Phylogeography and Population Variation in Prunus discoidea (Prunus subg. Cerasus) in China
Abstract
1. Introduction
2. Results
2.1. Population Genetic Diversity
2.2. Population Genetic Structure
2.3. Phylogeographic Structure
2.4. Molecular Dating and Historical Dynamics
3. Discussion
3.1. Genetic Diversity and Population Genetic Structure
3.2. Geographical Structure
3.3. Historical Dynamics of P. discoidea Group
4. Materials and Methods
4.1. Plant Materials
4.2. DNA Extraction, Polymerase Chain Reaction (PCR) Amplification, Sequencing, and Sequence Alignment
4.3. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Zhu, Y.M. The Research on Hybrid Embryo Salvage Technology of Prunus discoidea. Master’s Thesis, Central South University of Forestry & Technology, Changsha, China, 2023. [Google Scholar] [CrossRef]
- Yü, J.D.; Lu, T.L.; Ku, C.T.; Li, L.C.; Chen, X.S. Flora of China; Science Press: Beijing, China, 1986; Volume 38. [Google Scholar]
- Yan, C.F.; Xu, L.; Zhao, Q.; Wang, X.T.; Sha, C.L. Classification research of Chinese native Cerasus resources. J. Jiangsu For. Sci. Technol. 2017, 44, 35–40. [Google Scholar] [CrossRef]
- Nan, C.H.; Yi, X.G.; Wang, H.C.; Wang, X.R.; Tang, G.G. Study on the niche of the main populaition in Cerasus discoidea community. J. Nanjing For. Univ. 2014, 38, 89–92. [Google Scholar] [CrossRef]
- Fu, T.; Yan, C.F.; Lin, L.J.; Wang, Z.L.; Lin, L.; Yuan, D.M.; Xu, L. Analysis of genetic relationship of wild Cerasus in South China with SSR markers. J. Nucl. Agric. Sci. 2018, 32, 1949–1954+1959. [Google Scholar] [CrossRef]
- Shang, T.; Wang, X.R.; Nan, C.H.; Zhang, Q. Genetic diversity in natural populations of Cerasus discoidea based on SSR markers. J. Gansu Agri. Univ. 2013, 48, 104–109+115. [Google Scholar] [CrossRef]
- Xu, G.B. Intraspecific phylogeography and its application in conservation strategies of plant genetic diversity. J. Cent. South Univ. For. Technol. 2011, 31, 1–6. [Google Scholar]
- Avise, J.C.; Arnold, J.; Ball, R.M.; Bermingham, E.; Lamb, T.; Neigel, J.E.; Reeb, C.A.; Saunders, N.C. Intraspecific phylogeography: The mitochondrial DNA bridge between population genetics and systematics. Annu. Rev. Ecol. Syst. 1987, 18, 489–522. [Google Scholar] [CrossRef]
- Guo, R. Phylogeography of Actinidia eriantha in Evergreen Broad-Leaved Forest of Subtropical China. Ph.D. Thesis, University of Chinese Academy of Sciences, Beijing, China, 2022. [Google Scholar] [CrossRef]
- Sun, G.Y.; Wang, X.H.; Fan, Y. New advance on Quaternary glacier in Northeast China: Remains examination, new discovery and ice epoch model. J. Earth Sci. Environ. 2012, 34, 55–65. [Google Scholar]
- He, L.P.; Wang, L.Z.; Zhu, Y.Z. Proceedings of researches on Cerasus in China. Mod. Landsc. Archit. 2013, 10, 48–52. [Google Scholar]
