Assessment of Population Genetic Diversity of Medicinal Meconopsis integrifolia (Maxim.) Franch. Using Newly Developed SSR Markers
Abstract
1. Introduction
2. Results
2.1. SSR Markers’ Development and Their Characterizations
2.2. Assessment of Novel SSRs, Primer Design, and Genetic Diversity Statistics
2.3. Genetic Differentiation and Phylogenetic Relationship
3. Discussion
3.1. Genetic Diversity of M. integrifolia
3.2. Genetic Differentiation and Structure of M. integrifolia Populations
4. Materials and Methods
4.1. Samples Collection and DNA Extraction
4.2. SSRs Identification and Primer Design
4.3. Data Processing and Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Editorial Committee of the Flora of China of Chinese Academy of Science (Ed.) Flora of China; Science Press: Beijing, China, 1999. [Google Scholar]
- Wu, Z.Y.; Chuang, H. A study on the taxonomic system of the genus Meconopsis. Acta Bot. Yunnanica Kunming 1980, 2, 371–381. [Google Scholar]
- Wang, B.; Song, X.H.; Cheng, C.M.; Yang, J.S. Studies on species of Meconopsis as Tibetan medicines. Chin. Wild Pl. Resour. 2003, 22, 43–46. [Google Scholar]
- Grey-Wilson, C. The true identity of Meconopsis napaulensis DC. Curtis’s Bot. Mag. 2006, 23, 176–209. [Google Scholar] [CrossRef]
- Editorial Board of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine (Ed.) Chinese Materia Medica 8; Shanghai Science and Technology Press: Shanghai, China, 1999. [Google Scholar]
- Yu, Y.-L.; Wang, H.-C.; Yu, Z.-X.; Schinnerl, J.; Tang, R.; Geng, Y.-P.; Chen, G. Genetic diversity and structure of the endemic and endangered species Aristolochia delavayi growing along the Jinsha River. Plant Divers. 2021, 43, 225–233. [Google Scholar] [CrossRef] [PubMed]
- Sulaiman, I.M.; Hasnain, S.E. Random amplified polymorphic DNA (RAPD) markers reveal genetic homogeneity in the endangered Himalayan species Meconopsis paniculata and M. simplicifolia. Theor. Appl. Genet. 1996, 93, 91–96. [Google Scholar] [CrossRef]
- Yang, S.; Lu, X.; Ye, R.; Li, Y.; Zhou, Y.; Yue, P.; Zhao, J.; Zhang, C.; Peng, M. Genetic diversity and population structure in Meconopsis quintuplinervia (Papaveraceae). Afr. J. Biotechnol. 2010, 9, 3048–3053. [Google Scholar]
- Yang, F.-S.; Qin, A.-L.; Li, Y.-F.; Wang, X.-Q. Great genetic differentiation among populations of Meconopsis integrifolia and its implication for plant speciation in the Qinghai-Tibetan Plateau. PLoS ONE 2012, 7, e37196. [Google Scholar] [CrossRef]
- Guo, J.-L.; Zhang, X.-Y.; Zhang, J.-W.; Li, Z.-M.; Sun, W.-G.; Zhang, Y.-H. Genetic diversity of Meconopsis integrifolia (Maxim.) Franch. In the East Himalaya–Hengduan Mountains inferred from fluorescent amplified fragment length polymorphism analysis. Biochem. Syst. Ecol. 2016, 69, 67–75. [Google Scholar] [CrossRef]
- Kashi, Y.; King, D. Simple sequence repeats as advantageous mutators in evolution. Trends Genet. 2006, 22, 253–259. [Google Scholar] [CrossRef]
- Powell, W.; Machray, G.C.; Provan, J. Polymorphism revealed by simple sequence repeats. Trends Plant Sci. 1996, 1, 215–222. [Google Scholar] [CrossRef]
