Population Structure and Association Mapping for Agronomical and Biochemical Traits of a Large Spanish Apple Germplasm
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material and Field Trial
2.2. Leaf and Fruit Sampling
2.3. Phenotypical Evaluation of Biochemical Traits
2.3.1. Basic Fruit Quality
2.3.2. Antioxidant Compounds, Vitamin C, and Relative Antioxidant Capacity
2.3.3. Individual Sugars and Organic Acids
2.4. Microsatellite Loci Analysis and Genotyping
2.5. Data Analysis for the Whole Dataset
2.5.1. Phenotype Statistical Analyses
2.5.2. Diversity and Variability Assessment
2.5.3. Analysis of Population Structure
2.6. Data Analysis for the Association Mapping for 118 Accessions
2.6.1. Inter-Chromosomal Linkage Disequilibrium
2.6.2. Association Mapping
3. Results
3.1. Phenotypic Evaluation and Pearson’s Correlations
3.2. Genetic Diversity
3.3. Population Structure
3.4. Inter-Chromosomal Linkage Disequilibrium and Association Mapping
4. Discussion
4.1. Phenotypic Characterization
4.2. Genetic Identity and Overall Diversity
4.3. Population Structure
4.4. Association Mapping
5. Conclusions
Future Perspectives
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Urrestarazu, J.; Miranda, C.; Santesteban, L.G.; Royo, J.B. Genetic diversity and structure of local apple cultivars from Northeastern Spain assessed by microsatellite markers. Tree Genet. Genomes 2012, 8, 1163–1180. [Google Scholar] [CrossRef]
- FAOSTAT, 2021. Food and Agricultural Organization. Available online: http://faostat.fao.org (accessed on 31 January 2023).
- MAPAMA-España Ministerio de Agricultura, Pesca y Alimentación. Available online: https://www.mapa.gob.es/es/ (accessed on 22 October 2022).
- Mignard, P.; Beguería, S.; Reig, G.; i Forcada, C.F.; Moreno, M. Phenotypic analysis of fruit quality traits and effect of climate in an apple (Malus × domestica Borkh) germplasm bank of Aragón, Spain. Acta Hortic. 2021, 1307, 109–114. [Google Scholar] [CrossRef]
- Mignard, P.; Beguería, S.; Giménez, R.; i Forcada, C.F.; Reig, G.; Moreno, M. Effect of Genetics and Climate on Apple Sugars and Organic Acids Profiles. Agronomy 2022, 12, 827. [Google Scholar] [CrossRef]
- Urrestarazu, J.; Denancé, C.; Ravon, E.; Guyader, A.; Guisnel, R.; Feugey, L.; Poncet, C.; Lateur, M.; Houben, P.; Ordidge, M.; et al. Analysis of the genetic diversity and structure across a wide range of germplasm reveals prominent gene flow in apple at the European level. BMC Plant Biol. 2016, 16, 130. [Google Scholar] [CrossRef] [PubMed]
- Ordidge, M.; Kirdwichai, P.; Baksh, M.F.; Venison, E.P.; Gibbings, J.G.; Dunwell, J.M. Genetic analysis of a major international collection of cultivated apple varieties reveals previously unknown historic heteroploid and inbred relationships. PLoS ONE 2018, 13, e0202405. [Google Scholar] [CrossRef]
- Lassois, L.; Denancé, C.; Ravon, E.; Guyader, A.; Guisnel, R.; Hibrand-Saint-Oyant, L.; Poncet, C.; Lasserre-Zuber, P.; Feugey, L.; Durel, C.-E. Genetic Diversity, Population Structure, Parentage Analysis, and Construction of Core Collections in the French Apple Germplasm Based on SSR Markers. Plant Mol. Biol. Rep. 2016, 34, 827–844. [Google Scholar] [CrossRef]
- Gao, Y.; Liu, F.; Wang, K.; Wang, D.; Gong, X.; Liu, L.; Richards, C.M.; Henk, A.D.; Volk, G.M. Genetic diversity of Malus cultivars and wild relatives in the Chinese National Repository of Apple Germplasm Resources. Tree Genet. Genomes 2015, 11, 106. [Google Scholar] [CrossRef]
- Marconi, G.; Ferradini, N.; Russi, L.; Concezzi, L.; Veronesi, F.; Albertini, E. Genetic Characterization of the Apple Germplasm Collection in Central Italy: The Value of Local Varieties. Front. Plant Sci. 2018, 9, 1460. [Google Scholar] [CrossRef]
- Pereira-Lorenzo, S.; Urrestarazu, J.; Ramos-Cabrer, A.; Miranda, C.; Pina, A.; Dapena, E.; Moreno, M.; Errea, P.; Llamero, N.; Díaz-Hernández, M.; et al. Analysis of the genetic diversity and structure of the Spanish apple genetic resources suggests the existence of an Iberian genepool. Ann. Appl. Biol. 2017, 171, 424–440. [Google Scholar] [CrossRef]
- Urrestarazu, J.; Muranty, H.; Denancé, C.; Leforestier, D.; Ravon, E.; Guyader, A.; Guisnel, R.; Feugey, L.; Aubourg, S.; Celton, J.-M.; et al. Genome-Wide Association Mapping of Flowering and Ripening Periods in Apple. Front. Plant Sci. 2017, 8, 1923. [Google Scholar] [CrossRef]
- Vanderzande, S.; Micheletti, D.; Troggio, M.; Davey, M.W.; Keulemans, J. Genetic diversity, population structure, and linkage disequilibrium of elite and local apple accessions from Belgium using the IRSC array. Tree Genet. Genomes 2017, 13, 125. [Google Scholar] [CrossRef]
- Gross, B.L.; Volk, G.M.; Richards, C.M.; Forsline, P.L.; Fazio, G.; Chao, C.T. Identification of “Duplicate” Accessions within the USDA-ARS National Plant Germplasm System Malus Collection. J. Am. Soc. Hortic. Sci. 2012, 137, 333–342. [Google Scholar] [CrossRef]
- Velasco, R.; Zharkikh, A.; Affourtit, J.; Dhingra, A.; Cestaro, A.; Kalyanaraman, A.; Fontana, P.; Bhatnagar, S.K.; Troggio, M.; Pruss, D.; et al. The genome of the domesticated apple (Malus × domestica Borkh.). Nat. Genet. 2010, 42, 833–839. [Google Scholar] [CrossRef] [PubMed]
- Cornille, A.; Gladieux, P.; Smulders, M.J.M.; Roldán-Ruiz, I.; Laurens, F.; Le Cam, B.; Nersesyan, A.; Clavel, J.; Olonova, M.; Feugey, L.; et al. New Insight into the History of Domesticated Apple: Secondary Contribution of the European Wild Apple to the Genome of Cultivated Varieties. PLOS Genet. 2012, 8, e1002703. [Google Scholar] [CrossRef]
- Noiton, D.A.; Alspach, P.A. Founding Clones, Inbreeding, Coancestry, and Status Number of Modern Apple Cultivars. J. Am. Soc. Hortic. Sci. 1996, 121, 773–782. [Google Scholar] [CrossRef]
- Reig, G.; Blanco, Á.; Castillo, A.M.; Gogorcena, Y.; Moreno, M.Á. Phenotypic diversity of Spanish apple (Malus × domestica Borkh) accessions grown at the vulnerable climatic conditions of the Ebro Valley, Spain. Sci. Hortic. 2015, 185, 200–210. [Google Scholar] [CrossRef]