- Gao, Y.T.; Lin, L.; Yao, D.G.; Zhou, L.P.; Xu, J.W.; Mu, H.Z. Bioinformatics analysis of matK gene in Betula schmidtii. J. Beihua Univ. 2019, 20, 33–37. [Google Scholar] [CrossRef]
- Mo, W.J.; Li, S.F.; Qiu, Q.D.; Sun, C.Z.; Tang, Z.M.; Qiao, J.; Du, H.Y.; Fu, J.M. Genetic relationships among Paulownia elongate, Paulownia fortunei and Paulownia tomentosa based on cpDNA rps16 region sequences. For. Res. 2016, 29, 377–382. [Google Scholar] [CrossRef]
- Zhang, N.; Qian, Y.K.; Jia, F.Q.; Jiao, Z.W.; Zhang, X.L. Screening and evaluation of DNA barcoding genes for Prunus cerasifera. Plant Quar. 2018, 32, 34–42. [Google Scholar] [CrossRef]
- Zhang, S.D.; Jin, J.J.; Chen, S.Y.; Chase, M.W.; Soltis, D.E.; Li, H.T.; Yang, J.B.; Li, D.Z.; Yi, T.S. Diversification of Rosaceae since the late cretaceous based on plastid phylogenomics. New Phytol. 2017, 214, 1355–1367. [Google Scholar] [CrossRef] [PubMed]
- Xiang, Y.Z.; Huang, C.-H.; Hu, Y.; Wen, J.; Li, S.S.; Yi, T.S.; Chen, H.Y.; Xiang, J.; Ma, H. Evolution of Rosaceae fruit types based on nuclear phylogeny in the context of geological times and genome duplication. Mol. Biol. Evol. 2017, 34, 262–281. [Google Scholar] [CrossRef]
- Zhang, J.; Wang, Y.; Chen, T.; Chen, Q.; Wang, H.; Xie, R.; He, W.; Li, M.; Liu, C.L.; Yang, S.F.; et al. Evolution of Rosaceae plastomes highlights unique Cerasus diversification and independent origins of fruiting cherry. Front. Plant Sci. 2021, 12, 736053. [Google Scholar] [CrossRef]
- Liu, Z.; Cheng, Y.; Yang, P.D.; Zhao, Y.; Ning, J.; Yang, Y. Genetic diversity and structure of Chengbudong Tea population revealed by nSSR and cpDNA markers. J. Tea Sci. 2020, 40, 250–258. [Google Scholar] [CrossRef]
- Li, Y.X.; Lu, D.Y.; Hao, L.; Zhang, G.S.; Ning, J.; Wulan, N.R.; Alateng, S.H. Genetic diversity of Salix psammophila based on cpDNA non-coding sequence. Acta Bot. Boreal. Occident. Sin. 2020, 40, 413–424. [Google Scholar] [CrossRef]
- Li, L.K.; Li, X.Q.; Xie, G.W.; Li, H.S.; Zheng, Y.S.; Teng, J.H.; Gao, J.W. An analysis of phylogenetic relationship of the genus Disanthus distributed disjunctively in China and Japan based on cpDNA sequences. Biotechnol. Bull. 2016, 32, 80–87. [Google Scholar] [CrossRef]
- Yi, X.G.; Chen, J.; Zhu, H.; Li, Y.F.; Li, M.; Duan, Y.F.; Chen, L.; Wang, X.R. Phylogeography and the population genetic structure of flowering cherry Cerasus serrulata (Rosaceae) in subtropical and temperate China. Ecol. Evol. 2020, 10, 11262–11276. [Google Scholar] [CrossRef]
- Zhu, H.; Yi, G.X.; Li, F.Y.; Zhu, S.X.; Li, M.; Duan, Y.F.; Wang, X.R. Phylogeography and population genetic structure of flowering cherry species Cerasus dielsiana in subtropical China. Syst. Biodivers. 2019, 17, 622–633. [Google Scholar] [CrossRef]
