UBC Gene Family Analysis in Salvia castanea and Roles of ScUBC2/5 Genes under Abiotic Stress
Abstract
:1. Introduction
2. Results
2.1. Analysis of UBC Gene Family Members in S. castanea and Other Species
2.2. Phylogenetic Tree Analysis of ScUBCs
2.3. UBC Gene Structure Characteristics of S. castanea
2.4. Secondary Structure Prediction and 3D Structure Prediction of ScUBC2 and ScUBC5
2.5. ScUBC Gene Expression Pattern
2.6. Screening of Hairy Roots with Overexpression of ScUBC2 and ScUBC5 in S. castanea
2.7. Functional Verification of S. castanea UBC2/5 under Abiotic Stress
2.8. Determination of Tanshinones and Phenolic Acids in Overexpressed Hairy Roots
3. Discussion
3.1. Discussion of ScUBC Gene Family
3.2. Discussion of the Functional Analysis of ScUBC2 and ScUBC5 under Abiotic Stress
3.3. Discussion on Changes in Secondary Metabolites in S. castanea under Stress
4. Materials and Methods
4.1. Identification of UBC Gene Family in S. castanea
4.2. ScUBC2 and ScUBC5 Secondary Structure Prediction and 3D Protein Structure Prediction
4.3. Family Phylogenetic Tree Construction and Analysis of Gene Conserved Domain
4.4. Mapping of ScUBC Gene Expression Map
4.5. Screening of Overexpressed Hairy Roots in S. castanea
4.6. Functional Verification of S. castanea UBC 2/5 under Abiotic Stress
4.7. Content Determination of Tanshinones and Phenolic Acids
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Su, P.-J.; Zhang, Z.-P.; Cui, W.-B.; Liu, X.; Wang, R.-Y.; Zhi, D.-J.; Qi, F.-M.; Chen, X.-H.; Li, Y.-Q.; Djimabi, K.; et al. Polyoxygenated sesquiterpenoids from Salvia castanea and their potential anti-Alzheime’s disease bioactivities. Fitoterapia 2021, 151, 104867. [Google Scholar] [CrossRef] [PubMed]
- Pan, Z.H.; Li, Y.; Wu, X.D.; He, J.; Chen, X.Q.; Xu, G.; Peng, L.Y.; Zhao, Q.S. Norditerpenoids from Salvia castanea Diels f. pubescens. Fitoterapia 2012, 83, 1072–1075. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.Y.; Wang, L.; Zhang, L.; Wang, T.; Yu, L.; Ding, C.B.; Yang, R.W.; Wang, X.L.; Zhou, Y.H. Characterization, antioxidant and antitumor activities of polysaccharides from Salvia miltiorrhiza Bunge. Int. J. Biol. Macromol. 2014, 70, 92–99. [Google Scholar] [CrossRef]
- Fang, Y.; Hou, Z.; Zhang, X.; Yang, D.; Liang, Z. Diverse specialized metabolism and their responses to lactalbumin hydrolysate in hairy root cultures of Salvia miltiorrhiza Bunge and Salvia castanea Diels f. tomentosa Stib. Biochem. Eng. J. 2017, 131, 58–69. [Google Scholar] [CrossRef]
- Liang, Z.S.; Yang, D.F.; Liang, X.; Zhang, Y.J.; Liu, Y.; Liu, F.H. Roles of reactive oxygen species in methyl jasmonate and nitric oxide-induced tanshinone production in Salvia miltiorrhiza hairy roots. Plant Cell Rep. 2012, 31, 873–883. [Google Scholar] [CrossRef] [PubMed]
- Hou, Z.N.; Li, Y.Y.; Su, F.; Wang, Y.F.; XZhang, X.D.; Xu, L.; Yang, D.F.; Liang, Z.S. The exploration of methyl jasmonate on the tanshinones biosynthesis in hair roots of Salvia miltiorrhiza Bunge and Salvia castanea f. tomentosa Stib. Ind. Crops Prod. 2021, 167, 113563. [Google Scholar] [CrossRef]
- Subedi, L.; Gaire, B.P. Tanshinone IIA: A phytochemical as a promising drug candidate for neurodegenerative diseases. Pharmacol. Res. 2021, 169, 105661. [Google Scholar] [CrossRef]
