Next Article in Journal
Untapped Sources of Dual Resistance to Hessian Fly and Greenbug in Synthetic Hexaploid Wheats
Previous Article in Journal
Analysis and Identification of Genes Associated with the Desiccation Sensitivity of Panax notoginseng Seeds
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 12
Issue 22
10.3390/plants12223882
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification of the NRT1 Family Members and Their Expression under Low-Nitrate Conditions in Chinese Cabbage (Brassica rapa L. ssp. pekinensis)

by
Yihui Zhang
1,†,
Faujiah Nurhasanah Ritonga
1,2,†,
Shu Zhang
1,
Fengde Wang
1,
Jingjuan Li
1,* and
Jianwei Gao
1,*
1
Shandong Branch of National Vegetable Improvement Center, Institute of Vegetables, Shandong Academy of Agricultural Science, Jinan 250100, China
2
Graduate School, Padjadjaran University, Bandung 40132, West Java, Indonesia
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Plants 2023, 12(22), 3882; https://doi.org/10.3390/plants12223882
Submission received: 29 May 2023 / Revised: 6 November 2023 / Accepted: 9 November 2023 / Published: 17 November 2023
Browse Figures
Review Reports Versions Notes

Abstract

:
Nitrate transporters (NRTs) actively take up and transform nitrate (N) to form a large family with many members and distinct functions in plant growth and development. However, few studies have identified them in the context of low nitrate concentrations in Chinese cabbage (Brassica rapa L. ssp. Pekinensis), an important vegetable in China. This study focuses on the identification and analysis of the nitrate transporter 1 (NRT1) gene family as well as various aspects, including its phylogenic distribution, chromosomal position, gene structure, conserved motifs, and duplication pattern. Using bioinformatics methods, we identified and analyzed 84 BrNRT1 genes distributed on ten chromosomes. Furthermore, we conducted an analysis of the expression profile of the NRT1 gene in various tissues of Chinese cabbage exposed to varying nitrate concentrations. A phylogenetic analysis revealed that BrNRT1s members are distributed in six distinct groups. Based on an analysis of gene structure and conserved motifs, it can be inferred that BrNRT1 exhibits a generally conserved structural pattern. The promoters of BrNRT1 were discovered to contain moosefs (MFS) elements, suggesting their potential role in the regulation of NO3− transport across the cell membrane in Chinese cabbage. A transcriptome study and a subsequent RT-qPCR analysis revealed that the expression patterns of some BrNRT1 genes were distinct to specific tissues. This observation implies these genes may contribute to nitrate uptake and transport in various tissues or organs. The results offer fundamental insights into investigating the NRT1 gene family in Chinese cabbage. These results provide basic information for future research on the functional characterization of NRT1 genes in Chinese cabbage and the elucidation of the molecular mechanisms underlying low nitrogen tolerance in Chinese cabbage.

1. Introduction

Nitrogen (N) is a crucial element due to its function in leaf and growth development, seed germination and dormancy, floral induction, and response to stress [1,2,3]. Nitrate (NO3−) is a significant source of N for higher plants and a signal that regulates plant development [4,5,6]. Nitrate–nitrogen is the primary source of inorganic N for plants in soils with a high oxygen content. The spatial and temporal variations in the nitrate–nitrogen concentration result from leaching and microbial activity. However, plants have developed physiological and morphological adaptations to cope with a fluctuating soil nitrate supply. In addition, it was found that the regulatory networks of the transport proteins involved in nitrate uptake are complex in plants.
The significant development of nitrate transporter families was identified and characterized at the molecular level in recent years. However, the absorption and transportation of nitrate in plants primarily depend on the involvement of the NRT1, nitrate transporter 2 (NRT2) [7], and chloride channel (CLC) multigenic families [8,9]. NRT1 is a member of the vast PTR (peptide transporter) family, which includes members known as proton-coupled oligopeptide transporter (POT) and solute carrier 15 (SLC15) [7,10]. NRT1 was initially considered to be a low-affinity nitrate transporter. Several recent studies found that NRT1 is a dual-affinity transporter, such as AtNRT1.1 in A. thaliana and MtNRT1.3 in Medicago truncatula [11,12]. In addition, ZmNRT1.1B was found to be a high-affinity nitrate transporter in Zea mays [13]. Recently, the NRT1 nitrate transporter family was studied extensively due to its specificity in plant growth and development. Since the first discovery of NPF6.3/AtNRT1.1/CHL1 proteins in Arabidopsis thaliana [14], additional NRT1.1 homologs have been cloned and functionally classified in various plant species [15,16]. Currently, 53, 93, and 91 NRT1 family members have been identified from Arabidopsis, rice, and sorghum, respectively [17,18,19]. In Arabidopsis, NRT1 members have been demonstrated to play an important role as transporters of nitrate and other substrates [20,21]. NRT1 genes are expressed in roots, leaves, and xylem sap. AtNRT1.1 and AtNRT1.2 are important for absorbing nitrate from the soil solution into root cells [22,23]. Furthermore, AtNRT1.9 plays a crucial role in transporting nitrates from root stelae to root phloem to improve downward nitrate transport in roots [24]. NRT1.4 contributes to nitrate storage in leaf petioles [25]. NRT1.5 and NRT1.8 are important for loading and recovering nitrate from xylem sap [26,27]. NRT1.6 is involved in the transfer of nitrate from maternal tissue to developing embryos [28]. Nitrate is transferred from older to younger leaves through NRT1.7, NRT1.11, and NRT1.12 [29,30].
Chinese cabbage, scientifically known as Brassica campestris L. ssp. Chinensis L., a species in the family Brassicaceae, is known to have originated in China. At present, Chinese cabbage, known as Brassica rapa L. ssp. Pekinensis, is an important vegetable crop in China due to its prominent position in terms of its cultivation area inside the country. In addition, Chinese cabbage plays a crucial role in ensuring a stable supply of vegetables and maintaining market equilibrium in China [31]. As Chinese cabbage is a leafy vegetable, it accumulates nitrates during its growth and development [32]. To enhance the quality and productivity of Chinese cabbage, the N intake in Chinese cabbage fields is often 2–5 times greater than the recommended level for Chinese cabbage cultivation [33]. A previous study confirmed that 12 kg of pure N per an area of 667 m2 is recommended without the concurrent use of organic fertilizer [33]. Therefore, research on the molecular mechanism of N uptake in Chinese cabbage might contribute to addressing these issues, as well as provide theoretical support for the study of NRT1.1 in other species. However, the research on nitrate transporter genes and their impact on overall efficiency in Chinese cabbage are limited compared to studies conducted on Arabidopsis, rice (Oryza sativa L.), and tomato (Solanum lycopersicum).
In this study, we identified and analyzed 84 BrNRT1 genes and several of their aspects, including their phylogenic distribution, chromosomal position, gene structure, conserved motifs, and duplication pattern under low-nitrate (LN) conditions in the Chinese cabbage genome. Furthermore, we conducted an analysis of the expression profile of the NRT1 gene in various tissues of Chinese cabbage exposed to varying nitrate concentrations. Our findings are expected to serve as a genetic base and foundation for comprehending the involvement of the NRT1 genes in the process of nitrogen uptake in Chinese cabbage.