- Dong, J.J.; Yi, X.G.; Wang, X.R.; Li, M.; Chen, X.Z.; Gao, S.C.; Fu, W.Y.; Qian, S.Y.; Zeng, X.L.; Yun, Y.K. Population variation and phylogeography of cherry blossom (Prunus conradinae) in China. Plants 2024, 13, 974. [Google Scholar] [CrossRef]
- Wan, T. Genetic Diversity and Phylogeography of Wild Prunus tomentosa in China. Ph.D. Thesis, Northwest Agriculture and Forestry University, Shanxi, China, 2024. [Google Scholar]
- Chen, T.; Chen, Q.; Luo, Y.; Huang, Z.L.; Zhang, J.; Tang, H.R.; Pan, D.M.; Wang, X.R.; Wang, X. Phylogeography of Chinese cherry (Prunus pseudocerasus Lindl.) inferred from chloroplast and nuclear DNA: Insights into evolutionary patterns and demographic history. Plant Biol. 2015, 17, 787–797. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Huang, Z.L.; Chen, T.; Zhang, J.; Wang, Y.; Chen, Q.; Tang, H.R.; Wang, X.R. Genetic diversity and relationship analysis among Cerasus pseudocerasus, C. avium, and C. tomentosa based on Internal Transcribed Spacer (ITS) sequences. Acta Hortic. Sin. 2018, 45, 126–138. [Google Scholar] [CrossRef]
- Zhang, Y.; Ma, Z.L.; Xu, S.S.; Su, X.; Li, M.Y. Phylogeography of Xanthopappus subacaulis (Asteraceae), an Endemic Species from the Northeastern of the Qinghai–Tibet Plateau. Bull. Bot. Res. 2022, 42, 565–573. [Google Scholar] [CrossRef]
- Hewitt, G. The genetic legacy of the Quaternary ice ages. Nature 2000, 405, 907–913. [Google Scholar] [CrossRef]
- Comes, H.P.; Kadereit, J.W. The effect of Quaternary climatic changes on plant distribution and evolution. Trends Plant Sci. 1998, 3, 432–438. [Google Scholar] [CrossRef]
- Zhu, H. Phylogenetic Position and Population Biogeography of Cerasus dielsiana (Rosaceae). Ph.D. Thesis, Nanjing Forestry University, Nanjing, China, 2021. [Google Scholar]
- Niu, Z.Y. Phylogenomics of Asian justicia L. Based on Complete Chloroplast Genomes. Master’s Thesis, Nanjing Forestry University, Nanjing, China, 2021. [Google Scholar] [CrossRef]
- Xu, D.Y.; Zhang, H.J.; Li, K.X.; Yang, Q.; Gao, H.Y. Molecular identification of 22 species of Lauraceae by DNA barcoding. Chin. J. Exp. Tradit. Med. Formulae 2021, 27, 159–166. [Google Scholar] [CrossRef]
- Yi, X.G. The Variation and Phylogeography of Cerasus serrulata Mill. Populations. Ph.D. Thesis, Nanjing Forestry University, Nanjing, China, 2022. [Google Scholar] [CrossRef]
- Sun, Y.; Fung, K.-P.; Leung, P.-C.; Shaw, P.-C. A phylogenetic analysis of Epimedium (Berberidaceae) based on nuclear ribosomal DNA sequences. Mol. Phylogenet. Evol. 2005, 35, 287–291. [Google Scholar] [CrossRef]
- Wang, Z.P. Phylogeography, Genetic Diversity and Ecological Adaptation of Osmanthus cooperi. Master’s Thesis, Nanjing Forestry University, Nanjing, China, 2023. [Google Scholar]