- Liu, L.; Yang, D.; Xing, B.; Zhang, H.; Liang, Z. Salvia castanea Hairy Roots are More Tolerant to Phosphate Deficiency than Salvia miltiorrhiza Hairy Roots Based on the Secondary Metabolism and Antioxidant Defenses. Molecules 2018, 23, 1132. [Google Scholar] [CrossRef]
- Zhang, Y.; Xia, P. The DREB transcription factor, a biomacromolecule, responds to abiotic stress by regulating the expression of stress-related genes. Int. J. Biol. Macromol. 2023, 243, 125231. [Google Scholar] [CrossRef]
- Liu, W.; Zheng, L.; Qi, D. Variation in leaf traits at different altitudes reflects the adaptive strategy of plants to environmental changes. Ecol. Evol. 2020, 10, 8166–8175. [Google Scholar] [CrossRef]
- Alonso-Amelot, M.E. High altitude plants, chemistry of acclimation and adaptation. Stud. Nat. Prod. Chem. 2008, 34, 883–982. [Google Scholar]
- Yang, D.F.; Liang, Z.S. Three-dimensional multi-component quality evaluation of Chinese medicine based on proportion consistency of active components: A study of Salvia miltiorrhiza. Zhongguo Zhong Yao Za Zhi 2022, 47, 3118–3124. [Google Scholar]
- Gao, H.; Huang, L.; Ding, F.; Yang, K.; Feng, Y.; Tang, H.; Xu, Q.-M.; Feng, J.; Yang, S. Simultaneous purification of dihydrotanshinone, tanshinone I, cryptotanshinone, and tanshinone IIA from Salvia miltiorrhiza and their anti-inflammatory activities investigation. Sci. Rep. 2018, 8, 8460. [Google Scholar] [CrossRef]
- Xu, L.; Cao, M.; Wang, Q.; Xu, J.; Liu, C.; Ullah, N.; Li, J.; Hou, Z.; Liang, Z.; Zhou, W.; et al. Insights into the plateau adaptation of Salvia castanea by comparative genomic and WGCNA analyses. J. Adv. Res. 2022, 42, 221–235. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.; Yang, S.; Zhang, Y.; Liu, Y.; Meng, X.; Liang, Z. Metabolic profiles of three related Salvia species. Fitoterapia 2009, 80, 274–278. [Google Scholar] [CrossRef]
- Moreno, A.G.; de Cózar, A.; Prieto, P.; Domínguez, E.; Heredia, A. Radiationless mechanism of UV deactivationby cuticle phenolics in plants. Nat. Commun. 2022, 13, 1786. [Google Scholar] [CrossRef]
- Tholl, D. Biosynthesis and biological functions of terpenoids in plants. Adv. Biochem. Eng. Biotechnol. 2015, 148, 63–106. [Google Scholar] [PubMed]
- Liu, T.; Jin, H.; Sun, Q.; Xu, J.; Hu, H. The neuroprotective effects of tanshinone IIA onβ-amyloid- induced toxicity in rat cortical neurons. Neuropharmacology 2010, 59, 595–604. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.; Ma, P.; Liang, X.; Liang, Z.; Zhang, M.; Shen, S.; Liu, H.; Liu, Y. Metabolic profiles and cDNA-AFLP analysis of Salvia miltiorrhiza and Salvia castanea Diel f. tomentosa Stib. PLoS ONE 2012, 7, e29678. [Google Scholar] [CrossRef]
- Yang, D.; Fang, Y.; Xia, P.; Zhang, X.; Liang, Z. Diverse responses of tanshinone biosynthesis to biotic and abiotic elicitors in hairy root cultures of Salvia miltiorrhiza and Salvia castanea Diels f. tomentosa. Gene 2018, 643, 61–67. [Google Scholar] [CrossRef]
- Zou, Y.-H.; Zhao, L.; Xu, Y.-K.; Bao, J.-M.; Liu, X.; Zhang, J.-S.; Li, W.; Ahmed, A.; Yin, S.; Tang, G.-H. Anti-inflammatory sesquiterpenoids from the Traditional Chinese Medicine Salvia plebeia: Regulates pro-inflammatory mediators through inhibition of NF-κB and Erk1/2 signaling pathways in LPS-induced Raw264.7 cells. J. Ethnopharmacol. 2018, 210, 95–106. [Google Scholar] [CrossRef] [PubMed]
