Exogenous Melatonin Promotes Glucoraphanin Biosynthesis by Mediating Glutathione in Hairy Roots of Broccoli (Brassica oleracea L. var. italica Planch)
Abstract
:1. Introduction
2. Results
2.1. Integrative Analysis of the Transcriptome and Proteome
2.1.1. Correlation Analysis of the Transcriptome and Proteome
2.1.2. GO Association Analysis of Transcriptome and Proteome
2.1.3. KEGG Enrichment Analysis of the Transcriptome and Proteome
2.1.4. Effect of MT Treatment on Glutathione Metabolism in Hairy Broccoli Roots
2.2. Effect of MT Treatment on Physiological Indicators of Hairy Broccoli Roots
2.3. Effect of MT Treatment on Key Genes and Proteins Related to Glucoraphanin and Sulforaphane Synthesis in Hairy Broccoli Roots
2.4. Validation of Transcriptome Data by qRT-qPCR Analyses
2.5. Effects of Exogenous GSH on the Synthesis of Glucoraphanin and Sulforaphane in Hairy Broccoli Roots
2.6. Effects of Exogenous GSH on the Synthesis of Glucoraphanin and Sulforaphane as Well as the Expression of Glutathione-Related Genes in Hairy Broccoli Roots
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Experimental Design
4.3. Experimental Methods
4.3.1. Solution Configuration
4.3.2. Extraction and Detection of Reduced Glutathione in Hairy Roots
4.3.3. Extraction and Detection of Glutathione Reductase Activity in Hairy Roots
4.4. RNA-Seq Library Construction and Illumina Sequencing
4.4.1. RNA Extraction Library Construction and Sequencing
4.4.2. Differentially Expressed Gene Analysis
4.5. Proteomics
4.5.1. Protein Extraction, Protein Digestion, and Tandem Mass Tags Labeling
4.5.2. LC–MS/MS Analysis
4.5.3. Protein Identification and Data Analysis
4.5.4. Data Processing
4.6. Real-Time Quantitative PCR Analysis
4.7. Data Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
GLS | Glucosinolates |
GRA | Glucoraphanin |
SF | Sulforaphane |
MYR | Myrosinase |
MT | Melatonin |
DEGs | Differentially expressed genes |
DAPs | Differentially abundant proteins |
GO | Gene ontology |
KEGG | Kyoto Encyclopedia of Genes and Genomes |
GSH | Glutathione |
TMT | Tandem mass spectrometry tagging |
ROS | Reactive oxygen species |
GSTs | glutathione S-transferases |
References
- Li, H.; Xia, Y.; Liu, H.Y.; Guo, H.; He, X.Q.; Liu, Y.; Wu, D.T.; Mai, Y.H.; Li, H.B.; Zou, L.; et al. Nutritional values, beneficial effects, and food applications of broccoli (Brassica oleracea var. italica Plenck). Trends Food Sci. Technol. 2022, 119, 288–308. [Google Scholar] [CrossRef]
- Thomas, M.; Badr, A.; Desjardins, Y.; Gosselin, A.; Angers, P. Characterization of industrial broccoli discards (Brassica oleracea var. italica) for their glucosinolate, polyphenol and flavonoid contents using UPLC MS/MS and spectrophotometric methods. Food Chem. 2018, 245, 1204–1211. [Google Scholar] [CrossRef]
- Tian, M.; Yang, Y.; Ávila, F.W.; Fish, T.; Yuan, H.; Hui, M.; Pan, S.; Thannhauser, T.W.; Li, L. Effects of Selenium Supplementation on Glucosinolate Biosynthesis in Broccoli. J. Agric. Food Chem. 2018, 66, 8036–8044. [Google Scholar] [CrossRef] [PubMed]
- Falk, K.L.; Tokuhisa, J.G.; Gershenzon, J. The effect of sulfur nutrition on plant glucosinolate content: Physiology and molecular mechanisms. Plant Biol. 2007, 9, 573–581. [Google Scholar] [CrossRef] [PubMed]