2. Results

2.1. Identification of BrNRT1s in Chinese Cabbage

We identified 84 protein sequences of BrNRT1 using all AtNRT1 amino acid (aa) sequences from the Chinese cabbage genome, and their basic characteristics are listed in Table S1. The 84 BrNRT1 genes were distributed over ten chromosomes. The lengths of these BrNRT1 protein sequences varied from 194aa (BraA05g001720.3C) to 1071aa (BraA02g020750.3C) and their molecular weights ranged from 21.5 kD (BraA05g001720.3C) to 117.9 kD (BraA02g020750.3C), while their theoretical isoelectric point (pI) values ranged from 5.23 (BraA09g059270.3C) to 9.58 (BraA06g009470.3C). Through a subcellular localization prediction, it was revealed that a majority of BrNRT1 is located in the plasma membrane.

2.2. Phylogenetic Analysis of BrNRT1s

To examine the evolutionary relationships within BrNRT1s, a multi-sequence alignment was performed, using the 84 BrNRT1s to construct a phylogenetic tree (Figure 1). Then, the information gathered from the alignment was utilized to construct an unrooted phylogenetic tree. Notably, the absence of any BrNRT1 from the phylogenetic tree construction resulted from the deletion of either the C-terminal or N-terminal region. The 84 BrNRT1s were divided into six distinct subfamilies (Group 1–Group 6). Interestingly, subfamily Group 2 (21) has the highest number of NRT genes among these subfamilies, while subfamily Group 1 (3) has the lowest number of NRT genes. All members of the subfamily contained whole structural domains (Figure 1).

2.3. Gene Structure and Conserved Motif Analyses of BrNRT1s

Determining the gene structure and conducting a conserved motif analysis was beneficial for our understanding of the NRT1 family. A gene structural analysis of BrNRT1s was conducted using the GSDS tool. BrNRT1 members with close relationships shared similar gene structures. The MEME program was used to predict and analyze the motif compositions of the 84 members BrNRT1 family. As shown in Figure 2, there were 12 distinct motifs found. Of the 84 BrNRT1 proteins, 53.6% contained twelve conserved motifs, while the remaining proteins were absent in one or more motifs. Furthermore, it was found that BrNRT1 members with close relationships also shared similar motif compositions and orders. For instance, motif 10 was absent in five BrNRT1 genes belonging to the V subfamily. Figure 2 shows that none of the seven BrNRT1 genes in the Group 2 subfamily contained motif 9.

2.4. Regulatory Mechanism in the Promoter Regions of BrNRT1 Genes

Eleven cis-acting regulatory elements (CREs) from the promoters of the 84 BrNRT1 genes were discovered using PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 15 July 2023), as previously described by Hu et al. [34] (Figure 2). The study of CREs can provide valuable insights into the probable functionalities of BrNRT1 genes. The study revealed that each BrNRT1 gene contained one or more CREs in their promoter region. Additionally, many closely related genes exhibited comparable forms of CREs. As shown in Figure 2, the CREs discovered in the promoter region of BrNRT1 are known to be involved in protein transport. Members of the Major Facilitator Superfamily (MFS) can be found in all BrNRT1 genes (Figure 2).
Furthermore, it is notable that BraA09g012480.3C exhibited the presence of a GAG-pre-integrase domain (gag_pre-integrs (pfam13976)), suggesting the presence of mobile genetic elements. Another relevant gene is BraA07g034710.3C, an SPFH superfamily (SPFH_like_u4 (cd03407)). In BraA07g034710.3C, a potential association of genes with lipid rafts was found. Specifically, the gene BraA03g019780.3C was identified in this context. The BraA03g019780.3C protein possessed the PTZ00169 superfamily (cl36523), an ADP/ATP transporter located on the adenylate translocase (Figure 2).

2.5. Expression Patterns of BrNRT1s in Different Tissues

To further characterize the role of BrNRT1s in Chinese cabbage, we investigated the expression levels of BrNRT1s in two tissues (young leaves and tender roots) and at two nitrogen levels (0.2 mM and 6.0 mM). We analyzed the expression patterns of BrNRT1 genes in two Chinese cabbages (L14 and L40). Fifty-two (62%) of the eighty-four BrNRT1 genes were found in the tissues of both L14 and L40 (Table S1). We found 52 (62%) and 55 (65%) BrNRT1s in the tissues of both the LN and CK treatment cabbages, respectively. Meanwhile, 46 (55%) BrNRT1s were found in the root, whereas 54 (64%) were found in the leaves (Table S1).
The BrNRT1 genes exhibited distinct patterns of expression in several subfamilies. In the Group 6 subfamily, the expression levels of most BrNRT1 genes increased significantly in various tissues (FPKM > 1). Most genes belonging to the Group 4 and Group 5 subfamilies exhibited reduced expression levels (FPKM < 1). Interestingly, several BrNRT1 genes showed tissue-specific expression patterns. For instance, most BrNRT1 genes were more highly expressed in the root tissue than in the leaf tissue. The different expression patterns in each tissue demonstrated various functions of BrNRT1s in the whole plant (Table S1).