- Jang, H.-J.; Lee, S.; Lee, S.-J.; Lim, H.-J.; Jung, K.; Kim, Y.H.; Lee, S.W.; Rho, M.-C. Anti-inflammatory Activity of Eudesmane-Type Sesquiterpenoids from Salvia plebeia. J. Nat. Prod. 2017, 80, 2666–2676. [Google Scholar] [CrossRef] [PubMed]
- Hou, Z.; Li, Y.; Su, F.; Chen, J.; Zhang, X.; Xu, L.; Yang, D.; Liang, Z. Application of 1H-NMR combined with qRT-PCR technology in the exploration of rosmarinic acid biosynthesis in hair roots of Salvia miltiorrhiza Bunge and Salvia castanea f. tomentosa Stib. Planta 2020, 253, 2. [Google Scholar] [CrossRef] [PubMed]
- Jia, W.; Liu, G.; Zhang, P.; Li, H.; Peng, Z.; Wang, Y.; Jemrić, T.; Fu, D. The Ubiquitin-26S Proteasome Pathway and Its Role in the Ripening of Fleshy Fruits. Int. J. Mol. Sci. 2023, 24, 2750. [Google Scholar] [CrossRef] [PubMed]
- Xu, F.Q.; Xue, H.W. The ubiquitin-proteasome system in plant responses to environments. Plant Cell Environ. 2019, 42, 2931–2944. [Google Scholar] [CrossRef] [PubMed]
- Smalle, J.; Vierstra, R.D. The ubiquitin 26S proteasome proteolytic pathway. Annu. Rev. Plant Biol. 2004, 55, 555–590. [Google Scholar] [CrossRef] [PubMed]
- Pickart, C.M.; Eddins, M.J. Ubiquitin: Structures, functions, mechanisms. Biochim. Biophys. Acta (BBA)—Mol. Cell Res. 2004, 1695, 55–72. [Google Scholar] [CrossRef] [PubMed]
- Jentsch, S. The ubiquitin-conjugation system. Annu. Rev. Genet. 1992, 26, 179–207. [Google Scholar] [CrossRef]
- Dreher, K.; Callis, J. Ubiquitin, hormones and biotic stress in plants. Ann. Bot. 2007, 99, 787–822. [Google Scholar] [CrossRef]
- Chen, C.; Qiao, Y.; Jing, C.; Lu, W.; Jin, X.; Yu, L. Identification of UBC gene family and preliminary function analysis of GmUBC46 gene in soybean. J. Plant Genet. Resour. 2019, 21, 154–163. [Google Scholar]
- Liu, W.; Tang, X.; Zhu, X.; Qi, X.; Zhang, N.; Si, H. Genome-wide identification and expression analysis of the E2 gene family in potato. Mol. Biol. Rep. 2019, 46, 777–791. [Google Scholar] [CrossRef] [PubMed]
- Yao, S.; Xie, M.; Hu, M.; Cui, X.; Wu, H.; Li, X.; Hu, P.; Tong, C.; Yu, X. Genome-wide characterization of ubiquitin-conjugating enzyme gene family explores its genetic effects on the oil content and yield of Brassica napus. Front. Plant Sci. 2023, 14, 1118339. [Google Scholar] [CrossRef] [PubMed]
- Dong, C.; Wei, Y.; Wang, Y.; Zheng, X.; Li, W.; Shi, S. Analysis of bioinformatics and expression characteristics of ubiquitin-binding enzyme (LcUBC12) gene in Litchi. J. South. Agric. Sci. 2020, 51, 1091–1097. [Google Scholar]
- Xu, L.; Ménard, R.; Berr, A.; Fuchs, J.; Cognat, V.; Meyer, D.; Shen, W.H. The E2 ubiquitin-conjugating enzymes, AtUBC1 and AtUBC2, play redundant roles and are involved in activation of FLC expression and repression of flowering in Arabidopsis thaliana. Plant J. 2009, 57, 279–288. [Google Scholar] [CrossRef] [PubMed]
- E, Z.; Zhang, Y.; Li, T.; Wang, L.; Zhao, H. Characterization of the ubiquitin-conjugating enzyme gene family in rice and evaluation of expression profiles under abiotic stresses and hormone treatments. PLoS ONE 2015, 10, e0122621. [Google Scholar] [CrossRef]