- Fernández i Martí, A.; Font i Forcada, C.; Company, R.S.I.; Rubio-Cabetas, M.J. Genetic relationships and population structure of local olive tree accessions from Northeastern Spain revealed by SSR markers. Acta Physiol. Plant. 2015, 37, 1726. [Google Scholar] [CrossRef]
- Mignard, P.; Beguería, S.; Reig, G.; i Forcada, C.F.; Moreno, M. Genetic origin and climate determine fruit quality and antioxidant traits on apple (Malus × domestica Borkh). Sci. Hortic. 2021, 285, 110142. [Google Scholar] [CrossRef]
- Fernández i Martí, A.; Font i Forcada, C.; Kamali, K.; Rubio-Cabetas, M.J.; Wirthensohn, M.; i Company, R.S. Molecular analyses of evolution and population structure in a worldwide almond [Prunus dulcis (Mill.) D.A. Webb syn. P. amygdalus Batsch] pool assessed by microsatellite markers. Genet. Resour. Crop. Evol. 2014, 62, 205–219. [Google Scholar] [CrossRef]
- Urrestarazu, J.; Errea, P.; Miranda, C.; Santesteban, L.G.; Pina, A. Genetic diversity of Spanish Prunus domestica L. germplasm reveals a complex genetic structure underlying. PLoS ONE 2018, 13, e0195591. [Google Scholar] [CrossRef]
- Liang, W.; Dondini, L.; De Franceschi, P.; Paris, R.; Sansavini, S.; Tartarini, S. Genetic Diversity, Population Structure and Construction of a Core Collection of Apple Cultivars from Italian Germplasm. Plant Mol. Biol. Rep. 2014, 33, 458–473. [Google Scholar] [CrossRef]
- Vanderzande, S.; Howard, N.P.; Cai, L.; Linge, C.D.S.; Antanaviciute, L.; Bink, M.C.A.M.; Kruisselbrink, J.W.; Bassil, N.; Gasic, K.; Iezzoni, A.; et al. High-quality, genome-wide SNP genotypic data for pedigreed germplasm of the diploid outbreeding species apple, peach, and sweet cherry through a common workflow. PLoS ONE 2019, 14, e0210928. [Google Scholar] [CrossRef]
- Patocchi, A.; Fernández-Fernández, F.; Evans, K.; Gobbin, D.; Rezzonico, F.; Boudichevskaia, A.; Dunemann, F.; Stankiewicz-Kosyl, M.; Mathis-Jeanneteau, F.; Durel, C.E.; et al. Development and test of 21 multiplex PCRs composed of SSRs spanning most of the apple genome. Tree Genet. Genomes 2008, 5, 211–223. [Google Scholar] [CrossRef]
- Liu, Z.; Bao, D.; Liu, D.; Zhang, Y.; Ashraf, M.A.; Chen, X. Construction of a Genetic Linkage Map and QTL Analysis of Fruit-related Traits in an F1 Red Fuji × Hongrou Apple Hybrid. Open Life Sci. 2016, 11, 487–497. [Google Scholar] [CrossRef]
- Zhen, Q.; Fang, T.; Peng, Q.; Liao, L.; Zhao, L.; Owiti, A.; Han, Y. Developing gene-tagged molecular markers for evaluation of genetic association of apple SWEET genes with fruit sugar accumulation. Hortic. Res. 2018, 5, 14. [Google Scholar] [CrossRef] [PubMed]
- Eom, J.-S.; Chen, L.-Q.; Sosso, D.; Julius, B.T.; Lin, I.; Qu, X.-Q.; Braun, D.M.; Frommer, W.B. SWEETs, transporters for intracellular and intercellular sugar translocation. Curr. Opin. Plant Biol. 2015, 25, 53–62. [Google Scholar] [CrossRef] [PubMed]
- Font i Forcada, C.; Oraguzie, N.; Igartua, E.; Moreno, M.; Gogorcena, Y. Population structure and marker–trait associations for pomological traits in peach and nectarine cultivars. Tree Genet. Genomes 2012, 9, 331–349. [Google Scholar] [CrossRef]
- Font i Forcada, C.; Oraguzie, N.; Reyes-Chin-Wo, S.; Espiau, M.T.; Socias i Company, R.; Fernandez i Marti, A. Identification of Genetic Loci Associated with Quality Traits in Almond via Association Mapping. PLoS ONE 2015, 10, e0127656. [Google Scholar] [CrossRef]
- Amyotte, B.; Bowen, A.J.; Banks, T.; Rajcan, I.; Somers, D.J. Mapping the sensory perception of apple using descriptive sensory evaluation in a genome wide association study. PLoS ONE 2017, 12, e0171710. [Google Scholar] [CrossRef]
- Gutierrez, B.L.; Arro, J.; Zhong, G.-Y.; Brown, S.K. Linkage and association analysis of dihydrochalcones phloridzin, sieboldin, and trilobatin in Malus. Tree Genet. Genomes 2018, 14, 91. [Google Scholar] [CrossRef]
- Larsen, B.; Migicovsky, Z.; Jeppesen, A.A.; Gardner, K.M.; Toldam-Andersen, T.B.; Myles, S.; Ørgaard, M.; Petersen, M.A.; Pedersen, C. Genome-Wide Association Studies in Apple Reveal Loci for Aroma Volatiles, Sugar Composition, and Harvest Date. Plant Genome 2019, 12, 180104. [Google Scholar] [CrossRef] [PubMed]
- McClure, K.A.; Gardner, K.M.; Douglas, G.M.; Song, J.; Forney, C.F.; DeLong, J.; Fan, L.; Du, L.; Toivonen, P.M.; Somers, D.J.; et al. A Genome-Wide Association Study of Apple Quality and Scab Resistance. Plant Genome 2018, 11, 170075. [Google Scholar] [CrossRef]
- McClure, K.A.; Gong, Y.; Song, J.; Vinqvist-Tymchuk, M.; Palmer, L.C.; Fan, L.; Burgher-MacLellan, K.; Zhang, Z.; Celton, J.-M.; Forney, C.F.; et al. Genome-wide association studies in apple reveal loci of large effect controlling apple polyphenols. Hortic. Res. 2019, 6, 107. [Google Scholar] [CrossRef] [PubMed]
- Font i Forcada, C.; Reig, G.; Giménez, R.; Mignard, P.; Mestre, L.; Moreno, M. Sugars and organic acids profile and antioxidant compounds of nectarine fruits influenced by different rootstocks. Sci. Hortic. 2019, 248, 145–153. [Google Scholar] [CrossRef]
- Singleton, V.L.; Rossi, J.A. Colorimetry of total phenolics with phosphomolybdic-phosphotungsticacid reagents. Am. J. Enol. Vitic. 1965, 16, 144–158. [Google Scholar]
- Zhishen, J.; Mengcheng, T.; Jianming, W. The determination of flavonoid contents in mulberry and their scavenging effects on superoxide radicals. Food Chem. 1999, 64, 555–559. [Google Scholar] [CrossRef]
- Brand-Williams, W.; Cuvelier, M.E.; Berset, C. Use of a free radical method to evaluate antioxidant activity. LWT Food Sci. Technol. 1995, 28, 25–30. [Google Scholar] [CrossRef]
- Zaharieva, T.B.; Abadía, J. Iron deficiency enhances the levels of ascorbate, glutathione, and related enzymes in sugar beet roots. Protoplasma 2003, 221, 269–275. [Google Scholar] [CrossRef]
- Lateur, M.; Ordidge, J.; Engels, J.; Lipman, E. Report of a Working Group on Malus/Pyrus: Fourth Meeting, 7–9 March 2012, Weggis, Switzerland; Bioversity International: Rome, Italy, 2013. [Google Scholar]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2019; Available online: https://www.R-project.org/ (accessed on 15 December 2022).