- Zhang, D.; Gao, F.L.; Jakovlić, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef]
- Librado, P.; Rozas, J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009, 25, 1451–1452. [Google Scholar] [CrossRef]
- Nei, M. Molecular Evolutionary Genetics; Columbia University Press: New York, NY, USA, 1987. [Google Scholar]
- Wei, S.J. Phylogeography of Camellia flavida. Master’s Thesis, Guangxi Normal University, Guilin, China, 2018. [Google Scholar]
- Wei, S.; Yang, W.K.; Wang, X.Y.; Hou, G.Y. High genetic diversity in an endangered medicinal plant, Saussurea involucrata (Saussurea, Asteraceae), in western Tianshan Mountains, China. Conserv. Genet. 2017, 18, 1435–1447. [Google Scholar] [CrossRef]
- Freeland, J.R.; Krik, H.; Petersen, S. Molecular Ecology; John Wiley & Sons, Ltd.: Chichester, UK, 2011. [Google Scholar]
- Clement, M.; Posada, D.; Crandall, K.A. TCS: A computer program to estimate gene genealogies. Mol. Ecol. 2000, 9, 1657–1659. [Google Scholar] [CrossRef]
- Drummond, A.J.; Suchard, M.A.; Xie, D.; Rambaut, A. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Mol. Biol. Evol. 2012, 29, 1969–1973. [Google Scholar] [CrossRef]
- Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Pacheco, S.J.; Kong, S.; Pulido-Santacruz, P.; Murphy, R.W.; Kubatko, L. Median-joining network analysis of SARS-CoV-2 genomes is neither phylogenetic nor evolutionary. Proc. Natl. Acad. Sci. USA 2020, 117, 12518–12519. [Google Scholar] [CrossRef] [PubMed]
- Rozas, J.; Rozas, R. DnaSP, DNA sequence polymorphism: An interactive program for estimating population genetics parameters from DNA sequence data. Bioinformatics 1995, 11, 621–625. [Google Scholar] [CrossRef] [PubMed]
Haplotype | Base Mutation Loci | ||||||||
---|---|---|---|---|---|---|---|---|---|
trnD–E | rpoB | rps16 | |||||||
240 | 416 | 509 | 811 | 844 | 1018 | 1569 | 1743 | 1793 | |
Hap1 | T | A | G | A | T | C | G | A | C |
Hap2 | C | . | A | . | C | . | . | G | . |
Hap3 | C | G | . | . | C | T | . | G | . |
Hap4 | C | . | A | . | C | T | . | G | . |
Hap5 | C | G | . | . | C | . | . | G | . |
Hap6 | . | . | . | . | C | T | . | G | . |
Hap7 | . | . | . | . | C | T | . | G | A |
Hap8 | . | . | . | . | C | . | . | G | A |
Hap9 | C | . | A | . | C | T | . | G | A |
Hap10 | . | G | . | . | C | . | . | G | A |
Hap11 | C | G | . | . | C | T | . | G | A |
Hap12 | C | . | . | . | C | . | . | G | . |
Hap13 | C | . | A | . | C | . | T | G | . |
Hap14 | C | . | . | . | C | . | . | . | . |
Hap15 | C | . | A | G | C | . | . | G | . |
Hap16 | . | . | . | . | C | . | . | . | . |
Hap17 | C | . | . | . | C | T | . | G | . |
Population Code | Hd | Pi | Sample Size | Haplotype Distribution | |
---|---|---|---|---|---|
1 | BMQ | 0.498 | 0.00102 | 32 | H1(13)H2(19) |