2.6. The Expression of BrNRT1s in Response to LN Stress

Nitrate is a major substrate for NRT1-protein-mediated transport. In the roots of L14 and L40, the presence of N in the nutrient solution altered the expression of specific nitrogen utilization genes. This is crucial for N uptake, translocation, and assimilation. It was found that some of BrNRT1s’ expression levels differed significantly under different nitrate concentrations (Table S1).
We identified differentially expressed genes (DEGs) between two Chinese cabbages (L14 and L40) and different nitrate concentrations. In L14, 23 DEGs related to BrNRT1 were identified in response to LN. Seven DEGs were up-regulated and three DEGs were down-regulated in LN14L (L14-LN leaves) vs. CK14L (L14-CK leaves). Moreover, 20 DEGs were found in LN14R (L14-LN root) vs. CK14R (L14-CK root) of which 14 DEGs were up-regulated and the other six DEGs were down-regulated. In LN40L (L40-LN leaves) vs. CK40L (L40-CK leaves), 37 DEGs related to BrNRT1 were identified in response to LN levels. Among these DEGs, nine DEGs were up-regulated, while eleven DEGs were down-regulated. In addition, there were 13 up-regulated and 13 down-regulated DEGs in LN40R (L40-LN root) vs. CK40R (L40-CK root) (Table S1 and Figure 3).

2.7. The Involvement of BrNRT1 DEGs in Response to LN Stress

The presence of N in the absorption, translocation, and assimilation of N crucially influences the expression of some BrNRT1 genes in L14 and L40. As shown in Table 1, some of these gene expression levels differed significantly between the shoot and the root.
Several genes, such as NRT1.1 (BraA08g031180.3C), NPF2.10 (BraA01g024830.3C), NPF4.1 (BraA03g041550.3C), NPF4.3 (BraA09g017570.3C), NPF6.4 (BraA01g032090.3C), and NPF8.1 (BraA09g045140.3C), were expressed in the root and the shoot; however, the expression levels differed significantly in L40. Interestingly, NRT1.1 (BraA09g060970.3C), NRT1.11 (BraA06g002150.3C), NPF2.10 (BraA06g019030.3C), and NPF8.3 (BraA09g059270.3C) differentially only in the root of L40. Contrastingly, NRT1.7 (BraA02g019460.3C), NRT1.9 (BraA09g056980.3C), NPF4.1 (BraA03g041540.3C), and NPF4.4 (BraA09g031580.3C) were highly expressed only in the leaves of L40. Similarly, NRT1.5 (BraA05g023200.3C) and NRT1.8 (BraA03g049670.3C) were highly expressed specifically in the leaf tissues of the L14 cabbage. Furthermore, NPF3.1 (BraA02g018550.3C) was highly expressed in the root tissues of L14 and L40 (Table 1).
NRT1.8 (BraA01g012370.3C), NRT1.1 (BraA06g009470.3C), and NPF4.5 (BraA07g013380.3C) were highly expressed in both cultivars under LN stress. Notably, L14 and L40 had comparable regulatory pathways for these genes. Furthermore, the expression of NPF2.11 (BraA09g007360.3C) showed a similar pattern in both cultivars except in the shoot of the L14 cultivar. The NPF6.4 (BraA01g025490.3C) gene was only detected in the roots of L14 plants treated with a LN concentration. In addition, NRT1.9 (BraA09g056980.3C) was only detected in the shoots of L40 plants under LN stress. These findings demonstrate that BrNRT1s have different expression patterns in specific tissues and cultivars (Table 1).

2.8. The Expression Profiles of BrNRT1s in the N Metabolism Pathway under LN Stress Conditions

Nitrate is the primary substrate for NRT1 protein transport. In this study, we examined the expression profiles of 24 BrNRT1 genes in response to varying nitrate concentrations. A total of 24 BrNRT1 genes were selected from the six subfamilies to elucidate the expression patterns of the genes across various subfamilies (Figure 4).
The results of a multiple-factor analysis indicate that the presence of BrNRT1 were significantly different under different nitrogen treatments: genotypes, tissue, genotype*treatment, genotype*tissue, treatment*tissue, and genotype*treatment*tissue (p < 0.01) (Table S2). As we presented in Table S2, the relative average values of all BrNRT1 genes are significantly different under two nitrogen treatments, indicating that low nitrogen affected the reduction of BrNRT1s. Interestingly, the average values of BraA08g031180.3C, BraA06g009470.3C, and BraA09g060970.3C are the highest among the BrNRT1s (Table S2), implying that the low-nitrogen treatment had the greatest impact on these three genes. A total of 20 BrNRT1 genes in tissue were significantly affected by nitrogen supply levels (p < 0.05) under two nitrogen treatments, while 16 BrNRT1 genes were significantly affected by nitrogen supply levels (p < 0.01) compared to other treatments (Table S2). A total of nine, ten, and seven genes were significantly affected by nitrogen supply levels in genotype*treatment, genotype*tissues, and treatment*tissues, respectively (p < 0.01). Furthermore, a total of eight genes were significantly affected by nitrogen supply levels (p < 0.01) in genotype*treatment*tissues.
The expression profiles of 24 representative BrNRT1 genes under LN stress and a control are shown in Figure 4. The results showed that the levels of expression of 18 BrNRT1s’ transcripts were highly induced after LN stress. Fourteen BrNRT1s were up-regulated by twofold or more in the shoot of L14 and an additional fourteen BrNRT1s were up-regulated in the root of L14. In addition, a total of ten BrNRT1s were up-regulated in the shoot of L40, while four BrNRT1s were up-regulated by twofold or more in the shoot of L40. Significant differences were found under LN stress conditions in which one BrNRT1 was detected in the shoot of L14, nine BrNRT1s were detected in the root of L14, eight BrNRT1s were detected in the shoot of L40, and four BrNRT1s were detected in the shoot of L40 (Figure 4 and Table S2).
In addition, many BrNRT1s showed tissue- and variety-specificity expression patterns, consistent with the RNA-seq analysis results. The results revealed that a total of seven BrNRT1s were predominantly expressed in shoots, whereas ten BrNRT1s were primarily expressed in roots. Several genes, such as BraA06g002150.3C, BraA04g005820.3C, and BraA09g045140.3C, might be considered. BraA06g002150.3C was highly expressed in the shoot, implying its potential role in physiological activities such as photosynthesis and protein synthesis. Meanwhile, BraA04g005820.3C and BraA09g045140.3C were highly expressed in the root, suggesting that BraA04g005820.3C and BraA09g045140.3C might be involved in the long-distance transportation of nitrate from the root to any location in the whole plant (Figure 4 and Table S2).
The number of DEGs in the shoot increased dramatically in the L40 (eight BrNRT1s) compared with L14 (one BrNRT1). In contrast, the number of DEGs in the root of L40 (four BrNRT1s) was lower than the number of DEGs in L14 (seven BrNRT1s). Notably, the BraA06g009470.3C genes were the most highly expressed in the L40 shoot. These findings illustrated that the BraA06g009470.3C gene transcript levels significantly increased in the shoot of L40 under LN stress conditions. However, BraA06g009470.3C’s response to LN stress in L14 was slightly low. Contrastingly, the level of BraA10g026590.3C’s transcript expression was elevated in response to LN stress in the L14 root but displayed a slightly elevated response in the L40 root (Figure 4 and Table S2).