- Kimura, M.; Crow, J.F. The Number of Alleles that Can Be Maintained in a Finite Population. Genetics 1964, 49, 725–738. [Google Scholar] [CrossRef]
- Meirmans, P.G. genodiveversion 3.0: Easy-to-use software for the analysis of genetic data of diploids and polyploids. Mol. Ecol. Resour. 2020, 20, 1126–1131. [Google Scholar] [CrossRef]
- Nei, M. Analysis of Gene Diversity in Subdivided Populations. Proc. Natl. Acad. Sci. USA 1973, 70, 3321–3323. [Google Scholar] [CrossRef] [PubMed]
- Lewontin, R.C. The Apportionment of Human Diversity. In Evolutionary Biology; Springer: New York, NY, USA, 1972; pp. 381–398. [Google Scholar] [CrossRef]
- Yeh, F.C.; Yang, R.C.; Boyle, T.B.; Ye, Z.H.; Mao, J.X. POPGENE, The User-Friendly Shareware for Population Genetic Analysis; Molecular Biology and Biotechnology Center, University of Alberta: Edmonton, AB, Canada, 1997; Volume 10, pp. 295–301. [Google Scholar]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software structure: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef]
- Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program cervus accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef]
- Flint-Garcia, S.A.; Thornsberry, J.M.; Buckler, E.S. Structure of Linkage Disequilibrium in Plants. Annu. Rev. Plant Biol. 2003, 54, 357–374. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Buckler, E.S. Genetic association mapping and genome organization of maize. Curr. Opin. Biotechnol. 2006, 17, 155–160. [Google Scholar] [CrossRef] [PubMed]
- Aprea, E.; Charles, M.; Endrizzi, I.; Corollaro, M.L.; Betta, E.; Biasioli, F.; Gasperi, F. Sweet taste in apple: The role of sorbitol, individual sugars, organic acids and volatile compounds. Sci. Rep. 2017, 7, 44950. [Google Scholar] [CrossRef]
- Castel, L.; Pina, A.; Irisarri, P.; Errea, P. Sugar content and organic acid profiles of local apple cultivars recovered from mountain zones. J. Appl. Bot. Food Qual. 2020, 93, 217–224. [Google Scholar] [CrossRef]
- Donahue, D.; Córdoba, G.R.; Elone, S.; Wallis, A.; Basedow, M. ‘Honeycrisp’ Bitter Pit Response to Rootstock and Region under Eastern New York Climatic Conditions. Plants 2021, 10, 983. [Google Scholar] [CrossRef]
- Kistechok, A.; Wrona, D.; Krupa, T. Quality and Nutritional Value of ‘Chopin’ and Clone ‘JB’ in Relation to Popular Apples Growing in Poland. Agriculture 2022, 12, 1876. [Google Scholar] [CrossRef]
- Slatnar, A.; Kwiecinska, I.; Licznar-Malanczuk, M.; Veberic, R. The effect of green cover within rows on the qualitative and quantitative fruit parameters of full-cropping apple trees. Hortic. Environ. Biotechnol. 2019, 61, 41–49. [Google Scholar] [CrossRef]
- Yang, S.; Meng, Z.; Li, Y.; Chen, R.; Yang, Y.; Zhao, Z. Evaluation of Physiological Characteristics, Soluble Sugars, Organic Acids and Volatile Compounds in ‘Orin’ Apples (Malus domestica) at Different Ripening Stages. Molecules 2021, 26, 807. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Wang, C.; Jia, R.; Yang, N.; Jin, L.; Zhu, L.; Ma, B.; Yao, Y.-X.; Ma, F.; Li, M. Malate metabolism mediated by the cytoplasmic malate dehydrogenase gene MdcyMDH affects sucrose synthesis in apple fruit. Hortic. Res. 2022, 9, uhac194. [Google Scholar] [CrossRef] [PubMed]
- Preti, R.; Tarola, A.M. Study of polyphenols, antioxidant capacity and minerals for the valorisation of ancient apple cultivars from Northeast Italy. Eur. Food Res. Technol. 2020, 247, 273–283. [Google Scholar] [CrossRef]
- Raudone, L.; Raudonis, R.; Liaudanskas, M.; Janulis, V.; Viskelis, P. Phenolic antioxidant profiles in the whole fruit, flesh and peel of apple cultivars grown in Lithuania. Sci. Hortic. 2017, 216, 186–192. [Google Scholar] [CrossRef]
- Pandey, V.P.; Awasthi, M.; Singh, S.; Tiwari, S.; Dwivedi, U.N. A Comprehensive Review on Function and Application of Plant Peroxidases. Biochem. Anal. Biochem. 2017, 6, 308. [Google Scholar] [CrossRef]
- Ruan, Y.L. Sucrose metabolism: Gateway to diverse carbon use and sugar signaling. Annu. Rev. Plant Biol. 2014, 65, 33–67. [Google Scholar] [CrossRef]
- Vallarino, J.G.; Osorio, S. Organic acids. In Postharvest Physiology and Biochemistry of Fruits and Vegetables; Woodhead Publishing: Cambridge, UK, 2019; pp. 207–224. [Google Scholar] [CrossRef]
- Li, M.; Feng, F.; Cheng, L. Expression Patterns of Genes Involved in Sugar Metabolism and Accumulation during Apple Fruit Development. PLoS ONE 2012, 7, e33055. [Google Scholar] [CrossRef] [PubMed]
- Swarup, S.; Cargill, E.J.; Crosby, K.; Flagel, L.; Kniskern, J.; Glenn, K.C. Genetic diversity is indispensable for plant breeding to improve crops. Crop. Sci. 2020, 61, 839–852. [Google Scholar] [CrossRef]
- Bakɪr, M.; Dumanoglu, H.; Aygun, A.; Erdogan, V.; Dost, S.E.; Gülsen, O.; Serdar, U.; Kalkisim, O.; Bastas, K. Genetic diversity and population structure of apple germplasm from Eastern Black Sea region of Turkey by SSRs. Sci. Hortic. 2021, 294, 110793. [Google Scholar] [CrossRef]