- Xu, D.; Yu, Y.; Han, Q.; Ma, Y.; Gao, S.; Tian, Y.; Xu, Z.; Li, L.; Qu, Y.; Ma, Y.; et al. Characteristics and Function of a GmDREB5-Interacting Protein GmUBC13 in Soybean. Sci. Agric. Sin. 2014, 47, 3534–3544. [Google Scholar]
- van Wijk, S.J.L.; Timmers, H.T. The family of ubiquitin-conjugating enzymes (E2s): Deciding between life and death of proteins. FASEB J. 2010, 24, 981–993. [Google Scholar] [CrossRef]
- Jue, D.; Sang, X.; Lu, S.; Dong, C.; Zhao, Q.; Chen, H.; Jia, L.; Margis, R. Genomewide identification, phylogenetic and expression analyses of the ubiquitinconjugating enzyme gene family in Maize. PLoS ONE 2015, 10, e0143488. [Google Scholar] [CrossRef] [PubMed]
- Finn, R.D.; Coggill, P.; Eberhardt, R.Y.; Eddy, S.R.; Mistry, J.; Mitchell, A.L.; Potter, S.C.; Punta, M.; Qureshi, M.; Sangrador-Vegas, A.; et al. The Pfam protein families database: Towards a more sustainable future. Nucleic Acids Res. 2016, 44, 279–285. [Google Scholar] [CrossRef]
- Letunic, I.; Khedkar, S.; Bork, P. SMART: Recent updates, new developments and status in 2020. Nucleic Acids Res. 2021, 49, 458–460. [Google Scholar] [CrossRef]
- Artimo, P.; Jonnalagedda, M.; Arnold, K.; Baratin, D.; Csardi, G.; de Castro, E.; Duvaud, S.; Flegel, V.; Fortier, A.; Gasteiger, E.; et al. ExPASy: SIB bioinformatics resource portal. Nucleic Acids Res. 2012, 40, 597–603. [Google Scholar] [CrossRef] [PubMed]
- Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef] [PubMed]
- Xia, P.; Hu, W.; Liang, T.; Yang, D.; Liang, Z. An attempt to establish an Agrobacterium-mediated transient expression system in medicinal plants. Protoplasma 2020, 257, 1497–1505. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Lin, J.; Du, X.; Liang, Z.; Yang, D. Effects of different medium on hairy root growth and accumulation of effective components of Salvia miltiorrhiza and Salvia villosa. Shi Zhen Chin. Med. 2023, 34, 692–697. [Google Scholar]
- Li, B.; Zhang, C.; Peng, L.; Liang, Z.; Yan, X.; Zhu, Y.; Liu, Y. Comparison of essential oil composition and phenolic acid content of selected Salvia species measured by GC–MS and HPLC methods. Ind. Crops Prod. 2015, 69, 329–334. [Google Scholar] [CrossRef]
Species | Gene Name | Comment ID | pI | Mw |
---|---|---|---|---|
Salvia castanea | ScUBC1 | c14380_g1 | 7.71 | 16,538.13 |
ScUBC2 | c15670_g1 | 7.72 | 16,562.15 | |
ScUBC3 | c15890_g1 | 7.72 | 16,606.17 | |
ScUBC4 | c15906_g1 | 7.72 | 16,606.17 | |
ScUBC5 | c15861_g1 | 7.72 | 16,566.10 | |
ScUBC6 | c15345_g1 | 7.72 | 16,606.17 | |
ScUBC7 | c16215_g1 | 7.69 | 16,446.96 | |
ScUBC8 | c16784_g1 | 7.69 | 16,446.96 | |
ScUBC9 | c14548_g1 | 7.72 | 16,524.06 | |
Andrographis paniculata | ApUBC | AFU08355.1 | 6.03 | 8441.88 |
Amborella trichopoda | AtrUBC | XP_006846899.3 | 8.32 | 20,429.61 |
Arabidopsis thaliana | AtUBC | NP_001031228.1 | 7.72 | 16,510.04 |
Daucus carota | DcUBC | XP_017223186.1 | 7.72 | 16,534.10 |
Musa acuminata | MaUBC1 | XP_018679775.1 | 7.74 | 16,518.06 |
MaUBC2 | XP_018679365.1 | 7.72 | 16,530.11 | |
Oryza sativa | OsUBC1 | EAY85278.1 | 7.71 | 16,480.05 |
OsUBC2 | XP_015627363.1 | 7.71 | 16,446.03 | |
Prunus mume | PmUBC1 | XP_016651554.1 | 7.72 | 16,518.10 |
PmUBC2 | XP_008239078.1 | 7.71 | 16,521.10 | |
Populus trichocarpa | PtUBC1 | XP_002303624.1 | 7.72 | 16,522.09 |