3. Discussion

The NRT1 gene is widely distributed in eukaryotes and has been confirmed to be involved in the transport of nitrate/nitrite [14], dipeptide/tripeptide [35], and various hormones [36,37,38]. In recent years, extensive research has been conducted on the NRT1 gene in Arabidopsis, rice, and other plant species. However, studies about the NRT1 gene in Chinese cabbage are still limited. However, the production of Chinese cabbage is important as it is one of China’s primary vegetables. This cultivation plays a crucial role in providing a stability domestic vegetable supply and promoting sustainable agricultural development across the country [31]. This study identified a total of 84 BrNRT1 genes within the genome of Chinese cabbage. These genes were subsequently categorized into six subgroups based on the similarity of their structures. Our findings showed that Chinese cabbage has a different number of NRT1 subgroups compared to other species, including Spirodela polyrhiza, Poncirus trifoliata, and Setaria sp. under abiotic stress, illustrating the distinct response of NRT1 members in coping with stress cues [39,40].
The changes in gene structure might be caused by gene mutation and structural variants. Structural variants might influence the evolution of gene families. Based on this investigation of the BrNRT1 gene’s structure and conserved motifs results, the gene’s structure is highly conserved. In the same subfamily, closely related genes show similar gene structures and motif deletions. Similar studies were also reported in Arabidopsis, Populus trichocarpa, soybean [41], and Brassica napus [42]. We assumed that the diversity of gene functions in the genes of the Chinese cabbage family might be related to gene structure alterations and conserved motifs.
The structure and function of BrNRT1 genes were consistent; in particular, the expression of closely related BrNRT1 genes in the same subfamily showed similar patterns. However, the expression of some BrNRT1 genes showed specificity for different tissues. Numerous genes are frequently expressed in certain tissues and have tissue-specific functions [43]. For example, NRT1.7 (BraA02g019460.3C), NRT1.9 (BraA09g056980.3C), NPF4.1 (BraA03g041540.3C), and NPF4.4 (BraA09g031580.3C) were predominantly expressed in the leaf. NRT1.1 (BraA09g060970.3C), NRT1.11 (BraA06g002150.3C), NPF2.10 (BraA06g019030.3C), and NPF8.3 (BraA09g059270.3C) were predominantly expressed in the root. The expression patterns of NRT1 genes in Chinese cabbage varied between L14 and L40. For instance, NRT1.1 (BraA08g031180.3C), NPF2.10 (BraA01g024830.3C), NPF4.1 (BraA03g041550.3C), NPF4.3 (BraA09g017570.3C), NPF6.4 (BraA01g032090.3C), and NPF8.1 (BraA09g045140.3C) were only highly expressed in L40. Meanwhile, NRT1.5 (BraA05g023200.3C), NRT1.8 (BraA03g049670.3C), NPF3.1(BraA07g030700.3C), and NPF6.4 (BraA05g025490.3C) were highly expressed in L14. Our findings are in accordance with previous studies in B. rapa, Poncirus trifoliata, and Spirodela polyrhiza [39,44,45]. Hence, we assumed these genes could provide valuable allelic variations for the enhancement of nutrient use efficiency (NUE) in Chinese cabbage.
The functions of NRT1.1 are complex and include acting as a nitrate protein transporter, root development regulator, auxin activity transporter, nitrate signal transmitter, nutrient signal inducer, and plant microecological interaction regulator [22]. In this study, we found that three BrNRT1.1 (BraA06g009470.3C, BraA08g031180.3C, and BraA09g060970.3C) transcript levels were up-regulated under LN conditions, illustrating that BrNRT1.1 has similar effect on nitrate transport. Similarly, a previous study also stated that NRT1.1 acts as a nitrate transport protein in numerous plant species under abiotic stresses [1].
Generally, plants require the ability to acclimate to challenging conditions, synchronize their growth processes, and regulate functionally related genes. The NRT1.8 genes (BraA01g012370.3C and BraA03g049670.3C), homologs of AtNPF7.2/AtNRT1.8, were significantly up-regulated under LN conditions in L14. Similarly, the NRT1.5 gene (BraA05g023200.3C), a homolog of AtNPF7.3/AtNRT1.5, was down-regulated considerably under LN conditions in L14. Contrastingly, two members of the NPF7 family (AtNPF7.3/AtNRT1.5 and AtNPF7.2/AtNRT1.8) showed opposite functions under cadmium stress compared to other stress conditions, including LN stress [46]. These findings illustrate that NRT1s, which function in nitrate transporters, have different functions in response to specific stresses. Our findings are in accordance with previous studies which stated that NRT1 is important in the absorption and transportation of N for coping with various stresses in plants [47,48].
According to previous reports, five NPF proteins, namely NPF2.10 (GTR1), NPF2.11 (GTR2), NPF2.9 (NRT1.9), NPF2.14, and NPF2.13 (NRT1.7), have dual functions in terms of facilitating the transport of nitrate–nitrogen at low-affinity levels and the transport of erucic acid. The multiple functions of NPF proteins play crucial roles in improving nutrition uptake and plant defense mechanisms [24,34,49]. NPF homologous genes in Chinese cabbage were preferentially expressed in L40.
In addition, NRT1 also has the capability to transport hormone substrates. Our findings showed that NPF proteins (AtNPF4.1 (AIT3) and AtNPF4.5 (AIT2)) are involved in ABA and GA transport activities [50]. In Arabidopsis, a total of nine and eighteen NRT1 members actively regulate ABA and GA transport, respectively [36]. Numerous studies have shown that the expression patterns of these genes are usually closely related to their CREs [47]. This study discovered various cis-elements involved in protein transport in the BrNRT1 promoter, such as the MFS family (84/84 genes), which is involved in extensive substrate movement in biofilms. This finding indicates that BrNRT1 plays a vital role as a protein transporter in Chinese cabbage [48,51]. The transcript levels of NPF4.1 (BraA03g041540.3C) and NPF4.5 (BraA07g013380.3C) were significantly down-regulated under LN conditions. Moreover, previous study revealed that nitrate interacts with phytohormones like auxins, cytokinins, ABA, GA, and ethylene. According to [39], it was shown that hormone production, de-conjugation, transport, and signaling are partially regulated by nitrate signaling.
Considering the fact that N is an important nutrient for plants, NPFs (NRT1/PTR Family6) also facilitate the transportation of dipeptides, amino acids, and nitrate, which are the primary forms of nitrogen utilized by plants for their nutritional needs [52]. The dipeptide transport activity of two previously identified dipeptide transporters (AtNPF8.1 and AtNPF8.3) was confirmed in Arabidopsis [53]. The homologous genes, namely NPF8.1 (BraA09g045140.3C) and NPF8.3 (BraA09g059270.3C), were significantly down-regulated under LN conditions and preferentially expressed in L40, demonstrating that these genes contribute to providing nutrition in Chinese cabbage. In addition, our findings demonstrated that treatments, genotypes, and tissues are significantly affected the DEGs in Chinese cabbage (p < 0 01). The highest number of DEGs was identified in tissue, indicating NRT1 is susceptible to different nitrogen treatments in different tissues of Chinese cabbage. Also, several NRT1 genes are subject to dual or triple regulation simultaneously. We assumed that the BrNRT1 gene’s mechanism is complex in response to LN conditions in Chinese cabbage. In this study, the expression of several BrNRT1 genes changed significantly, demonstrating the involvement of these genes in the uptake of nitrate and other substances.