- Ferreira, V.; Ramos-Cabrer, A.M.; Carnide, V.; Pinto-Carnide, O.; Assunção, A.; Marreiros, A.; Rodrigues, R.; Pereira-Lorenzo, S.; Castro, I. Genetic pool structure of local apple cultivars from Portugal assessed by microsatellites. Tree Genet. Genomes 2016, 12, 36. [Google Scholar] [CrossRef]
- Khachtib, Y.; Zinelabidine, L.H.; Bouda, S.; Hamdali, H.; Hammada, S.; Haddioui, A. Genetic characterization of cultivated apple (Malus × domestica Borkh.) in Morocco using microsatellite (SSR) markers. Ecol. Genet. Genom. 2022, 23, 100122. [Google Scholar] [CrossRef]
- Van Treuren, R.; Kemp, H.; Ernsting, G.; Jongejans, B.; Houtman, H.; Visser, L. Microsatellite genotyping of apple (Malus × domestica Borkh.) genetic resources in the Netherlands: Application in collection management and variety identification. Genet. Resour. Crop. Evol. 2010, 57, 853–865. [Google Scholar] [CrossRef]
- Herrero, J.; Cambra, M.; Tabuenca, M.C. Cartografía de Frutales de Hueso y Pepita; Consta de 12 Tomos, más Uno por Cada Provincia Española; Dpto. de Pomología, Estación Experimental de Aula Dei (CSIC): Zaragoza, Spain, 1964. [Google Scholar]
- Bühlmann, A.; Gassmann, J.; Ingenfeld, A.; Hunziker, K.; Kellerhals, M.; Frey, J.E. Molecular Characterisation of the Swiss Fruit Genetic Resources. Erwerbs-Obstbau 2015, 57, 29–34. [Google Scholar] [CrossRef]
- Patzak, J.; Paprštein, F.; Henychová, A.; Sedlák, J. Comparison of genetic diversity structure analyses of SSR molecular marker data within apple (Malus × domestica) genetic resources. Genome 2012, 55, 647–665. [Google Scholar] [CrossRef]
- Meland, M.; Aksic, M.F.; Frøynes, O.; Konjic, A.; Lasic, L.; Pojskic, N.; Gasi, F. Genetic Identity and Diversity of Apple Accessions within a Candidate Collection for the Norwegian National Clonal Germplasm Repository. Horticulturae 2022, 8, 630. [Google Scholar] [CrossRef]
- Jung, M.; Roth, M.; Aranzana, M.J.; Auwerkerken, A.; Bink, M.; Denancé, C.; Dujak, C.; Durel, C.-E.; i Forcada, C.F.; Cantin, C.M.; et al. The apple REFPOP—A reference population for genomics-assisted breeding in apple. Hortic. Res. 2020, 7, 189. [Google Scholar] [CrossRef]
- Jung, M.; Keller, B.; Roth, M.; Aranzana, M.J.; Auwerkerken, A.; Guerra, W.; Al-Rifaï, M.; Lewandowski, M.; Sanin, N.; Ry-menants, M.; et al. Genetic architecture and genomic predictive ability of apple quantitative traits across environments. Hortic. Res. 2022, 9, uhac028. [Google Scholar] [CrossRef]
- Gross, B.L.; Henk, A.D.; Richards, C.M.; Fazio, G.; Volk, G.M. Genetic diversity in Malus × domestica (Rosaceae) through time in response to domestication. Am. J. Bot. 2014, 101, 1770–1779. [Google Scholar] [CrossRef]
- Wedger, M.J.; Schumann, A.C.; Gross, B.L. Candidate genes and signatures of directional selection on fruit quality traits during apple domestication. Am. J. Bot. 2021, 108, 616–627. [Google Scholar] [CrossRef]
- Li, M.; Guo, J.; He, J.; Xu, C.; Li, J.; Mi, C.; Tao, S. Possible impact of climate change on apple yield in Northwest China. Theor. Appl. Clim. 2019, 139, 191–203. [Google Scholar] [CrossRef]
- Cevik, V.; Ryder, C.D.; Popovich, A.; Manning, K.; King, G.J.; Seymour, G.B. A FRUITFULL-like gene is associated with genetic variation for fruit flesh firmness in apple (Malus domestica Borkh.). Tree Genet. Genomes 2009, 6, 271–279. [Google Scholar] [CrossRef]
- Tsykun, T.; Rellstab, C.; Dutech, C.; Sipos, G.; Prospero, S. Comparative assessment of SSR and SNP markers for inferring the population genetic structure of the common fungus Armillaria cepistipes. Heredity 2017, 119, 371–380. [Google Scholar] [CrossRef]
- Guichoux, E.; Lagache, L.; Wagner, S.; Chaumeil, P.; Léger, P.; Lepais, O.; Lepoittevin, C.; Malausa, T.; Revardel, E.; Salin, F.; et al. Current trends in microsatellite genotyping. Mol. Ecol. Resour. 2011, 11, 591–611. [Google Scholar] [CrossRef]
- Chagné, D.; Krieger, C.; Rassam, M.; Sullivan, M.; Fraser, J.; André, C.; Pindo, M.; Troggio, M.; Gardiner, S.E.; Henry, R.A.; et al. QTL and candidate gene mapping for polyphenolic composition in apple fruit. BMC Plant Biol. 2012, 12, 12. [Google Scholar] [CrossRef]
- Guan, Y.; Peace, C.; Rudell, D.; Verma, S.; Evans, K. QTLs detected for individual sugars and soluble solids content in apple. Mol. Breed. 2015, 35, 135. [Google Scholar] [CrossRef]
- Howard, N.P.; Tillman, J.; Vanderzande, S.; Luby, J.J. Genetics of zonal leaf chlorosis and genetic linkage to a major gene regulating skin anthocyanin production (MdMYB1) in the apple (Malus × domestica) cultivar Honeycrisp. PLoS ONE 2019, 14, e0210611. [Google Scholar] [CrossRef]
- Kenis, K.; Keulemans, J.; Davey, M.W. Identification and stability of QTLs for fruit quality traits in apple. Tree Genet. Genomes 2008, 4, 647–661. [Google Scholar] [CrossRef]
- Kunihisa, M.; Moriya, S.; Abe, K.; Okada, K.; Haji, T.; Hayashi, T.; Kim, H.; Nishitani, C.; Terakami, S.; Yamamoto, T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breed. Sci. 2014, 64, 240–251. [Google Scholar] [CrossRef] [PubMed]