2 | BYS | 0.000 | 0.00000 | 34 | H2(34) |
3 | DMS | 0.667 | 0.00066 | 34 | H2(4)H3(4)H4(20)H5(6) |
4 | HS | 0.652 | 0.00077 | 33 | H2(13)H3(14)H12(6) |
5 | YTS | 0.523 | 0.00027 | 18 | H2(8)H13(10) |
6 | SMS | 0.663 | 0.00069 | 16 | H2(4)H14(4)H15(8) |
7 | LCS | 0.492 | 0.00102 | 26 | H2(10)H3(16) |
8 | ZJS | 0.844 | 0.00113 | 32 | H3(3)H4(7)H6(4)H7(4) H8(4)H9(4)H10(3)H11(3) |
9 | LS | 0.000 | 0.00000 | 11 | H3(11) |
10 | ZJG | 0.209 | 0.00032 | 18 | H2(16)H3(2) |
11 | LKY | 0.659 | 0.00094 | 32 | H2(15)H3(9)H6(8) |
12 | THC | 0.575 | 0.00068 | 32 | H3(20)H4(6)H16(3)H17(3) |
13 | YZH | 0.891 | 0.00104 | 30 | H2(4)H3(7)H4(9)H5(2) H6(2)H7(2)H8(2)H9(3) |
Eastern | 0.703 | 0.00087 | 193 | H1(13)H2(92)H3(34) H4(20)H5(6) H12(6)H13(10)H14(4) H15(8) | |
Central | 0.807 | 0.00103 | 155 | H2(25)H3(48)H4(22) H5(2)H6(14)H7(6) H8(6)H9(6)H10(3)H11(3)H16(3)H17(3) | |
Mean | 0.546 | 0.000696 | |||
Total | 0.782 | 0.00104 | 348 |
Ribosome | Base Mutation Loci | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
84 | 132 | 133 | 135 | 137 | 153 | 186 | 221 | 231 | 465 | 485 | 495 | 620 | |
R1 | G | G | A | G | G | C | C | T | A | C | T | A | T |
R2 | . | T | T | . | . | . | . | . | . | . | . | . | . |
R3 | . | . | T | . | A | . | . | C | C | A | G | G | A |
R4 | . | . | T | T | . | A | T | . | C | . | G | . | A |
R5 | . | . | T | T | . | . | . | . | C | . | G | . | A |
R6 | C | . | T | T | . | . | T | . | C | . | G | . | A |
Population Code | Rd | Pi | Sample Size | Ribotype Distribution | |
---|---|---|---|---|---|
1 | BMQ | 0.175 | 0.00051 | 32 | R1(29)R2(3) |
2 | BYS | 0.401 | 0.00116 | 34 | R1(25)R2(9) |
3 | LCS | 0.492 | 0.00571 | 26 | R1(10)R3(15) |
4 | DMS | 0.561 | 0.00458 | 34 | R1(21)R2(6)R3(7) |
5 | HS | 0.409 | 0.00474 | 33 | R1(24)R3(9) |
6 | YTS | 0.000 | 0.00000 | 18 | R3(18) |
7 | SMS | 0.400 | 0.00116 | 16 | R1(12)R2(4) |
8 | LS | 0.000 | 0.00000 | 11 | R1(11) |
9 | ZJG | 0.699 | 0.00560 | 18 | R1(6)R4(6)R5(5) |
10 | LKY | 0.000 | 0.00000 | 32 | R1(32) |
11 | ZJS | 0.000 | 0.00000 | 32 | R1(32) |
12 | THC | 0.000 | 0.00000 | 32 | R1(32) |
13 | YZH | 0.756 | 0.00537 | 30 | R1(10)R4(5)R5(9)R6(6) |
Eastern | 0.530 | 0.00489 | 193 | R1(122)R2(22)R3(50) | |
Central | 0.348 | 0.00336 | 155 | R1(123)R4(11)R5(14)R6(6) | |
Mean | 0.318 | 0.00247 | |||
Total | 0.478 | 0.00451 | 348 |
Source of Variation | d.f. | Sum of Squares | Variant Components | Percentage of Variation | Fixation Index |
---|---|---|---|---|---|
Chloroplast DNA Fragments | |||||
All groups | |||||
Among populations | 12 | 120.807 | 0.35323 | 34.26 | Fst = 0.34264 |
Within populations | 335 | 227.026 | 0.67769 | 65.74 | |
Central | |||||
Among populations | 5 | 36.409 | 0.25649 | 24.45 | Fst = 0.24453 |
Within populations | 149 | 118.069 | 0.79241 | 75.55 | |