4. Conclusions

In this study, a total of 84 BrNRT1 genes were identified at the genomic level, and their gene structures, conserved motifs, cis-acting elements, and expression patterns were analyzed. The gene structure and motif of the BrNRT1 protein in each subfamily are highly conserved, indicating that these genes might be involved in regulating similar functions in response to LN stress. Furthermore, our findings show that the expression pattern of the NRT1 genes in Chinese cabbage is tissue-specific and variety-specific. An RT-qPCR analysis showed that most selected BrNRT1 genes were induced by nitrate and involved in N uptake and transport. These findings provide basic information for future research and a promising strategy for Chinese cabbage breeding programs to improve N uptake efficiency and yield productivity.

5. Materials and Methods

1.
Plant Material and Treatment
Two inbred lines of Chinese cabbage named L14 (LN-sensitive) and L40 (LN-tolerant) were analyzed in the present study. These two cultivars were screened out according to their agronomic trait yields under a normal N supply (N: 270 kg/ha) and LN (N: 54 kg/ha) conditions. The seedlings were obtained from the Shandong Academy of Agricultural Sciences, China, and selected for this study. The seedlings were cultured in a full nitrogen hydroponic solution for 2 weeks. Then, we transferred the seedlings to a low-nitrogen (0.2 mM, LN ) nutrient solution for 1 week as a N-starvation treatment. Full nitrogen was used as the control (6 mM, CK) [54]. The shoots and roots were harvested, rapidly frozen in liquid nitrogen, and then stored at −80 °C. The specific formulation of the medium is shown in Table 2.
2.
RNA Isolation:
The total RNA was isolated using Trizol (Invitrogen, Carlsbad, CA, USA). We used a 1% agarose gel and a 2100 Bioanalyzer RNA Nanochip (Agilent, Santa Clara, CA, USA) to measure the quality of the total RNA. Then, we used a NanoDrop ND-2000 Spectrophotometer (Nano-Drop, Wilmington, DE, USA) to measure the concentration of the total RNA.
3.
cDNA Library Construction, Sequencing, and Data Processing:
Equal quantities of total RNA from three replicates were mixed according to the manufacturer’s protocol (Illumina Inc., San Diego, CA, USA). DNA library construction, sequencing, and data processing and the construction of cDNA libraries occurred at Novogene (Tianjin, China). First, the Agilent 2100 Bioanalyzer (Agilent Technologies Inc., Santa Clara, CA, USA) and ABI StepOnePlus Real-Time PCR System (Applied Biosystems, Inc., Foster City, CA, USA) were used to qualify and quantify the sample library. Then, an IlluminaHiSeq™ 2000 (Illumina Inc., San Diego, CA, USA) was used to perform high-throughput sequencing. Finally, the original image data were generated by the sequencer and were transferred into raw sequence data via base calling. High-quality, clean data were obtained from the raw sequence data after removing empty reads, adapters, and low-quality reads. The clean reads were mapped to the Brassica rapa L. ssp. pekinensis reference genome (http://brassicadb.cn, accessed on 15 July 2023), using SOAPaligner/soap2 [55], with ≤2 mismatches being allowed in the sequence alignment to obtain unambiguous, clean tags.
4.
The Identification of Chinese cabbage NRT1 Genes:
We used the TARI website (http://www.arabidopsis.org/, accessed on 15 July 2023) to obtain 77 NRT1 sequences of A. thaliana. The Brassica database (BRAD) website (http://www.brassicadb.cn/#/, accessed on 15 July 2023) was used to download Chinese cabbage genome sequences. The putative NRT1s of Chinese cabbage were obtained via screening Chinese cabbage genome sequences via a BlastP search, using AtNRTs as queries. In this study, we encountered statistical models known as hidden models. We identified members of the gene family using the online sequence analysis tool named HMMER (http://hmmer.org/download.html, accessed on 15 July 2023). HMMER implementation uses probabilistic models known as profile-hidden Markov models (profile HMMs) to search sequences of homologs in the databases and then align the sequences [56]. The putative members of the NRT1 gene family obtained from the two approaches were merged to generate a unique gene list. To confirm the presence of the NRT1 domain, we used the protein sequences of putative NRT1 gene family members of Chinese cabbage in the Pfam (http://pfam.xfam.org/, accessed on 15 July 2023) and SMART (http://smart.embl-heidelberg.de/, accessed on 15 July 2023) databases for analysis.
5.
The Physicochemical Properties of the Proteins:
The molecular masses of the putative NRT1 proteins were calculated using the Compute pI/Mw tool of ExPaSy (http://web.expasy.org/compute_pi/, accessed on 15 July 2023). The number of amino acids, the molecular weight (MW), and the theoretical isoelectric point (pI) were computed using the ProtParam tool (https://web.expasy.org/protparam/, accessed on 15 July 2023) based on the general feature format (GFF) file of the NRT1 genes in Brassica rapa L. ssp. pekinensis.
6.
The Construction of a Phylogenetic Tree:
Annotation of the Chinese cabbage genome was downloaded from the Brassica database (BRAD, http://www.brassicadb.cn/#/, accessed on 15 July 2023), including the complete Brassica A genome sequence from B. rapa (Chiifu-401). The NRT1 nucleotide sequences were aligned using SnapGene 5.0.5 Software (from GSL Biotech; available at snapgene.com). Schematic gene structure diagrams were drawn using the exon/intron organization of the NRT1 genes and determined using the Gene Structure Display Server (http://gsds.cbi.pku.edu.cn/, accessed on 15 July 2023) and a GFF file, as described by Guo et al. [57]. The motifs of the NRT1 protein sequences were analyzed using MEME online tools (http://meme-suite.org/tools/meme, accessed on 15 July 2023). For the phylogenetic analysis, protein sequences of NRT1 from Chinese cabbage, Arabidopsis, and rice were aligned with MUSCLE multiple sequence alignment tools from SnapGene5.0.5 Software (from GSL Biotech; available at snapgene.com), using thedefault settings. The phylogenetic tree was constructed using the Neighbour-Joining (NJ) method and a bootstrap test was conducted using MEGA 7.0 Software with the following parameter settings: pairwise deletion mode, Poisson correction, and bootstrapping (1000 replicates).
7.
Gene Structure and Conserved Motif Analyses:
We used the BRAD database (http://brassicadb.org/brad/, accessed on 15 July 2023) to analyze the gene structure of Chinese cabbage. TBtools software was used to display the distribution patterns of the exons and introns of NRT1 gene and motif results [58]. An online prediction of the conserved motif of the NRT1 gene encoding protein was conducted with the maximum number of motif discoveries set to 20 and the other parameters set to default values.
8.
Analysis of cis-acting Elements:
First, we extracted a 2000 bp promoter region sequence upstream of each BrNRT1 member’s starting codon ATG using TBtools software. Then, the PlantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 15 July 2023) was used to perform a cis-acting element analysis. Finally, we used TBtools software to visualize a distribution map of cis-acting elements in the BrNRT1 members’ promoter regions.
9.
Analysis of BrNRT1 Genes’ Expression Profiles in Response to LN Stress:
The gene expression levels of all of BrNRT1 genes were normalized according to the RPKM (reads per kb per million reads) method [59]. Differentially expressed BrNRT1 genes (DEGs) between the LN-treated groups (L14–LN and L40–LN) and control groups (L14–CK and L40–CK) were screened based on an algorithm developed by Audic and Claverie [60]. We used the threshold “FDR ≤ 0.001 and the absolute value of log2 Ratio ≥ 1” to judge the significance of the BrNRT1 gene expression difference. A Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis was performed to investigate the high-level functions and utilities of the biological system. The cluster Profiler R package was used to test the statistical enrichment of DEGs in KEGG pathways.
10.
Reverse Transcription and RT-qPCR Detection:
A TOYOBO ReverTra Ace qPCR RT Kit (FSQ-101, TOYOBO, Osaka, Japan) was used to synthesize the first-strand cDNA. We performed a real-time quantitative PCR (RT-qPCR) analysis using a 2 × M5 HiPer SYBR Premix EsTaq plus (with Tli RNaseH) (MF787, Mei5bio, Beijing, China) and an IQ5 Real-Time PCR System (BIO-RAD, Hercules, CA, USA). The PCR reactions were performed at 95 °C for 30 s, followed by 40 reaction cycles (95 °C for 5 s, followed by 60 °C for 20 s). For each gene, three independent PCR reactions were carried out. Then, the relative gene expression was calculated using the 2−∆∆CT method [61]. The gene-specific primers were designed using Primer Premier 5.0, as shown in Table 3.

6. Data Processing and Analysis

Microsoft Excel (Version 2016, Microsoft Corporation, Washington, DC, USA) and SPSS (Version 13.0., SPSS Inc., Chicago, FL, USA) statistical software were used for the statistical analysis and to generate the diagrams, as described by Anwar et al., 2020 [62]. A univariate analysis was used to test for significant differences in the relative gene expression levels of the BrNRT1s according to the results of a qPCR among the genotypes, tissues, treatments, and their interactions. All data are expressed as means ± standard deviations (SDs).

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants12223882/s1.