- Sun, R.; Chang, Y.; Yang, F.; Wang, Y.; Li, H.; Zhao, Y.; Chen, D.; Wu, T.; Zhang, X.; Han, Z. A dense SNP genetic map constructed using restriction site-associated DNA sequencing enables detection of QTLs controlling apple fruit quality. BMC Genom. 2015, 16, 747. [Google Scholar] [CrossRef]
- Zhang, B.; Han, Y. Genomics of Fruit Acidity and Sugar Content in Apple. In The Apple Genome; Springer: Cham, Switzerland, 2021; pp. 297–309. [Google Scholar]
- Oh, S.; Ahn, S.; Han, H.; Kim, K.; Kim, S.A.; Kim, D. Genetic linkage maps and QTLs associated with fruit skin color and acidity in apple (Malus × domestica). Hortic. Environ. Biotechnol. 2023, 1–12. [Google Scholar] [CrossRef]
- Celton, J.-M.; Martinez, S.; Jammes, M.-J.; Bechti, A.; Salvi, S.; Legave, J.-M.; Costes, E. Deciphering the genetic determinism of bud phenology in apple progenies: A new insight into chilling and heat requirement effects on flowering dates and positional candidate genes. New Phytol. 2011, 192, 378–392. [Google Scholar] [CrossRef]
- Chagné, D.; Dayatilake, D.; Diack, R.; Oliver, M.; Ireland, H.; Watson, A.E.; Gardiner, S.; Johnston, J.W.; Schaffer, R.J.; Tustin, S. Genetic and environmental control of fruit maturation, dry matter and firmness in apple (Malus × domestica Borkh.). Hortic. Res. 2014, 1, 14046. [Google Scholar] [CrossRef]
- Liu, G.-S.; Li, H.-L.; Grierson, D.; Fu, D.-Q. NAC Transcription Factor Family Regulation of Fruit Ripening and Quality: A Review. Cells 2022, 11, 525. [Google Scholar] [CrossRef]
- Zhu, M.; Chen, G.; Zhou, S.; Tu, Y.; Wang, Y.; Dong, T.; Hu, Z. A New Tomato NAC (NAM/ATAF1/2/CUC2) Transcription Factor, SlNAC4, Functions as a Positive Regulator of Fruit Ripening and Carotenoid Accumulation. Plant Cell Physiol. 2013, 55, 119–135. [Google Scholar] [CrossRef]
- Nieuwenhuizen, N.J.; Chen, X.; Wang, M.Y.; Matich, A.J.; Perez, R.L.; Allan, A.C.; Green, S.A.; Atkinson, R.G. Natural Variation in Monoterpene Synthesis in Kiwifruit: Transcriptional Regulation of Terpene Synthases by NAC and ETHYLENE-INSENSITIVE3-Like Transcription Factors. Plant Physiol. 2015, 167, 1243–1258. [Google Scholar] [CrossRef]
- Hyun, T.K.; Eom, S.H.; Kim, J.S. Genomic analysis and gene structure of the two invertase families in the domesticated apple (Malus domestica Borkh). Plant Omics 2011, 4, 391–399. [Google Scholar]
- Gharghani, A.; Zamani, Z.; Talaie, A.; Oraguzie, N.C.; Fatahi, R.; Hajnajari, H.; Wiedow, C.; Gardiner, S.E. Genetic identity and relationships of Iranian apple (Malus × domestica Borkh.) cultivars and landraces, wild Malus species and representative old apple cultivars based on simple sequence repeat (SSR) marker analysis. Genet. Resour. Crop. Evol. 2009, 56, 829–842. [Google Scholar] [CrossRef]
- Raja, W.H.; Yousuf, N.; Qureshi, I.; Sharma, O.C.; Singh, D.B.; Kumawat, K.L.; Nabi, S.U.; Mir, J.I.; Sheikh, M.A.; Kirmani, S.N.; et al. Morpho-molecular characterization and genetic diversity analysis across wild apple (Malus baccata) accessions using simple sequence repeat markers. South Afr. J. Bot. 2021, 145, 378–385. [Google Scholar] [CrossRef]
N° | Accession | EEAD Code | Ploidy | Origin |
---|---|---|---|---|
1 | Aciprés * | 3339 | 2n | Spanish |
2 | Akane * | 2902 | 2n | non-Spanish |
3 | Almenar-2 * | 3555 | 2n | Spanish |
4 | Ascara-1 | 3423 | 3n | Spanish |
5 | Ascara-2 * | 3424 | 2n | Spanish |
6 | Astrakan Red * | 3378 | 2n | non-Spanish |
7 | Audiena de Oroz * | 3375 | 2n | Spanish |
8 | Augüenta * | 3335 | 2n | Spanish |
9 | Averdal-1 * | 882021 | 2n | non-Spanish |
10 | Averdal-2 | 892340 | 2n | non-Spanish |
11 | Baujade * | 923284 | 2n | non-Spanish |
12 | Belgolden | 3193 | 2n | non-Spanish |
13 | Bellaguarda Lardero * | 3547 | 2n | Spanish |
14 | Belleza de Roma * | 638 | 2n | non-Spanish |
15 | Biscarri-1 * | 3726 | 2n | Spanish |
16 | Blackjon * | 2690 | 2n | non-Spanish |
17 | Blacktayman | 2490 | 3n | non-Spanish |
18 | Bofla * | 3418 | 2n | Spanish |
19 | Boluaga | 3340 | 3n | Spanish |
20 | Boskoop Rouge | 2898 | 3n | non-Spanish |
21 | Bossost-1 | 3626 | 3n | Spanish |
22 | Bossost-2 | 3627 | 3n | Spanish |
23 | Bossost-4 * | 3629 | 2n | Spanish |
24 | Bost Kantoia * | 3341 | 2n | Spanish |
25 | Cabdellà-2 * | 3613 | 2n | Spanish |
26 | Cabello de Angel * | 3255 | 2n | Spanish |
27 | Calvilla de San Salvador * | 3342 | 2n | Spanish |
28 | Camosa-1 * | 3553 | 2n | Spanish |
29 | Camosa-2 * | 3620 | 2n | Spanish |
30 | Camuesa de Daroca * | 3371 | 2n | Spanish |
31 | Camuesa de Llobregat * | 1342 | 2n | Spanish |
32 | Camuesa Fina de Aragón * | 3372 | 2n | Spanish |
33 | Carapanón | 3634 | 3n | Spanish |
34 | Carrió | 3636 | 3n | Spanish |
35 | Cella * | 2512 | 2n | Spanish |
36 | Cepiland | 881967 | 2n | non-Spanish |
37 | Charden | 303 | 3n | non-Spanish |
38 | Ciri Blanc * | 3402 | 2n | Spanish |
39 | Cirio * | 3615 | 2n | Spanish |
40 | Cox’s Orange Pippin * | 2889 | 2n | non-Spanish |
41 | Cripps Pink * | 933540 | 2n | non-Spanish |