- Sugiyama, R.; Li, R.; Kuwahara, A.; Nakabayashi, R.; Sotta, N.; Mori, T.; Ito, T.; Ohkama-Ohtsu, N.; Fujiwara, T.; Saito, K.; et al. Retrograde sulfur flow from glucosinolates to cysteine in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 2021, 118, e2017890118. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Kawaguchi, R.; Morikawa-Ichinose, T.; Allahham, A.; Kim, S.J.; Maruyama-Nakashita, A. Sulfur Deficiency-Induced Glucosinolate Catabolism Attributed to Two β-Glucosidases, BGLU28 and BGLU30, is Required for Plant Growth Maintenance under Sulfur Deficiency. Plant Cell Physiol. 2020, 61, 803–813. [Google Scholar] [CrossRef] [PubMed]
- Maruyama-Nakashita, A. Metabolic changes sustain the plant life in low-sulfur environments. Curr. Opin. Plant Biol. 2017, 39, 144–151. [Google Scholar] [CrossRef] [PubMed]
- Tang, L.; Paonessa, J.D.; Zhang, Y.; Ambrosone, C.B.; McCann, S.E. Total isothiocyanate yield from raw cruciferous vegetables commonly consumed in the United States. J. Funct. Foods 2013, 5, 1996–2001. [Google Scholar] [CrossRef]
- Wu, Q.; Wang, J.; Mao, S.; Xu, H.; Wu, Q.; Liang, M.; Yuan, Y.; Liu, M.; Huang, K. Comparative transcriptome analyses of genes involved in sulforaphane metabolism at different treatment in Chinese kale using full-length transcriptome sequencing. BMC Genom. 2019, 20, 377. [Google Scholar] [CrossRef]
- Latté, K.P.; Appel, K.E.; Lampen, A. Health benefits and possible risks of broccoli—An overview. Food Chem. Toxicol. 2011, 49, 3287–3309. [Google Scholar] [CrossRef]
- Choi, W.J.; Kim, S.K.; Park, H.K.; Sohn, U.D.; Kim, W. Anti-Inflammatory and Anti-Superbacterial Properties of Sulforaphane from Shepherd’s Purse. Korean J. Physiol. Pharmacol. 2014, 18, 33–39. [Google Scholar] [CrossRef] [PubMed]
- Kang, K.; Yu, M. Protective effect of sulforaphane against retinal degeneration in the Pde6rd10 mouse model of retinitis pigmentosa. Curr. Eye Res. 2017, 42, 1684–1688. [Google Scholar] [CrossRef] [PubMed]
- Bao, J.Y.; Lu, X.; Ma, L.; Zhang, X.M.; Tian, P.; Zhang, X.L.; Li, S.; Ma, S.Y.; Yang, J.; Lu, Y.Q.; et al. Transcriptome analysis of genes related to glucoraphanin and sulforaphane synthesis in methyl jasmonate treated broccoli (Brassica oleracea var. italica) hairy roots. J. Plant Res. 2022, 135, 757–770. [Google Scholar] [CrossRef] [PubMed]
- Ma, S.Y.; Bao, J.Y.; Lu, Y.; Lu, X.; Tian, P.; Zhang, X.M.; Yang, J.; Shi, X.T.; Pu, Z.H.; Li, S. Glucoraphanin and sulforaphane biosynthesis by melatonin mediating nitric oxide in hairy roots of broccoli (Brassica oleracea L. var. italica Planch): Insights from transcriptome data. BMC Plant Biol. 2022, 22, 403. [Google Scholar] [CrossRef]
- Tian, P.; Lu, X.; Bao, J.Y.; Zhang, X.M.; Lu, Y.; Zhang, X.; Wei, Y.; Yang, J.; Li, S.; Ma, S. Transcriptomics analysis of genes induced by melatonin related to glucosinolates synthesis in broccoli hairy roots. Plant Signal. Behav. 2021, 16, 1952742. [Google Scholar] [CrossRef]
- Zhang, X.L.; Bao, J.Y.; Lu, X.; Tian, P.; Yang, J.; Wei, Y.; Li, S.; Ma, S. Transcriptome analysis of melatonin regulating the transformation of glucoraphanin to sulforaphane in broccoli hairy roots. Physiol. Mol. Biol. Plants 2022, 28, 51–64. [Google Scholar] [CrossRef] [PubMed]