PtUBC2 | XP_002323682.3 | 7.72 | 16,460.06 | |
Sesamum indicum | SiUBC1 | XP_011095163.1 | 7.71 | 16,510.08 |
SiUBC1 | XP_011080642.1 | 7.72 | 16,478.04 | |
Solanum lycopersicum | SlUBC1 | NP_001234247.1 | 7.72 | 16,522.09 |
SlUBC2 | NP_001294911.1 | 7.72 | 16,522.09 | |
Selaginella moellendorffii | SmoUBC1 | EFJ35297.1 | 7.72 | 16,571.16 |
SmoUBC2 | XP_024522878.1 | 6.82 | 16,797.27 | |
Salvia miltiorrhiza | SmUBC1 | EVM0014715.1 | 7.72 | 16,562.15 |
SmUBC2 | EVM0027060.1 | 7.72 | 16,566.10 | |
SmUBC3 | EVM0018149.1 | 7.72 | 16,562.15 | |
SmUBC4 | EVM0013655.1 | 7.72 | 16,606.17 | |
SmUBC5 | EVM0026692.2 | 6.81 | 16,436.94 | |
SmUBC6 | EVM0006402.1 | 7.72 | 16,562.15 | |
SmUBC7 | EVM0006158.1 | 7.72 | 16,524.06 | |
SmUBC8 | EVM0006069.5 | 7.72 | 16,576.14 | |
Vitis vinifera | ViUBC1 | XP_010658920.1 | 7.72 | 16,548.13 |
ViUBC2 | AAU04836.1 | 5.52 | 4857.55 | |
Zea mays | ZmUBC1 | NP_001104888.1 | 7.71 | 16,503.04 |
ZmUBC2 | AAB88617.1 | 7.71 | 16,503.04 | |
ZmUBC3 | NP_001148222.1 | 7.72 | 16,507.03 | |
ZmUBC4 | NP_001146962.1 | 7.74 | 16,589.06 |
Primer Name | Sequence | Application |
---|---|---|
1-UCB2-F | TCCCGCCAGACTACCCTT | Selection of primers for ScUBC2 overexpression lines |
1-UCB2-R | TGGGTCGTCCGGGTTTGG | |
2-UCB2-F | CCCGCCAGACTACCCTT | |
2-UCB2-R | GGGTCGTCCGGGTTTG | |
3-UCB2-F | CCATTCATTTCCCGCCAGAC | |
3-UCB2-R | CAATGGGTCGTCCGGGTTT | |
1-UCB5-F | AGTCCTTATGCTGGAGGTGT | Selection of primers for ScUBC5 overexpression lines |
1-UCB5-R | CGAGCAAATAGACAGCAGGAC | |
2-UCB5-F | GGCAAGCCACAATCATGGG | |
2-UCB5-R | GTCAATGCTGGACTCCACTG | |
3-UCB5-F | GAGCAGTGGAGTCCAGCATT | |
3-UCB5-R | CCCATGGCATATTTCTGGGT | |
1-L-SmAOC-RT-F | CAACTCCATCCAAGGTTCAGG | Low temperature primer |
1-L-SmAOC-RT-R | TCGCCGGAGTAGAGCTTGTTG | |
1-PAL3-F | GTGACGTTGTGGTTGAGGAAT | Ultraviolet primer |
1-PAL3-R | CTCATCAACAAGAGCAGCAAT | |
2-LOX6-F | TTGAAGACTCATGCCTGCAC | |
2-LOX6-R | GTCAAACCGCCACAATTTCT | |
Actin-F | GGTGCCCTGAGGTCCTGTT | Internal reference primer |
Actin-R | AGGAACCACCGATCCAGACA |
Composition | Standard Curve | Composition |
---|---|---|
DTI | y = (x − 23,027.7527)/2,660,639.56 | DTI |
CT | y = (x − 85,722.742)/5,526,269.802 | CT |
T-I | y = (x + 86,099.6853)/3,752,634.878 | T-I |
TIIA | y = (x + 58,317.4739)/5,128,785.876 | TIIA |
SAB | y = (x + 614,965.8527)/1,032,490.8342 | SAB |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, L.; Sun, Y.; Ullah, N.; Zhang, G.; Liu, H.; Xu, L. UBC Gene Family Analysis in Salvia castanea and Roles of ScUBC2/5 Genes under Abiotic Stress. Plants 2024, 13, 1353. https://doi.org/10.3390/plants13101353
Zhu L, Sun Y, Ullah N, Zhang G, Liu H, Xu L. UBC Gene Family Analysis in Salvia castanea and Roles of ScUBC2/5 Genes under Abiotic Stress. Plants. 2024; 13(10):1353. https://doi.org/10.3390/plants13101353
Chicago/Turabian StyleZhu, Longyi, Yuee Sun, Najeeb Ullah, Guilian Zhang, Hui Liu, and Ling Xu. 2024. "UBC Gene Family Analysis in Salvia castanea and Roles of ScUBC2/5 Genes under Abiotic Stress" Plants 13, no. 10: 1353. https://doi.org/10.3390/plants13101353
APA StyleZhu, L., Sun, Y., Ullah, N., Zhang, G., Liu, H., & Xu, L. (2024). UBC Gene Family Analysis in Salvia castanea and Roles of ScUBC2/5 Genes under Abiotic Stress. Plants, 13(10), 1353. https://doi.org/10.3390/plants13101353