42 | Crispin | 3080 | 3n | non-Spanish |
43 | Cuallarga * | 3467 | 2n | Spanish |
44 | Cul de Cirio * | 3551 | 2n | Spanish |
45 | De Agosto * | 3619 | 2n | Spanish |
46 | De Pera * | 3416 | 2n | Spanish |
47 | De Valdés * | 3632 | 2n | Spanish |
48 | Delbar Estivale | 3262 | 2n | non-Spanish |
49 | Delciri * | 3413 | 2n | Spanish |
50 | Delcon * | 2896 | 2n | non-Spanish |
51 | Delgared Infel * | 902708 | 2n | non-Spanish |
52 | Deljeni * | 851305 | 2n | non-Spanish |
53 | Delkistar * | 923273 | 2n | non-Spanish |
54 | Delorgue Festival * | 913044 | 2n | non-Spanish |
55 | Democrat | 2892 | 3n | non-Spanish |
56 | Elista * | 912883 | 2n | non-Spanish |
57 | Esperiega * | 3420 | 2n | Spanish |
58 | Esperiega de Olba * | 3725 | 2n | Spanish |
59 | Eugenia * | 3468 | 2n | Spanish |
60 | Evasni (Scarlet Spur) | 933554 | 2n | non-Spanish |
61 | Florina * | 3633 | 2n | non-Spanish |
62 | Fortuna Delicious | 2702 | 2n | non-Spanish |
63 | Freyberg | 2611 | 2n | non-Spanish |
64 | Fuji * | 3488 | 2n | non-Spanish |
65 | Fukutami | 2895 | 2n | non-Spanish |
66 | Gala * | 3197 | 2n | non-Spanish |
67 | Galaxy * | 892451 | 2n | non-Spanish |
68 | Gloster 69 | 3140 | 2n | non-Spanish |
69 | Golden Auvil Spur | 2402 | 2n | non-Spanish |
70 | Golden Delicious * | 675 | 2n | non-Spanish |
71 | Golden Delicious Infel * | 2491 | 2n | non-Spanish |
72 | Golden Paradise * | 3739 | 2n | non-Spanish |
73 | Golden Smoothee * | 3286 | 2n | non-Spanish |
74 | Granny Smith-1 * | 3196 | 2n | non-Spanish |
75 | Granny Smith-2 * | 2614 | 2n | non-Spanish |
76 | Gravenstein | 3109 | 3n | non-Spanish |
77 | Guillemes * | 3411 | 2n | Spanish |
78 | Hared * | 892232 | 2n | non-Spanish |
79 | Harrold Red Delicious | 2899 | 2n | non-Spanish |
80 | Helada * | 3368 | 2n | Spanish |
81 | Hierro * | 3374 | 2n | Spanish |
82 | Idared * | 2484 | 2n | non-Spanish |
83 | Irgo-2 * | 3622 | 2n | Spanish |
84 | Jerseymac | 3141 | 2n | non-Spanish |
85 | Jonadel * | 2650 | 2n | non-Spanish |
86 | Jonagored | 882001 | 3n | non-Spanish |
87 | Jonathan-1 * | 2495 | 2n | non-Spanish |
88 | Jonathan-2 * | 3096 | 2n | non-Spanish |
89 | Jubilee * | 851304 | 2n | non-Spanish |
90 | Kidd’s Orange Red | 2888 | 2n | non-Spanish |
91 | Kinrei | 2900 | 2n | non-Spanish |
92 | Lancer | 881968 | 2n | non-Spanish |
93 | Landetxo * | 3343 | 2n | Spanish |
94 | Les-1 * | 3624 | 2n | Spanish |
95 | Les-2 | 3625 | 3n | Spanish |
96 | MacIntosh * | 3192 | 2n | non-Spanish |
97 | Mañaga-1 * | 469 | 2n | Spanish |
98 | Mañaga-2 * | 3554 | 2n | Spanish |
99 | Marinera * | 3412 | 2n | Spanish |
100 | Marquiñez | 3419 | 3n | Spanish |
101 | Médulas-1 * | 3548 | 2n | Spanish |
102 | Melrose * | 2484 | 2n | non-Spanish |
103 | Merrigold * | 851307 | 2n | non-Spanish |
104 | Montcada-1 * | 3631 | 2n | Spanish |
105 | Morro de Liebre * | 3256 | 2n | Spanish |
106 | Mutsu | 2487 | 3n | non-Spanish |
107 | Nesple * | 3410 | 2n | Spanish |
108 | Normanda | 3252 | 3n | Spanish |
109 | Nueva Starking * | 1899 | 2n | non-Spanish |
110 | Ortell-1 | 413 | 3n | Spanish |
111 | Ortell-2 * | 3546 | 2n | Spanish |
112 | Ozark Gold | 3175 | 2n | non-Spanish |
113 | Pera 2 * | 3417 | 2n | Spanish |
114 | Pera de Sangüesa | 3379 | 3n | Spanish |
115 | Pero Pardo | 3369 | 3n | Spanish |
116 | Peromingan * | 1158 | 2n | Spanish |
117 | Peruco de Caparroso * | 3373 | 2n | Spanish |
118 | Plaona * | 923283 | 2n | non-Spanish |
119 | Poma de San Juan * | 3556 | 2n | Spanish |
120 | Prau Riu-3 * | 3491 | 2n | Spanish |
121 | Prau Riu-4 | 3492 | 3n | Spanish |
122 | Prau Riu-5 * | 3493 | 2n | Spanish |
123 | Prima * | 851306 | 2n | non-Spanish |
124 | Prime Gold | 3198 | 2n | non-Spanish |
125 | Rebellón * | 3370 | 2n | Spanish |
126 | Red Delicious * | 3085 | 2n | non-Spanish |
127 | Red Elstar | 882002 | 2n | non-Spanish |
128 | Red King Delicious | 2688 | 2n | non-Spanish |
129 | Red Rome Beauty * | 2897 | 2n | non-Spanish |
130 | Redaphough * | 933411 | 2n | non-Spanish |
131 | RedChief * | 851308 | 2n | non-Spanish |
132 | Redspur Delicious | 3082 | 2n | non-Spanish |
133 | Regal Prince-1 | 882022 | 2n | non-Spanish |
134 | Regal Prince-2 * | 892341 | 2n | non-Spanish |
135 | Reguard-2 * | 3617 | 2n | Spanish |
136 | Reguard-4 * | 3618 | 2n | Spanish |
137 | Reina de Reinetas | 2488 | 3n | non-Spanish |
138 | Reineta Blanca del Canadá-1 | 308 | 3n | non-Spanish |
139 | Reineta Blanca del Canadá-2 | 3111 | 3n | non-Spanish |
140 | Reineta Blanca del Canadá-3 | 3194 | 3n | non-Spanish |
141 | Reineta Encarnada * | 3635 | 2n | Spanish |
142 | Reineta Gris | 2883 | 3n | non-Spanish |
143 | Reineta Inesita Asua | 2543 | 3n | Spanish |
144 | Reineta Regil | 3466 | 3n | Spanish |
145 | Reneta * | 3408 | 2n | Spanish |
146 | Richared Delicious | 2481 | 2n | non-Spanish |
147 | Roja Valle de Benejama * | 1038 | 2n | Spanish |
148 | Roser de la Reula * | 3552 | 2n | Spanish |
149 | Royal Red Delicious | 2363 | 2n | non-Spanish |
150 | Rubinete * | 861526 | 2n | non-Spanish |