- Huffman, G.A.; White, F.F.; Gordon, M.P.; Nester, E.W. Hairy-root-inducing plasmid: Physical map and homology to tumor-inducing plasmids. J. Bacteriol. 1984, 157, 269–276. [Google Scholar] [CrossRef]
- Blakesley, D.; Chaldecott, M.A. The role of endogenous anxin in root initiation. Plant Growth Regul. 1993, 13, 77–84. [Google Scholar] [CrossRef]
- Guillon, S.; Trémouillaux-Guiller, J.; Pati, P.K.; Rideau, M.; Gantet, P. Hairy root research: Recent scenario and exciting prospects. Curr. Opin. Plant Biol. 2006, 9, 341–346. [Google Scholar] [CrossRef]
- Georgiev, M.I.; Pavlov, A.I.; Bley, T. Hairy root type plant in vitro systems as sources of bioactive substances. Appl. Microbiol. Biotechnol. 2007, 74, 1175–1185. [Google Scholar] [CrossRef]
- Jiao, J.; Gai, Q.Y.; Wang, W.; Zang, Y.P.; Niu, L.L.; Fu, Y.J.; Wang, X. Remarkable enhancement of flavonoid production in a co-cultivation system of Isatis tinctoria L. hairy root cultures and immobilized Aspergillus niger. Ind. Crops Prod. 2018, 112, 252–261. [Google Scholar] [CrossRef] [PubMed]
- Shilpha, J.; Satish, L.; Kavikkuil, M.; Largir, M.; Ramesh, M. Methyl jasmonate elicits the solasodine production and anti-oxidant activity in hairy root cultures of Solanum trilobatum L. Ind. Crop Prod. 2015, 71, 51–64. [Google Scholar] [CrossRef]
- Wang, Q.J.; Zheng, L.P.; Yuan, H.Y.; Wang, J.W. Propagation of Salvia miltiorrhiza from hairy root explants via somatic embryogenesis and tanshinone content in obtained plants. Ind. Crop Prod. 2013, 50, 648–653. [Google Scholar] [CrossRef]
- Kim, S.J.; Park, W.T.; Uddin, M.R.; Kim, Y.B.; Nam, S.Y.; Jho, K.H.; Park, S.U. Glucosinolate biosynthesis in hairy root cultures of broccoli (Brassica oleracea var. italica). Nat. Prod. Commun. 2013, 8, 217–220. [Google Scholar] [CrossRef] [PubMed]
- Lerner, A.B.; Case, J.; Takahashi, Y.; Lee, T.H.; Mori, W. Isolation of melatonin, the pineal gland factor that lightens melanocytes. J. Am. Chem. Soc. 1958, 80, 2587. [Google Scholar] [CrossRef]
- Dubbels, R.; Reiter, R.J.; Klenke, E.; Goebel, A.; Schnakenberg, E.; Ehlers, C.; Schiwara, H.W.; Schloot, W. Melatonin in edible plants identified by radioimmunoassay and by high performance liquid chromatography-mass spectrometry. J. Pineal Res. 1995, 18, 28–31. [Google Scholar] [CrossRef] [PubMed]
- Hattori, A.; Migitaka, H.; Iigo, M.; Itoh, M.; Yamamoto, K.; Ohtani-Kaneko, R.; Hara, M.; Suzuki, T.; Reiter, R.J. Identification of melatonin in plants and its effects on plasma melatonin levels and binding to melatonin receptors in vertebrates. Biochem. Mol. Biol. Int. 1995, 35, 627–634. [Google Scholar]
- Gao, H.S.; Huang, L.Z.; Gong, Z.J.; Wang, X.T.; Qiao, X.Q.; Xiao, F.; Yang, Y.T.; Yu, B.H.; Guo, X.T.; Yu, C.Y.; et al. Exogenous melatonin application improves resistance to high manganese stress through regulating reactive oxygen species scavenging and ion homeostasis in tobacco. Plant Growth Regul. 2022, 98, 219–233. [Google Scholar] [CrossRef]
- Wu, X.; Ren, J.; Huang, X.Q.; Zheng, X.Z.; Tian, Y.C.; Shi, L.; Dong, P.; Li, Z.G. Melatonin: Biosynthesis, content, and function in horticultural plants and potential application. Sci. Hortic. 2021, 288, 110392. [Google Scholar] [CrossRef]