- Zhao, Y.; Zhang, S.-B.; Yang, J.; Zhang, L. Characterization of 13 microsatellite loci developed from Meconopsis horridula. Genet. Mol. Biol. 2010, 33, 539–541. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zhou, Q.; Luo, D.; Ma, L.; Xie, W.; Wang, Y.; Wang, Y.; Liu, Z. Development and cross-species transferability of EST-SSR markers in Siberian wildrye (Elymus sibiricus L.) using Illumina sequencing. Sci. Rep. 2016, 6, 20549. [Google Scholar] [CrossRef] [PubMed]
- Hannaway, D.; Fransen, S.; Cropper, J.B.; Teel, M.; Chaney, M.; Griggs, T.; Halse, R.R.; Hart, J.M.; Cheeke, P.R.; Hansen, D.E.; et al. Perennial Ryegrass (Lolium perenne L.); Oregon State University: Corvallis, OR, USA, 1999. [Google Scholar]
- Qu, Y.; Ou, Z.; Yang, F.-s.; Wang, S.; Peng, J. The study of transcriptome sequencing for flower coloration in different anthesis stages of alpine ornamental herb (Meconopsis ‘Lingholm’). Gene 2019, 689, 220–226. [Google Scholar] [CrossRef] [PubMed]
- Park, Y.-J.; Lee, J.K.; Kim, N.-S. Simple sequence repeat polymorphisms (SSRPs) for evaluation of molecular diversity and germplasm classification of minor crops. Molecules 2009, 14, 4546–4569. [Google Scholar] [CrossRef] [PubMed]
- Yun, W.; Niwen, Z.; Han, P.; Guangli, L. Phenotypic Selection on Plant Traits and Floral Traits at Different Altitudes for Meconopsis integrifolia. Acta Bot. Boreali-Occident. Sin. 2016, 36, 1443–1449. [Google Scholar]
- Pauls, S.U.; Nowak, C.; Bálint, M.; Pfenninger, M. The impact of global climate change on genetic diversity within populations and species. Mol. Ecol. 2013, 22, 925–946. [Google Scholar] [CrossRef]
- Baraket, G.; Chatti, K.; Saddoud, O.; Abdelkarim, A.B.; Mars, M.; Trifi, M.; Hannachi, A.S. Comparative assessment of SSR and AFLP markers for evaluation of genetic diversity and conservation of fig, Ficus carica L., genetic resources in Tunisia. Plant Mol. Biol. Rep. 2011, 29, 171–184. [Google Scholar] [CrossRef]
- Garcia, A.A.; Benchimol, L.L.; Barbosa, A.M.; Geraldi, I.O.; Souza, C.L., Jr.; Souza, A.P.D. Comparison of RAPD, RFLP, AFLP and SSR markers for diversity studies in tropical maize inbred lines. Genet. Mol. Biol. 2004, 27, 579–588. [Google Scholar] [CrossRef]
- Belaj, A.; Satovic, Z.; Cipriani, G.; Baldoni, L.; Testolin, R.; Rallo, L.; Trujillo, I. Comparative study of the discriminating capacity of RAPD, AFLP and SSR markers and of their effectiveness in establishing genetic relationships in olive. Theor. Appl. Genet. 2003, 107, 736–744. [Google Scholar] [CrossRef]
- Jay, F.; Manel, S.; Alvarez, N.; Durand, E.Y.; Thuiller, W.; Holderegger, R.; Taberlet, P.; François, O. Forecasting changes in population genetic structure of alpine plants in response to global warming. Mol. Ecol. 2012, 21, 2354–2368. [Google Scholar] [CrossRef]
- Vandergast, A.G.; Bohonak, A.J.; Weissman, D.B.; Fisher, R.N. Understanding the genetic effects of recent habitat fragmentation in the context of evolutionary history: Phylogeography and landscape genetics of a southern California endemic Jerusalem cricket (Orthoptera: Stenopelmatidae: Stenopelmatus). Mol. Ecol. 2007, 16, 977–992. [Google Scholar] [CrossRef] [PubMed]
- Tremblay, R.L.; Ackerman, J.D. Gene flow and effective population size in Lepanthes (Orchidaceae): A case for genetic drift. Biol. J. Linn. Soc. 2008, 72, 47–62. [Google Scholar] [CrossRef]