151 | Ruixou-1 * | 3614 | 2n | Spanish |
152 | San Felipe * | 3376 | 2n | Spanish |
153 | San Miguel * | 2579 | 2n | Spanish |
154 | Sandía * | 3336 | 2n | Spanish |
155 | Sant Jaume | 3470 | 3n | Spanish |
156 | Sant Joan * | 3409 | 2n | Spanish |
157 | Santa Margarida | 3401 | 3n | Spanish |
158 | Shelred | 2893 | 2n | non-Spanish |
159 | Signatillis * | 3403 | 2n | Spanish |
160 | Solafuente | 3559 | 3n | Spanish |
161 | Spartan | 2483 | 2n | non-Spanish |
162 | Starking-1 * | 2964 | 2n | non-Spanish |
163 | Starking-2 * | 632 | 2n | non-Spanish |
164 | Starkrimson-1 * | 3195 | 2n | non-Spanish |
165 | Starkrimson-2 | 1904 | 2n | non-Spanish |
166 | Stayman Waynesap | 3110 | 3n | non-Spanish |
167 | Taüll-1 * | 3623 | 2n | Spanish |
168 | Telamon * | 3398 | 2n | non-Spanish |
169 | Tempera * | 3334 | 2n | Spanish |
170 | Terrera | 3469 | 3n | Spanish |
171 | Topred Delicious | 2651 | 2n | non-Spanish |
172 | Totxa * | 3471 | 2n | Spanish |
173 | Trajan | 3396 | 2n | non-Spanish |
174 | Transparente * | 3377 | 2n | Spanish |
175 | Transparente Blanca * | 3344 | 2n | Spanish |
176 | Turley Winnesap | 2884 | 3n | non-Spanish |
177 | Tuscan | 3397 | 2n | non-Spanish |
178 | Urarte | 3415 | 3n | Spanish |
179 | Urtebete * | 3345 | 2n | Spanish |
180 | Valsaina * | 3558 | 2n | Spanish |
181 | Vance Delicious | 2647 | 2n | non-Spanish |
182 | Verde Doncella-1 * | 2125 | 2n | Spanish |
183 | Verde Doncella-2 | 310 | 2n | Spanish |
184 | Verde Doncella-3 * | 3549 | 2n | Spanish |
185 | Vinçada Tardía | 3621 | 3n | Spanish |
186 | Wellspur Delicious | 3081 | 2n | non-Spanish |
Locus | LG | Multiplex | Dye | Size Range (bp) | Forward Primer Sequence (5′→3′) | Reverse Primer Sequence (5′→3′) | Primer Concentration | Reference |
---|---|---|---|---|---|---|---|---|
CH-Vf1 | 1 | MP5 | VIC | 130–171 | ATCACCACCAGCAGCAAAG | CATACAAATCAAAGCACAACCC | [0.1 µM] | [1] |
Hi02c07 | 1 | MP3 | VIC | 98–146 | AGAGCTACGGGGATCCAAAT | GTTTAAGCATCCCGATTGAAAGG | [0.1 µM] | [1] |
CH02c06 | 2 | MP3 | PET | 201–261 | TGACGAAATCCACTACTAATGCA | GATTGCGCGCTTTTTAACAT | [0.4 µM] | [1] |
GD12 | 3 | MP3 | NED | 139–189 | TTGAGGTGTTTCTCCCATTGGA | CTAACGAAGCCGCCATTTCTTT | [0.1 µM] | [1] |
MdSWEET2a | 3 | MP6 | VIC | 331–357 | ATACCGAGGAACTGTAGGACCAAGC | CTCCACACTAAACAACCAGAAAGCA | [0.1 µM] | [27] |
MdSWEET9b | 4 | MP4 | 6-FAM | 336–360 | GCGCCAATGTAAGACCCTTTACTTT | CTGACCTTGTCCTTCTTGGATGCGTA | [0.1 µM] | [27] |
CH05f06 | 5 | MP2 | NED | 161–189 | TTAGATCCGGTCACTCTCCACT | TGGAGGAAGACGAAGAAGAAAG | [0.1 µM] | [1] |
MdSWEET2d | 5 | MP6 | PET | 265–289 | CATTCAATTTATTCGACCGGACGAC | TGGGTTCATCCCTCACTTTCACTCA | [0.1 µM] | [27] |
MdSWEET7b | 6 | MP4 | VIC | 230–267 | GGGTTTTGAGAATCTTGAGGGTAGG | TTTGATGGGTTGGACTGTAACTTGC | [0.1 µM] | [27] |
CH03d07 | 6 | MP3 | VIC | n.a. | CAAATCAATGCAAAACTGTCA | GGCTTCTGGCCATGATTTTA | [0.1 µM] | [1] |
CH04e05 | 7 | MP1 | PET | 163–228 | AGGCTAACAGAAATGTGGTTTG | ATGGCTCCTATTGCCATCAT | [0.1 µM] | [1] |
CH01h10 | 8 | MP4 | PET | 81–120 | TGCAAAGATAGGTAGATATATGCCA | AGGAGGGATTGTTTGTGCAC | [0.1 µM] | [1] |
CH01f03b | 9 | MP5 | NED | 127–177 | GAGAAGCAAATGCAAAACCC | CTCCCCGGCTCCTATTCTAC | [0.1 µM] | [1] |
CH01h02 | 9 | MP1 | NED | n.a. | AGAGCTTCGAGCTTCGTTTG | ATCTTTTGGTGCTCCCACAC | [0.1 µM] | [1] |
CH02c11 | 10 | MP2 | PET | 208–238 | TGAAGGCAATCACTCTGTGC | TTCCGAGAATCCTCTTCGAC | [0.15 µM] | [1] |
MdSWEET2e | 10 | MP4 | NED | 205–243 | GTGAGCCCACAACTAATCCCAT | CTTGTGCGTAGGAATCCCGATA | [0.1 µM] | [27] |
CH02d08 | 11 | MP1 | VIC | 196–256 | TCCAAAATGGCGTACCTCTC | GCAGACACTCACTCACTATCTCTC | [0.1 µM] | [1] |
MdSWEET2b | 11 | MP5 | 6-FAM | 249–263 | TGAGGCAGAAACAATCATAAGGGTC | GAGCACGGAATTTGAAGCTGTAAAA | [0.1 µM] | [27] |
MdSWEET7a | 11 | MP5 | PET | 340–376 | TTCTATCTCCCCTTCCCAAACTTCC | GCTAAACAGTGCCACTGCATAAGGT | [0.1 µM] | [27] |
CH01f02 | 12 | MP1 | 6-FAM | 155–212 | ACCACATTAGAGCAGTTGAGG | CTGGTTTGTTTTCCTCCAGC | [0.1 µM] | [1] |
GD147 | 13 | MP3 | PET | 124–158 | TCCCGCCATTTCTCTGC | GTTTAAACCGCTGCTGCTGAAC | [0.1 µM] | [1] |
CH04c07 | 14 | MP2 | VIC | 93–139 | GGCCTTCCATGTCTCAGAAG | CCTCATGCCCTCCACTAACA | [0.1 µM] | [1] |
MdSWEET12a | 14 | MP6 | NED | 223–253 | ATGACAGGGCAACTTCAGGGT | CGTAATAGTCCTTTGCCCTCC | [0.1 µM] | [27] |
CH02c09 | 15 | MP2 | VIC | 203–254 | TTATGTACCAACTTTGCTAACCTC | AGAAGCAGCAGAGGAGGATG | [0.1 µM] | [1] |
CH04f10 | 16 | MP3 | 6-FAM | n.a. | GTAATGGAAATACAGTTTCACAA | TTAAATGCTTGGTGTGTTTTGC | [0.1 µM] | [1] |
CH01h01 | 17 | MP2 | 6-FAM | 92–130 | GAAAGACTTGCAGTGGGAGC | GGAGTGGGTTTGAGAAGGTT | [0.1 µM] | [1] |
Trait | Units | Minimum | Maximum | Mean | SD | SE | ANOVA |
---|---|---|---|---|---|---|---|
SSC | °Brix | 10.14 | 17.03 | 13.40 | 1.36 | 0.47 | *** |
TA | g malic acid L−1 | 1.77 | 17.29 | 6.61 | 2.92 | 1.35 | *** |
RI | - | 0.76 | 8.55 | 2.62 | 1.34 | 1.45 | *** |
TPC | mg GAE 100 g FW−1 | 15.24 | 98.07 | 39.54 | 15.76 | 0.08 | *** |
TFC | mg CE 100 g FW−1 | 6.00 | 88.95 | 22.84 | 14.67 | 0.12 | *** |
AsA | mg AsA 100 g FW−1 | 1.37 | 5.30 | 2.83 | 0.82 | 0.27 | *** |