- Wang, T.; Hu, M.J.; Yuan, D.B.; Yun, Z.; Gao, Z.Y.; Su, Z.H.; Zhang, Z.K. Melatonin alleviates pericarp browning in litchi fruit by regulating membrane lipid and energy metabolisms. Postharvest Biol. Technol. 2020, 160, 111066. [Google Scholar] [CrossRef]
- Apostolova, N.; Victor, V.M. Molecular strategies for targeting antioxidants to mitochondria: Therapeutic implications. Antioxid. Redox Signal. 2015, 22, 686–729. [Google Scholar] [CrossRef] [PubMed]
- Sønderby, I.E.; Geu-Flores, F.; Halkier, B.A. Biosynthesis of glucosinolates—Gene discovery and beyond. Trends Plant Sci. 2010, 15, 283–290. [Google Scholar] [CrossRef] [PubMed]
- Piślewska-Bednarek, M.; Nakano, R.T.; Hiruma, K.; Pastorczyk, M.; Sanchez-Vallet, A.; Singkaravanit-Ogawa, S.; Ciesiołka, D.; Takano, Y.; Molina, A.; Schulze-Lefert, P.; et al. Glutathione transferase U13 functions in pathogen-triggered glucosinolate metabolism. Plant Physiol. 2018, 176, 538–551. [Google Scholar] [CrossRef] [PubMed]
- Zhao, C.; Yang, M.; Wu, X.; Wang, Y.; Zhang, R. Physiological and transcriptomic analyses of the effects of exogenous melatonin on drought tolerance in maize (Zea mays L.). Plant Physiol. Biochem. 2021, 168, 128–142. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Ren, J.; Lin, X.; Yang, Z.; Deng, X.; Ke, Q. Melatonin alleviates chromium toxicity in maize by modulation of cell wall polysaccharides biosynthesis, glutathione metabolism, and antioxidant capacity. Int. J. Mol. Sci. 2023, 24, 3816. [Google Scholar] [CrossRef] [PubMed]
- Hasan, M.K.; Ahammed, G.J.; Yin, L.; Shi, K.; Xia, X.; Zhou, Y.; Yu, J.; Zhou, J. Melatonin mitigates cadmium phytotoxicity through modulation of phytochelatins biosynthesis, vacuolar sequestration, and antioxidant potential in Solanum lycopersicum L. Front. Plant Sci. 2015, 6, 601. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Sun, X.; Li, C.; Wei, Z.; Liang, D.; Ma, F. Long-term exogenous application of melatonin delays drought-induced leaf senescence in apple. J. Pineal Res. 2013, 54, 292–302. [Google Scholar] [CrossRef]
- Dunbar, K.L.; Scharf, D.H.; Litomska, A.; Hertweck, C. Enzymatic carbon-sulfur bond formation in natural product biosynthesis. Chem. Rev. 2017, 117, 5521–5577. [Google Scholar] [CrossRef]
- Wang, L.; Ouyang, B.; Li, Y.; Feng, Y.; Jacquot, J.P.; Rouhier, N.; Xia, B. Glutathione regulates the transfer of iron-sulfur cluster from monothiol and dithiol glutaredoxins to apo ferredoxin. Protein Cell 2012, 3, 714–721. [Google Scholar] [CrossRef]
- May, M.J.; Teva, V.; Chris, L.; Marc, V.M.; Dirk, I. Glutathione homeostasis in plants: Implications for environmental sensing and plant development. J. Exp. Bot. 1998, 321, 649–667. [Google Scholar] [CrossRef]
- Sen, C.K. Glutathione homeostasis in response to exercise training and nutritional supplements. Mol. Cell. Biochem. 1999, 196, 31–42. [Google Scholar] [CrossRef] [PubMed]
- Cnubben, N.H.; Rietjens, I.M.; Wortelboer, H.; Van-Zanden, J.; Van-Bladeren, P.J. The interplay of glutathione-related processes in antioxidant defense. Environ. Toxicol. Pharmacol. 2001, 10, 141–152. [Google Scholar] [CrossRef] [PubMed]