- Lowry, D.B.; Modliszewski, J.L.; Wright, K.M.; Wu, C.A.; Willis, J.H. The strength and genetic basis of reproductive isolating barriers in flowering plants. Philos. Trans. R. Soc. B Biol. Sci. 2008, 363, 3009–3021. [Google Scholar] [CrossRef] [PubMed]
- Tero, N.; Aspi, J.; Siikamäki, P.; Jäkäläniemi, A.; Tuomi, J. Genetic structure and gene flow in a metapopulation of an endangered plant species, Silene tatarica. Mol. Ecol. 2003, 12, 2073–2085. [Google Scholar] [CrossRef] [PubMed]
- Nybom, H.; Bartish, I.V. Effects of life history traits and sampling strategies on genetic diversity estimates obtained with RAPD markers in plants. Perspect. Plant Ecol. Evol. Syst. 2000, 3, 93–114. [Google Scholar] [CrossRef]
- Ellstrand, N.C. Gene flow by pollen: Implications for plant conservation genetics. Oikos 1992, 63, 77–86. [Google Scholar] [CrossRef]
- Kwak, M.M.; Velterop, O.; van Andel, J. Pollen and gene flow in fragmented habitats. Appl. Veg. Sci. 1998, 1, 37–54. [Google Scholar] [CrossRef]
- Wang, D.-Y.; Chen, Y.-J.; Zhu, H.-M.; Lv, G.-S.; Zhang, X.-P.; Shao, J.-W. Highly differentiated populations of the narrow endemic and endangered species Primula cicutariifolia in China, revealed by ISSR and SSR. Biochem. Syst. Ecol. 2014, 53, 59–68. [Google Scholar] [CrossRef]
- Wu, Y.; Liu, Y.; Peng, H.; Yang, Y.; Liu, G.; Cao, G.; Zhang, Q. Pollination ecology of alpine herb Meconopsis integrifolia at different altitudes. Chin. J. Plant Ecol. 2015, 39, 1–13. [Google Scholar]
- Ciccheto, J.R.M.; Carnaval, A.C.; Araujo, S.B.L. The influence of fragmented landscapes on speciation. J. Evol. Biol. 2024, voae043. [Google Scholar] [CrossRef]
- Schluter, D.; Rieseberg, L.H. Three problems in the genetics of speciation by selection. Proc. Natl. Acad. Sci. USA 2022, 119, e2122153119. [Google Scholar] [CrossRef] [PubMed]
- Meng-Meng, G.; Rui, M.; Xun, G. Conservation genetics of an endemic plant, Anemoclema glaucifolium, in the Jinsha River Valley. Plant Divers. 2013, 35, 555. [Google Scholar]
- Höglund, J. Evolutionary Conservation Genetics; Oxford University Press: Oxford, UK, 2009. [Google Scholar]
- Chen, K.; Ye, C.; Guo, J.; Chen, D.; Guo, T.; Liu, J.; Liu, C.; Zhou, X. Agrobacterium-mediated transformation efficiency and grain phenotypes in six indica and japonica rice cultivars. Seed Biol. 2023, 2, 4. [Google Scholar] [CrossRef]
- Wang, X.; Wang, L. GMATA: An integrated software package for genome-scale SSR mining, marker development and viewing. Front. Plant Sci. 2016, 7, 1350. [Google Scholar] [CrossRef] [PubMed]
- Currie-Fraser, E.; Shah, P.; True, S. Data analysis using GeneMapper® v4. 1: Comparing the newest generation of GeneMapper software to legacy Genescan® and Genotyper® Software. J. Biomol. Tech. JBT 2010, 21 (Suppl. S3), S31. [Google Scholar]
- Shi, P.; Zhou, Y.; Shang, X.; Xiao, L.; Zeng, W.; Cao, S.; Wu, Z.; Yan, H. Assessment of genetic diversity and identification of core germplasm of Pueraria in Guangxi using SSR markers. Trop. Plants 2024, 3, e012. [Google Scholar] [CrossRef]
- Yeh, F.C.; Yang, R.C.; Boyle, T. POPGENE. Microsoft Windows Based Freeware for Population Genetic Analysis, version 1.32; University of Alberta: Edmonton, AB, Canada, 1999.