Author Contributions

Y.Z. and F.N.R. performed the experiment, Y.Z. and F.N.R. wrote the first draft of the manuscript. S.Z. performed the real-time RT-PCR. Y.Z., J.L. and J.G. designed the experiments. All the authors contributed to the data analysis. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Modern Agricultural Industrial Technology System Funding of Shandong Province, China (SDAIT-05); the National Natural Science Foundation, China (32172591); the Taishan Scholars Program of Shandong Province, China (tsqn201909167); the China Agriculture Research System (CARS-23-G13); the Agricultural Science and Technology Innovation Project of SAAS (CXGC2023A18); the Projects of 20 Rules for New Universities in Jinan, China (202228058); and the Shandong Province Technology-based Small and Medium-sized Enterprise Innovation Capacity Improvement Project (2023TSGC0719).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Fang, X.Z.; Fang, S.Q.; Ye, Z.Q.; Liu, D.; Zhao, K.L.; Jin, C.W. NRT1.1 Dual-Affinity Nitrate Transport/Signalling and its Roles in Plant Abiotic Stress Resistance. Front. Plant Sci. 2021, 12, 715694. [Google Scholar] [CrossRef] [PubMed]
  2. Zhang, T.; Liu, M.; Huang, X.; Hu, W.; Qiao, N.; Song, H.; Zhang, B.; Zhang, R.; Yang, Z.; Liu, Y.; et al. Direct Effects of Nitrogen Addition on Seed Germination of Eight Semi-arid Grassland Species. Ecol. Evol. 2020, 20, 8793–8800. [Google Scholar] [CrossRef] [PubMed]
  3. Sanagi, M.; Aoyama, S.; Kubo, A.; Lu, Y.; Sato, T. Low Nitrogen Conditions Accelerate Flowering by Modulating the Phosphorylation State of FLOWERING BHLH 4 in Arabidopsis. Proc. Natl. Acad. Sci. USA 2021, 118, e2022942118. [Google Scholar] [CrossRef] [PubMed]
  4. Alboresi, A.; Gestin, C.; Leydecker, M.T.; Bedu, M.; Meyer, C.; Truong, H.N. Nitrate, a Signal Relieving Seed Dormancy in Arabidopsis. Plant Cell Environ. 2005, 28, 500–512. [Google Scholar] [CrossRef]
  5. Wang, Y.Y.; Hsu, P.K.; Tsay, Y.F. Uptake, Allocation and Signaling of Nitrate. Trends Plant Sci. 2012, 17, 458–467. [Google Scholar] [CrossRef]
  6. Wang, Y.Y.; Cheng, Y.H.; Chen, K.E.; Tsay, Y.F. Nitrate transport, signaling, and use efficiency. Annu. Rev. Plant Biol. 2018, 69, 85–122. [Google Scholar] [CrossRef]
  7. Tsay, Y.F.; Chiu, C.C.; Tsai, C.B.; Ho, C.H.; Hsu, P.K. Nitrate transporters and peptide transporters. FEBS Lett. 2007, 581, 2290–2300. [Google Scholar] [CrossRef]
  8. De Angeli, A.; Thomine, S.; Frachisse, J.M.; Ephritikhine, G.; Gambale, F.; Barbier-Brygoo, H. Anion channels and transporters in plant cell membranes. FEBS Lett. 2007, 581, 2367–2374. [Google Scholar] [CrossRef]
  9. Von der Fecht-Bartenbach, J.; Bogner, M.; Dynowski, M.; Ludewig, U. CLC-b-mediated NO3−/H+ exchange across the tonoplast of Arabidopsis vacuoles. Plant Cell Physiol. 2010, 51, 960–968. [Google Scholar] [CrossRef]
  10. Steiner, H.Y.; Naider, F.; Becker, J.M. The PTR family: A new group of peptide transporters. Mol. Microbiol. 1995, 16, 825–834. [Google Scholar] [CrossRef]
  11. Liu, K.H.; Tsay, Y.F. Switching between the two action modes of the dual-affifinity nitrate transporter CHL1 by phosphorylation. EMBO J. 2003, 22, 1005–1013. [Google Scholar] [CrossRef] [PubMed]
  12. Morere-Le Paven, M.C.; Viau, L.; Hamon, A.; Vandecasteele, C.; Pellizzaro, A.; Bourdin, C.; Laffont, C.; Lapied, B.; Lepetit, M.; Frugier, F.; et al. Characterization of a dual-affifinity nitrate transporter MtNRT1.3 in the model legume Medicago truncatula. J. Exp. Bot. 2011, 62, 5595–5605. [Google Scholar] [CrossRef] [PubMed]
  13. Bagchi, R.; Salehin, M.; Adeyemo, O.S.; Salazar, C.; Shulaev, V.; Sherrier, D.J.; Dickstein, R. Functional assessment of the Medicago truncatula NIP/LATD protein demonstrates that it is a high-affifinity nitrate transporter. Plant Physiol. 2012, 160, 906–916. [Google Scholar] [CrossRef] [PubMed]
  14. Tsay, Y.F.; Schroeder, J.I.; Feldmann, K.A.; Crawford, N.M. The herbicide sensitivity gene CHL1 of Arabidopsis encodes a nitrate-inducible nitrate transporter. Cell 1993, 72, 705–713. [Google Scholar] [CrossRef] [PubMed]
  15. Xia, X.D.; Fan, X.R.; Wei, J.; Feng, H.M.; Qu, H.Y.; Xie, D.; Miller, A.J.; Xu, G.H. Rice nitrate transporter OsNPF2.4 functions in low-affifinity acquisition and long-distance transport. J. Exp. Bot. 2015, 66, 317–331. [Google Scholar] [CrossRef] [PubMed]
  16. Jorgensen, M.E.; Xu, D.; Crocoll, C.; Ramirez, D.; Motawia, M.S.; Olsen, C.E.; Nour-Eldin, H.H.; Halkier, B.A. Origin and evolution of transporter substrate specifificity within the NPF family. eLife 2017, 6, e19466. [Google Scholar] [CrossRef]