- Hérouart, D.; Baudouin, E.; Frendo, P.; Harrison, J.; Santos, R.; Jamet, A.; Sype, G.V.; Touati, D.; Puppo, A. Reactive oxygen species, nitric oxide and glutathione: A key role in the establishment of the legume-Rhizobium symbiosis? Plant Physiol. Bioch. 2002, 40, 619–624. [Google Scholar] [CrossRef]
- Matés, J.M.; Pérez-Gómez, C.; Núñez de Castro, I.; Asenjo, M.; Márquez, J. Glutamine and its relationship with intracellular redox status, oxidative stress and cell proliferation/death. Int. J. Biochem. Cell Biol. 2002, 34, 439–458. [Google Scholar] [CrossRef] [PubMed]
- Pastori, G.M.; Foyer, C.H. Common components, networks, and pathways of cross-tolerance to stress. The central role of “redox” and abscisic acid-mediated controls. Plant Physiol. 2002, 129, 460–468. [Google Scholar] [CrossRef] [PubMed]
- Czerniawski, P.; Bednarek, P. Glutathione S-Transferases in the Biosynthesis of Sulfur-Containing Secondary Metabolites in Brassicaceae Plants. Front. Plant Sci. 2018, 9, 1639. [Google Scholar] [CrossRef] [PubMed]
- Hirai, M.Y.; Klein, M.; Fujikawa, Y.; Yano, M.; Goodenowe, D.B.; Yamazaki, Y.; Kanaya, S.; Nakamura, Y.; Kitayama, M.; Suzuki, H.; et al. Elucidation of gene-to-gene and metabolite-to-gene networks in arabidopsis by integration of metabolomics and transcriptomics. J. Biol. Chem. 2005, 280, 25590–25595. [Google Scholar] [CrossRef] [PubMed]
- Wentzell, A.M.; Rowe, H.C.; Hansen, B.G.; Ticconi, C.; Halkier, B.A.; Kliebenstein, D.J. Linking metabolic QTLs with network and cis-eQTLs controlling biosynthetic pathways. PLoS Genet. 2007, 3, 1687–1701. [Google Scholar] [CrossRef]
- Yang, Q.; Luo, M.; Zhou, Q.; Zhao, Y.; Chen, J.; Ji, S. Insights into the loss of glucoraphanin in post-harvested broccoli—Possible involvement of the declined supply capacity of sulfur donor. Plant Sci. 2023, 328, 111580. [Google Scholar] [CrossRef]
- Chen, J.X.; Wang, X.F. Plant Physiology Experimental Guidance; South China University of Technology Press: Guangzhou, China, 2002; pp. 122–127. [Google Scholar]
- Halliwell, B.; Foyer, C.H. Properties and physiological function of a glutathione reductase purified from spinach leaves by affinity chromatography. Planta 1978, 139, 9–17. [Google Scholar] [CrossRef]
- Zhang, C.W.; Wei, Y.P.; Xiao, D.; Gao, L.W.; Lyu, S.W.; Hou, X.L.; Bouuema, G. Transcriptomic and proteomic analyses provide new insights into the regulation mechanism of low-temperature-induced leafy head formation in Chinese cabbage. J. Proteom. 2016, 144, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Protein Name | Regulation | Gene Name | Regulation | GO Annotation | KEGG Annotation |
---|---|---|---|---|---|
FD3 | ↑ | FD3 | ↑ | -- | K02369 |
SG1 | ↑ | SG1 | ↑ | Molecular Function | -- |
GSTF11 | ↑ | GSTF11 | ↑ | Molecular Function | K00799 |
MIK2 | ↑ | MIK2 | ↑ | Cellular Component | -- |
A2 | ↑ | A2 | ↑ | Cellular Component | -- |
UCC2 | ↑ | UCC2 | ↑ | Molecular Function | -- |
CCP2 | ↑ | CCP2 | ↑ | Molecular Function | K12820 |
CYTB5-D | ↑ | CYTB5-D | ↑ | Molecular Function | -- |
SGS3 | ↑ | SGS3 | ↑ | Molecular Function | -- |
G6PD3 | ↑ | G6PD3 | ↑ | Cellular Component | K00036 |
SFH10 | ↑ | SFH10 | ↑ | Molecular Function | K02639 |