- Excoffier, L.; Lischer, H. An Integrated Software Package for Population Genetics Data Analysis; Swiss Institute of Bioinformatics: Lausanne, Switzerland, 2011. [Google Scholar]
- Kumar, S.; Tamura, K.; Nei, M. MEGA: Molecular evolutionary genetics analysis software for microcomputers. Bioinformatics 1994, 10, 189–191. [Google Scholar] [CrossRef]
- Miller, M. Tools for Population Genetic Analysis (TFPGA) 1.3: A Windows Program for the Analysis of Elysium and Molecular Population Genetic Data; Northern Arizona University: Flagstaff, AZ, USA, 1997. [Google Scholar]







| Parameter | Number |
|---|---|
| Total number of unigenes examined | 91,615 |
| Total number of identified SSRs | 15,165 |
| Number of SSR containing unigenes | 12,455 |
| Mono nucleotide | 226 |
| Di nucleotide | 3360 |
| Tri nucleotide | 10,022 |
| Tetra nucleotide | 315 |
| Penta nucleotide | 436 |
| Hexa nucleotide | 806 |
| Population | Sampling Location | PPB | Na | Ne | He | I |
|---|---|---|---|---|---|---|
| DDS | Zogang Dongda Mountain (Tibet) | 40.48% | 1.4048 | 1.2443 | 0.1425 | 0.2132 |
| CD | Qamdo (Tibet) | 32.14% | 1.3214 | 1.2129 | 0.1219 | 0.1800 |
| JZWS | Litang Jianziwan Mountain (Sichuan Province) | 48.81% | 1.4881 | 1.2683 | 0.1603 | 0.2436 |
| SJLS | Shergyla Mountain (Tibet) | 30.95% | 1.3095 | 1.1714 | 0.1026 | 0.1556 |
| YS | Yushu (Qinghai Province) | 28.57% | 1.2857 | 1.1822 | 0.1043 | 0.1549 |
| CS | Cangshan Mountain (Yunnan Province) | 28.57% | 1.2857 | 1.1424 | 0.0874 | 0.1352 |
| BMXS | Baima Snow Mountain (Yunnan Province) | 30.95% | 1.3095 | 1.1911 | 0.1119 | 0.1672 |
| BYQ | Bayan Har Mountain (Qinghai Province) | 26.19% | 1.2619 | 1.1868 | 0.1043 | 0.1523 |
| YLXS | Yulong Snow Mountain (Yunnan Province) | 25.00% | 1.2500 | 1.1254 | 0.0779 | 0.1206 |
| HY | Hongyuan (Sichuan Province) | 23.81% | 1.2381 | 1.1385 | 0.0817 | 0.1233 |
| BLS | Xiaojin Balang Mountain (Sichuan Province) | 28.57% | 1.2857 | 1.1791 | 0.1051 | 0.1565 |
| DR | Dari (Qinghai Province) | 22.62% | 1.2262 | 1.1300 | 0.0779 | 0.1177 |
| NMC | Namtso (Tibet) | 27.38% | 1.2738 | 1.1457 | 0.0879 | 0.1342 |
| BM | Bomi Tianchi (Tibet) | 5.95% | 1.0595 | 1.0397 | 0.0226 | 0.0334 |
| MDK | Maidika (Tibet) | 17.86% | 1.1786 | 1.0989 | 0.0599 | 0.0911 |
| QJYS | Yaoshan Mountain (Yunnan Province) | 11.90% | 1.1190 | 1.0634 | 0.0381 | 0.0583 |
| Mean | 12.08% (±0.16) | 1.1208 (±0.13) | 1.0657 (±0.06) | 0.0399 (±0.12) | 0.0610 (±0.05) | |
| Total | 91.67% | 1.9167 | 1.5037 | 0.2989 | 0.4514 |
| Degrees of Freedom | Sum of Squares of Deviations | Variance Component | Variation Ratio | p Value | |
|---|---|---|---|---|---|
| Among populations | 15 | 1551.684 | 8.53261 | 63.39% | <0.001 |
| Within populations | 169 | 832.932 | 4.92859 | 36.61% | <0.001 |
| Number | Primer Sequences (5′-3′) | Repeat Motif | Tm | Size |
|---|---|---|---|---|
| P5 | TTGCCTTGAAATTGAACATTCTT | (ATT)5 | 59.997 | 148 |
| AAGCAAACCCAAGATAAAACACA | ||||
| P11 | TATGGATATGGAATTGGAATTGG | (TGC)6 | 59.769 | 157 |