Eastern | |||||
Among populations | 6 | 52.182 | 0.29754 | 33.68 | Fst = 0.33684 |
Within populations | 186 | 108.957 | 0.58579 | 66.32 | |
Eastern and Central | |||||
Among groups | 1 | 32.216 | 013640 | 12.47 | Fsc = 0.29216 Fst = 0.38043 Fct = 0.12470 |
Among populations within groups | 11 | 88.591 | 0.27972 | 25.57 | |
Within populations | 335 | 227.026 | 0.67769 | 61.96 | |
nuclear DNA fragments | |||||
All groups | |||||
Among populations | 12 | 274.754 | 0.83160 | 57.65 | Fst = 0.57621 |
Within populations | 335 | 264.838 | 0.70560 | 42.35 | |
Central | |||||
Among populations | 5 | 92.266 | 0.70636 | 54.83 | Fst = 0.54835 |
Within populations | 149 | 86.689 | 0.58180 | 45.17 | |
Eastern | |||||
Among populations | 6 | 145.809 | 0.85631 | 47.20 | Fst = 0.47203 |
Within populations | 186 | 178.150 | 0.95779 | 52.80 | |
Central and Eastern | |||||
Among groups | 1 | 36.679 | 0.07575 | 4.57 | Fsc = 0.57791 Fst = 0.52292 Fct = 0.04571 |
Among populations within groups | 11 | 238.057 | 0.79078 | 47.72 | |
Within populations | 335 | 264.838 | 0.79056 | 47.71 |
Province | City | Longitude | Latitude | Province | City | Longitude | Latitude |
---|---|---|---|---|---|---|---|
Jiangxi | Jiujiang | 116.0603 | 29.64585 | Hubei | Xianning | 114.6116 | 29.82106 |
116.0573 | 29.64455 | 114.6262 | 29.82052 | ||||
116.0506 | 29.63852 | 114.6975 | 29.78564 | ||||
116.0495 | 29.63825 | 114.5980 | 29.81822 | ||||
116.0482 | 29.63799 | 114.5883 | 29.77600 | ||||
Zhejiang | Lishui | 119.9113 | 28.50320 | 114.5869 | 29.77621 | ||
Hangzhou | 119.9107 | 28.49354 | 114.5301 | 29.81668 | |||
119.9090 | 28.49267 | 114.5265 | 29.82496 | ||||
119.9095 | 28.49301 | 114.5234 | 29.83107 | ||||
119.9111 | 28.49441 | Jingmen | 112.0240 | 31.21449 | |||
119.9109 | 28.49600 | 112.0178 | 31.22911 | ||||
119.9069 | 28.49807 | 112.0562 | 31.18117 | ||||
119.9122 | 28.50784 | Huanggang | 115.9719 | 30.99700 | |||
119.9130 | 28.51143 | 115.9970 | 30.99309 | ||||
119.9135 | 28.51229 | 116.0092 | 30.99434 | ||||
119.9114 | 28.51227 | 116.0107 | 30.98784 | ||||
119.9111 | 28.51197 | 116.0250 | 30.98490 | ||||
119.9109 | 28.51256 | 116.0226 | 30.98254 | ||||
119.9122 | 28.51424 | 116.0258 | 30.98203 | ||||
119.7562 | 29.44729 | Henan | Nanyang | 113.3932 | 32.46884 | ||
119.7467 | 29.45877 | 113.3566 | 32.51996 | ||||
119.7271 | 29.46597 | 113.3492 | 32.52327 | ||||
119.7225 | 29.47247 | 113.4165 | 32.47025 | ||||
119.7213 | 29.47398 | 113.4575 | 32.50649 | ||||
119.7189 | 29.47520 | Jiangsu | Lianyungang | 119.4586 | 34.70469 | ||
119.7194 | 29.47445 | 119.4578 | 34.70529 | ||||
Yuyao | 121.0254 | 29.67678 | 119.4580 | 34.70554 | |||
Huzhou | 119.8398 | 30.61118 | Yixing | 119.6931 | 31.21817 | ||
119.8372 | 30.58625 | ||||||
119.8513 | 30.55984 | ||||||