RAC | mg Trolox 100 g FW−1 | 5.93 | 30.82 | 15.44 | 5.08 | 0.12 | *** |
Sucrose | g.kg−1 | 10.29 | 42.14 | 25.52 | 7.01 | 0.64 | *** |
Glucose | g.kg−1 | 6.23 | 24.29 | 13.17 | 4.12 | 0.38 | *** |
Fructose | g.kg−1 | 31.39 | 61.41 | 45.55 | 5.17 | 0.48 | *** |
Sorbitol | g.kg−1 | 1.20 | 11.96 | 4.55 | 2.43 | 0.22 | *** |
Sugars | g.kg−1 | 63.69 | 115.27 | 88.76 | 9.87 | 0.91 | *** |
Oxalic | g.kg−1 | 0.0136 | 0.0176 | 0.0147 | 0.0006 | 0.0001 | *** |
Citric | g.kg−1 | 0.0178 | 0.1482 | 0.0556 | 0.0279 | 0.0026 | *** |
Tartaric | g.kg−1 | 0.0260 | 0.0910 | 0.0480 | 0.0146 | 0.0013 | *** |
Malic | g.kg−1 | 2.6831 | 9.8144 | 5.5182 | 1.6930 | 0.1559 | *** |
Quinic | g.kg−1 | 0.2350 | 0.8005 | 0.4231 | 0.1151 | 0.0106 | *** |
Succinic + Shikimic | g.kg−1 | 0.1948 | 1.6766 | 0.5570 | 0.2520 | 0.0232 | *** |
Acids | g.kg−1 | 3.4242 | 11.3889 | 6.6085 | 1.8218 | 0.1677 | *** |
SSR | NA | NE | NB | Ho | He | Fis |
---|---|---|---|---|---|---|
CH-Vf1 | 13 | 3.50 | 10 | 0.75 | 0.73 | −0.03 |
Hi02c07 | 9 | 3.40 | 4 | 0.68 | 0.70 | 0.03 |
CH02c06 | 21 | 8.54 | 14 | 0.93 | 0.90 | −0.03 |
GD12 | 17 | 2.85 | 13 | 0.71 | 0.69 | −0.03 |
MdSWEET2a | 12 | 4.28 | 8 | 0.83 | 0.81 | −0.02 |
MdSWEET9b | 9 | 2.53 | 5 | 0.66 | 0.63 | −0.05 |
CH05f06 | 14 | 5.79 | 7 | 0.86 | 0.92 | 0.07 |
MdSWEET2d | 13 | 4.88 | 8 | 0.44 | 0.81 | 0.46 |
MdSWEET7b | 15 | 5.17 | 9 | 0.96 | 0.87 | −0.10 |
CH04e05 | 30 | 3.47 | 26 | 0.67 | 0.73 | 0.08 |
CH01h10 | 18 | 3.23 | 14 | 0.78 | 0.72 | −0.08 |
CH01f03b | 15 | 5.24 | 11 | 0.92 | 0.82 | −0.12 |
CH02c11 | 15 | 8.72 | 5 | 0.89 | 0.90 | 0.01 |
MdSWEET2e | 12 | 1.50 | 10 | 0.19 | 0.41 | 0.54 |
CH02d08 | 25 | 8.98 | 18 | 0.85 | 0.90 | 0.06 |
MdSWEET2b | 4 | 1.96 | 2 | 0.51 | 0.50 | −0.02 |
MdSWEET7a | 12 | 3.61 | 8 | 0.72 | 0.74 | 0.03 |
CH01f02 | 35 | 8.60 | 29 | 0.81 | 0.90 | 0.10 |
GD147 | 15 | 4.29 | 9 | 0.83 | 0.78 | −0.06 |
CH04c07 | 19 | 7.06 | 11 | 0.92 | 0.91 | −0.01 |
MdSWEET12a | 8 | 2.42 | 4 | 0.60 | 0.58 | −0.03 |
CH02c09 | 13 | 6.96 | 5 | 0.93 | 0.87 | −0.07 |
CH01h01 | 16 | 5.80 | 10 | 0.75 | 0.83 | 0.10 |
Mean-186 accessions (Pop1) | 15.65 | 4.90 | 10.43 | 0.75 | 0.77 | 0.03 |
Mean diploids-150 accessions (Pop2) | 14.70 | 5.23 | 9.22 | 0.79 | 0.77 | −0.03 |
Mean triploids-36 accessions (Pop3) | 10.00 | 4.66 | 5.26 | 0.71 | 0.73 | 0.03 |
Agronomical | Antioxidants | Basic Fruit Quality | Individual Sugars | Individual Organic Acids | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
LG | Marker Name | Harvest | Peel Color | RAC | TFC | TPC | AsA | SSC | TA | RI | Suc | Glu | Fru 1 | Sor | Sug | Oxa | Cit | Tar | Mal | Qui | Succ-Shi | Acids |
1 | CH-Vf1 | *** | * | ** | ||||||||||||||||||
1 | Hi02c07 | ** | ** | * | * | |||||||||||||||||
2 | CH02c06 | *** | ** | * | * | * | ** | * | *** | * | *** | * | * | * | *** | |||||||
3 | GD12 1 | |||||||||||||||||||||
3 | MdSWEET2a | ** | * | * | * | *** | * | ** | * | * | * | |||||||||||
4 | MdSWEET9b | * | * | ** | * | |||||||||||||||||
5 | CH05f06 | * | ** | *** | *** | ** | ** | * | * | *** | * | * | *** | ** | ** | |||||||
5 | MdSWEET2d | * | * | ** | ** | ** | * | ** | ||||||||||||||
6 | MdSWEET7b | *** | ** | *** | * | * | ||||||||||||||||
7 | CH04e05 | ** | ** | * | *** | |||||||||||||||||
8 | CH01h10 | ** | ||||||||||||||||||||
9 | CH01f03b | * | ** | * | ** | ** | * | *** | ** | |||||||||||||
10 | CH02c11 | ** | ** | * | * | |||||||||||||||||
10 | MdSWEET2e 1 | |||||||||||||||||||||
11 | CH02d08 1 | |||||||||||||||||||||
11 | MdSWEET2b | * | * | * | * | * | * | * | ||||||||||||||
11 | MdSWEET7a | * | * | ** | * | * | ** | |||||||||||||||
12 | CH01f02 | * | ** | *** | * | *** | * | * | ||||||||||||||
13 | GD147 | ** | ||||||||||||||||||||
14 | CH04c07 | * | * | * | ** | * | ** | *** | * | * | * | * | * | * | * | |||||||
14 | MdSWEET12a | *** | ** | * | ** | *** | ||||||||||||||||
15 | CH02c09 | * | * | ** | ||||||||||||||||||
17 | CH01h01 | * | * | * | * | ** |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mignard, P.; Font i Forcada, C.; Giménez, R.; Moreno, M.Á. Population Structure and Association Mapping for Agronomical and Biochemical Traits of a Large Spanish Apple Germplasm. Plants 2023, 12, 1249. https://doi.org/10.3390/plants12061249
Mignard P, Font i Forcada C, Giménez R, Moreno MÁ. Population Structure and Association Mapping for Agronomical and Biochemical Traits of a Large Spanish Apple Germplasm. Plants. 2023; 12(6):1249. https://doi.org/10.3390/plants12061249
Chicago/Turabian StyleMignard, Pierre, Carolina Font i Forcada, Rosa Giménez, and María Ángeles Moreno. 2023. "Population Structure and Association Mapping for Agronomical and Biochemical Traits of a Large Spanish Apple Germplasm" Plants 12, no. 6: 1249. https://doi.org/10.3390/plants12061249
APA StyleMignard, P., Font i Forcada, C., Giménez, R., & Moreno, M. Á. (2023). Population Structure and Association Mapping for Agronomical and Biochemical Traits of a Large Spanish Apple Germplasm. Plants, 12(6), 1249. https://doi.org/10.3390/plants12061249