTGCTCGGTGG | EA09 | GACTGCGTACCAATTCAAT |
H+M+TCA | ATCATGAGTCCTGCTCGGTCA | EA10 | GACTGCGTACCAATTCATA |
H+M+TGA | ATCATGAGTCCTGCTCGGTGA | EA11 | GACTGCGTACCAATTCACA |
H+M+TTA | ATCATGAGTCCTGCTCGGTTA | EA12 | GACTGCGTACCAATTCAGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, L.; Zhang, J.; Xu, X. A Comparison of DNA-Methylation during Protoplast Culture of Ponkan Mandarin (Citrus reticulata Blanco) and Tobacco (Nicotiana tabacum L.). Plants 2024, 13, 2878. https://doi.org/10.3390/plants13202878
Wang L, Zhang J, Xu X. A Comparison of DNA-Methylation during Protoplast Culture of Ponkan Mandarin (Citrus reticulata Blanco) and Tobacco (Nicotiana tabacum L.). Plants. 2024; 13(20):2878. https://doi.org/10.3390/plants13202878
Chicago/Turabian StyleWang, Lun, Jiaojiao Zhang, and Xiaoyong Xu. 2024. "A Comparison of DNA-Methylation during Protoplast Culture of Ponkan Mandarin (Citrus reticulata Blanco) and Tobacco (Nicotiana tabacum L.)" Plants 13, no. 20: 2878. https://doi.org/10.3390/plants13202878
APA StyleWang, L., Zhang, J., & Xu, X. (2024). A Comparison of DNA-Methylation during Protoplast Culture of Ponkan Mandarin (Citrus reticulata Blanco) and Tobacco (Nicotiana tabacum L.). Plants, 13(20), 2878. https://doi.org/10.3390/plants13202878