119.8506 | 30.55914 | ||||||
Anhui | Huangshan | 118.1552 | 30.14521 | ||||
Lu’an | 115.8897 | 31.24339 |
Sample Code | Sampling Site | Sample Size | Longitude and Latitude | Altitude/m |
---|---|---|---|---|
DMS | Daming Mountain, Lin’an District, Zhejiang Province | 34 | 119.02536 E 30.06924 N | 800 |
HS | Huang Mountain, Huangshan City, Anhui Province | 33 | 118.15517 E 30.14521 N | 850 |
BYS | Baiyun Mountain, Lishui City, Zhejiang Province | 34 | 119.91132 E 28.50266 N | 333 |
SMS | Siming Mountain, Yuyao City, Zhejiang Province | 16 | 121.02541 E 29.67678 N | 847 |
BMQ | Eightmu Hill, Jiande County, Zhejiang Province | 32 | 119.71899 E 29.4761 N | 351 |
LCS | Longchi Mountain, Yixing City, Jiangsu Province | 26 | 119.69308 E 31.21817 N | 324 |
YTS | Yuntai Mountain, Lianyungang City, Jiangsu Province | 18 | 119.45889 E 34.70508 N | 157 |
YZH | Yanzi River, Lu’an City, Anhui Province | 30 | 115.88972 E 31.24339 N | 568 |
THC | Taohua Chong, Huanggang City, Hubei Province | 32 | 116.01271 E 30.98719 N | 522 |
ZJS | Zengjia Mountain, Xianning City, Hubei Province | 32 | 114.61163 E 29.82106 N | 118 |
ZJG | Zhangjia Gully, Jingmen City, Hubei Province | 18 | 112.01784 E 31.22911 N | 285 |
LS | Lu Mountain, Jiujiang City, Jiangxi Province | 11 | 116.05310 E 29.64308 N | 222 |
LKY | Tongbo County, Nanyang City, Henan Province | 32 | 113.39161 E 32.48135 N | 169 |
total | 348 |
Primer Name | Primer Sequence | Tm/°C | Number of Cycles |
---|---|---|---|
rps16 | F: GTGGTAGAAAGCAACGTGCGACTT R: TCGGGATCGAACATCAATTGCAAC | 52 | 30 |
rpoB | F: AAGTGCATTGTTGGAACTGG R: CCCAGCATCACAATTCC | 56 | 35 |
trnD–E | F: ACCAATTGAACTACAATCCC R: AGGACATCTTCAAGGAG | 56 | 35 |
ITS | F: TCCTCCGCTTATTGATATGC R: GGAAGGAGAAGTCGTAACAAGG | 58 | 35 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, X.; Gao, S.; Yang, H.; Fu, W.; Qian, S.; Wang, X.; Yi, X. Phylogeography and Population Variation in Prunus discoidea (Prunus subg. Cerasus) in China. Plants 2024, 13, 2535. https://doi.org/10.3390/plants13172535
Chen X, Gao S, Yang H, Fu W, Qian S, Wang X, Yi X. Phylogeography and Population Variation in Prunus discoidea (Prunus subg. Cerasus) in China. Plants. 2024; 13(17):2535. https://doi.org/10.3390/plants13172535
Chicago/Turabian StyleChen, Xiangzhen, Shucheng Gao, Hong Yang, Wenyi Fu, Siyu Qian, Xianrong Wang, and Xiangui Yi. 2024. "Phylogeography and Population Variation in Prunus discoidea (Prunus subg. Cerasus) in China" Plants 13, no. 17: 2535. https://doi.org/10.3390/plants13172535
APA StyleChen, X., Gao, S., Yang, H., Fu, W., Qian, S., Wang, X., & Yi, X. (2024). Phylogeography and Population Variation in Prunus discoidea (Prunus subg. Cerasus) in China. Plants, 13(17), 2535. https://doi.org/10.3390/plants13172535