| AGACTTCGACCTAACACGCTTTT | ||||
| P14 | TCATTCACTGCTAGTACTCCAACTC | (TCA)6 | 59.037 | 135 |
| TGATGCTGAGAGTTTCTGTTTGA | ||||
| P17 | TTTGGTTCCTTCTCCTCCTCTTA | (TC)7 | 60.567 | 151 |
| GATTGATGAACTGAAAAGCATCC | ||||
| P20 | AGCAACAACAACATCAACATCAG | (GGT)5 | 60.088 | 132 |
| GCATGTTAGACTGAGATGGAAGG | ||||
| P23 | ATGTCTCTGGAGTAATGGGTGTG | (TA)6 | 60.295 | 142 |
| CCGACAATGAAATGTAAAACCAT | ||||
| P24 | GGTGAGAAGGGAGGATTTATGTC | (GGT)6 | 60.196 | 140 |
| ACTTCAGTAGTCAATCCGAACCC | ||||
| P27 | AACACATGTAGCAATCTCGTCCT | (TCA)5 | 60.075 | 145 |
| GTTTCCTGGTTTTCTCATGGTT | ||||
| P29 | GGTTTCTGCTCTTTGCTTCAGTA | (AT)7 | 60.069 | 155 |
| CACAACCCAACTAGAAAGACCAC | ||||
| P30 | GAAAACAACACAAGAATCACCGT | (CAC)5 | 60.309 | 145 |
| GTTGACGTCTTCTTCTTCGTCTC | ||||
| P31 | GTTGTCGATGATGAAAATGATTG | (ATG)6 | 59.333 | 143 |
| GCTAAAGACACCTTTTGAAGCAA | ||||
| P37 | TGTAGGTAATAGCAGAGCCATTG | (TCT)5 | 58.492 | 151 |
| CTTGGGTAGTGCTTGATATGTCG | ||||
| P40 | GTTACCCAACCATCGGTAGTTCA | (TGC)5 | 62.175 | 140 |
| GCTCGAGTTAATACATCCTCACG | ||||
| P42 | ACTTTGCTAGGGAATGTCCAGAT | (GTG)5 | 60.373 | 148 |
| TTATGGTCTCCATTACGATCACC | ||||
| P57 | CTTGAAAAGACGACTACACCCTTA | (TA)6 | 58.929 | 140 |
| CCTCAAGAGACTAGTCGGGAACT | ||||
| P58 | TTCATGAATGAGGATGTGTATGC | (CAA)5 | 59.843 | 156 |
| AGAGAATGAGGATTGCATTACGA | ||||
| P65 | CAAACATCAGTTTCCAACAACAA | (AAC)5 | 59.927 | 160 |
| GTTTACATTACCCGGAAGATGCT | ||||
| P69 | CTTCTTCTTCGGCAATTGAAAAT | (AAT)5 | 60.898 | 138 |
| TACCAACACATCCTCTTACCGTT | ||||
| P76 | CGAAGAATTAAGTGATGGAGAGG | (GAG)5 | 59.273 | 157 |
| TTAGGGCAACAGTGAATTTTGAT | ||||
| P84 | AGAGATCATAGTTACAACCGCCA | (GTG)5 | 60.035 | 139 |
| CCTTGCAGTAAACCCTAACTGTG | ||||
| P91 | GCTTATATGAAGATGCAACGAGG | (ACA)6 | 60.128 | 138 |
| CATTGTTTGACATTGAAAATGGA | ||||
| P94 | TGGTGGTGGAGTAGGAGTTAGAG | (ATC)5 | 59.685 | 160 |
| TTGAAGAGCAAGAGAAAGTCCAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, J.; Yang, Q.; Zhao, W.; Miao, X.; Qin, Y.; Qu, Y.; Zheng, P. Assessment of Population Genetic Diversity of Medicinal Meconopsis integrifolia (Maxim.) Franch. Using Newly Developed SSR Markers. Plants 2024, 13, 2561. https://doi.org/10.3390/plants13182561
Wu J, Yang Q, Zhao W, Miao X, Qin Y, Qu Y, Zheng P. Assessment of Population Genetic Diversity of Medicinal Meconopsis integrifolia (Maxim.) Franch. Using Newly Developed SSR Markers. Plants. 2024; 13(18):2561. https://doi.org/10.3390/plants13182561
Chicago/Turabian StyleWu, Jiahao, Quanyin Yang, Wanyue Zhao, Xue Miao, Yuan Qin, Yan Qu, and Ping Zheng. 2024. "Assessment of Population Genetic Diversity of Medicinal Meconopsis integrifolia (Maxim.) Franch. Using Newly Developed SSR Markers" Plants 13, no. 18: 2561. https://doi.org/10.3390/plants13182561
APA StyleWu, J., Yang, Q., Zhao, W., Miao, X., Qin, Y., Qu, Y., & Zheng, P. (2024). Assessment of Population Genetic Diversity of Medicinal Meconopsis integrifolia (Maxim.) Franch. Using Newly Developed SSR Markers. Plants, 13(18), 2561. https://doi.org/10.3390/plants13182561