PG11 | ↓ | PG11 | ↓ | Biological Process | K01904 |
KIN14I | ↓ | KIN14I | ↓ | Molecular Function | K01810 |
IAR4 | ↓ | IAR4 | ↓ | Molecular Function | K10406 |
FUM1 | ↓ | FUM1 | ↓ | Molecular Function | K00161 |
NUDT7 | ↓ | NUDT7 | ↓ | Molecular Function | K01679 |
RPN11 | ↓ | RPN11 | ↓ | Molecular Function | -- |
SDH1-2 | ↓ | SDH1-2 | ↓ | Cellular Component | K03030 |
GAL1 | ↓ | GAL1 | ↓ | Cellular Component | K00234 |
PED1 | ↓ | PED1 | ↓ | Molecular Function | K18674 |
4CL4 | ↓ | 4CL4 | ↓ | Molecular Function | K07513 |
Gene Name | Primer Sequences (5′ to 3′) | Accession |
---|---|---|
ADF3 | Forward: GAGGAGCAGCAGAAGCAAGTGG | XM_013797493.2 |
Reverse: ATCGGCATTCATCAGCAGGAAGAC | ||
CYP83B1 | Forward: TTTCGGGTCAGGCAGAAGAATGTG | XM_013749594.1 |
Reverse: ATCCCTGTCGGTAGGCTCCAATC | ||
UGT74B1 | Forward: ACAACAGCGACCAACTCCAAAGG | XM_013730524.1 |
Reverse: GTGTAGGTGGTGGTGGCGATTG | ||
SUR1 | Forward: CGAAGAACAAGCACACGCCAAC | XM_013743483.1 |
Reverse: CTCCACCGAACCGCCAAACTG | ||
GSL-OH | Forward: ACGAGATGAAAATCGGCGTGAAGG | XM_013781535.1 |
Reverse: TGGCTTGCGGGTTATGGAATATGC | ||
FMOGS-OX5 | Forward: TGGCAGTGATCGGAGCAGGAG | XM_013749606.1 |
Reverse: GAAGACGACGACGGAGTGTGATTC | ||
GSTF9 | Forward: GCTCTGGTAACGCTCATCGAGAAG | XM_013827777.3 |
Reverse: AAGGCGAGATAAGCAGGCTGTTTG | ||
GSTF10 | Forward: CCGATTTGGCTCACCTTCCCTTC | XM_013766931.1 |
Reverse: TTCCAGGCAGCACGGTTACTAATC | ||
GSTF11 | Forward: ATCTTCTTCGTCAGCCGTTTGGTC | XM_013730029.1 |
Reverse: CCGTTCCTTGGTCCGCATACTTG | ||
GSTU5 | Forward: TTTGTATCAATGGCAAGAGCAGACG | XM_013889167.3 |
Reverse: TCCGACAAGTTCCTTCTCCAGATTC | ||
GSTL3 | Forward: CCGATCCACCCGCTCTGTTC | XM_013760577.1 |
Reverse: GCAGGCACCTTGTTTTCAGGATAG | ||
GSTU9 | Forward: CTGACTAACGAGACTATGAGCCTTG | XM_013756220.1 |
Reverse: GCCAACTACAGACACCAGGAAC | ||
GSTU22 | Forward: ATGGCTGATGAGGTGATTCTTCTAG | XM_013765269.1 |
Reverse: TCAGTGCGATCCTTGCTCTTAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bao, J.; Yang, J.; Lu, X.; Ma, L.; Shi, X.; Lan, S.; Zhao, Y.; Cao, J.; Ma, S.; Li, S. Exogenous Melatonin Promotes Glucoraphanin Biosynthesis by Mediating Glutathione in Hairy Roots of Broccoli (Brassica oleracea L. var. italica Planch). Plants 2024, 13, 106. https://doi.org/10.3390/plants13010106
Bao J, Yang J, Lu X, Ma L, Shi X, Lan S, Zhao Y, Cao J, Ma S, Li S. Exogenous Melatonin Promotes Glucoraphanin Biosynthesis by Mediating Glutathione in Hairy Roots of Broccoli (Brassica oleracea L. var. italica Planch). Plants. 2024; 13(1):106. https://doi.org/10.3390/plants13010106
Chicago/Turabian StyleBao, Jinyu, Jie Yang, Xu Lu, Lei Ma, Xiaotong Shi, Shimin Lan, Yi Zhao, Jie Cao, Shaoying Ma, and Sheng Li. 2024. "Exogenous Melatonin Promotes Glucoraphanin Biosynthesis by Mediating Glutathione in Hairy Roots of Broccoli (Brassica oleracea L. var. italica Planch)" Plants 13, no. 1: 106. https://doi.org/10.3390/plants13010106
APA StyleBao, J., Yang, J., Lu, X., Ma, L., Shi, X., Lan, S., Zhao, Y., Cao, J., Ma, S., & Li, S. (2024). Exogenous Melatonin Promotes Glucoraphanin Biosynthesis by Mediating Glutathione in Hairy Roots of Broccoli (Brassica oleracea L. var. italica Planch). Plants, 13(1), 106. https://doi.org/10.3390/plants13010106