  17. Li, H.; Hu, B.; Chu, C.C. Nitrogen use efficiency in crops: Lessons from Arabidopsis and rice. J. Exp. Bot. 2017, 68, 2477–2488. [Google Scholar] [CrossRef]
  18. Zhang, R.J.; Qu, C.L.; He, Y.T.; Yang, Z.R.; Wang, X.C. Identification and gene expression analysis of the nitrate transporter NRT1 gene family in foxtail millet. J. Shanxi Agric. Univ. (Nat. Sci. Ed.) 2018, 38, 37–43. [Google Scholar]
  19. Guo, Z.Q.; Liang, Y.X.; Feng, F.; Zhu, L.X.; Fan, J.L.; Jiang, X.D.; Lv, J.H.; Zhang, C.L. Genome-wide Identification of NRT1 Gene, Expression Profiling and DNA Variation Analysis in Sorghum. Acta Laser Biol. Sin. 2021, 30, 459–467. [Google Scholar]
  20. Corratge-Faillie, C.; Lacombe, B. Substrate (un)specifificity of Arabidopsis NRT1/PTR FAMILY (NPF) proteins. J. Exp. Bot. 2017, 68, 3107–3113. [Google Scholar] [CrossRef]
  21. Wang, H.D.; Wan, Y.F.; Buchner, P.; King, R.; Ma, H.X.; Hawkesford, M.J. Phylogeny and gene expression of the complete Nitrate Transporter 1/Peptide Transporter Family in Triticum aestivum. J. Exp. Bot. 2020, 71, 4531–4546. [Google Scholar] [CrossRef] [PubMed]
  22. Wang, W.; Hu, B.; Li, A.; Chu, C.C. NRT1.1s in plants: Functions beyond nitrate transport. J. Exp. Bot. 2019, 15, 4373–4379. [Google Scholar] [CrossRef] [PubMed]
  23. Li, G.J.; Zhu, L.; Wang, Y.N.; Cao, J.S. Cloning and functional analysis of GmNRT1.2a and GmNRT1.2b in soybean. Acta Agron. Sin. 2020, 46, 1025–1032. [Google Scholar] [CrossRef]
  24. Wang, Y.Y.; Tsayl, Y.F. Arabidopsis nitrate transporter NRT1.9 is important in phloem nitrate transport. Plant Cell 2011, 23, 1945–1957. [Google Scholar] [CrossRef] [PubMed]
  25. Fan, S.C.; Lin, C.S.; Hsu, P.K.; Lin, S.H.; Tsay, Y.F. The Arabidopsis nitrate transporter NRT1.7, expressed in phloem, is responsible for source-to-sink remobilization of nitrate. Plant Cell 2009, 21, 2750–2761. [Google Scholar] [CrossRef] [PubMed]
  26. Li, J.Y.; Fu, Y.L.; Pike, S.M. The Arabidopsis nitrate transporter NRT1.8 functions in nitrate removal from the xylem sap and mediates cadmium tolerance. Plant Cell 2010, 22, 1633–1646. [Google Scholar] [CrossRef]
  27. Lin, S.H.; Kuo, H.F.; Canivenc, G.; Lin, C.S.; Lepetit, M.; Hsu, P.K.; Tillard, P.; Lin, H.L.; Wang, Y.Y.; Tsai, C.B.; et al. Mutation of the Arabidopsis NRT1.5 nitrate transporter causes defective root-to-shoot nitrate transport. Plant Cell 2008, 20, 2514–2528. [Google Scholar] [CrossRef]
  28. Hsu, P.K.; Tsay, Y.F. Two phloem nitrate transporters, NRT1.11 and NRT1.12, are important for redistributing xylem-borne nitrate to enhance plant growth. Plant Physiol. 2013, 163, 844–856. [Google Scholar] [CrossRef]
  29. Almagro, A.; Lin, S.H.; Tsay, Y.F. Characterization of the Arabidopsis nitrate transporter NRT1.6 reveals a role of nitrate in early embryo development. Plant Cell 2008, 20, 3289–3299. [Google Scholar] [CrossRef]
  30. Léran, S.; Varala, K.; Boyer, J.C.; Chiurazzi, M.; Crawford, N.; Daniel-Vedele, F.; David, L.; Dickstein, R.; Fernandez, E.; Forde, B.; et al. A unified nomenclature of Nitrate Transporter 1/Peptide Transporter family members in plants. Trends Plant Sci. 2014, 19, 5–9. [Google Scholar] [CrossRef]
  31. Chunyan, D.; Minglei, N.; Yan, Y.; Xiaoyan, C.; Lü, L.; Nan, L. Research on the Construction and Application of a Big Data Platform for the Whole Vegetable Industry Chain: The Case of Chinese Cabbage. J. Agric. Big Data 2021, 1, 66–72. [Google Scholar]
  32. Staugaitis, G.; Viškelis, P. Amounts of nitrogen, phosphorus, potassium, calcium and magnesium in the heads and plant residues of Chinese cabbage crop fertilised with different rates of nitrogen. Sodinink. Ir. Darzinink. 2005, 24, 98–106. [Google Scholar]
  33. Yuanqiong, L.; Junxia, L. Preliminary Report on the Total Amount Control Experiment of Nitrogen, Phosphorus, and Potassium Fertilizers in Chinese CabbageProduction. Shanghai Agric. Sci. Technol. 2019, 5, 2. [Google Scholar]
  34. Hu, X.C.; Yu, X.; Shi, H.; Ruan, Y.; Liu, C.L. Construction and Gene Editing Analysis of CRISPR/Cas9 Knockout Vector of BnaGTR Gene in Brassica napus. Mol. Plant Breed. 2022, 20, 6732–6741. [Google Scholar]
  35. Hammes, U.Z.; Meier, S.; Dietrich, D.; Ward, J.M.; Rentsch, D. Functional properties of the Arabidopsis peptide transporters AtPTR1 and AtPTR5. J. Biol. Chem. 2010, 285, 39710–39717. [Google Scholar] [CrossRef] [PubMed]
  36. Chiba, Y.; Shimizu, T.; Miyakawa, S.; Kanno, Y.; Koshiba, T.; Kamiya, Y.; Seo, M. Identifification of Arabidopsis thaliana NRT1/PTR FAMILY (NPF) proteins capable of transporting plant hormones. J. Plant Res. 2015, 128, 679–686. [Google Scholar] [CrossRef]
  37. Krouk, G.; Crawford, N.M.; Coruzzi, G.M.; Tsay, Y.F. Nitrate signaling: Adaptation to flfluctuating environments. Curr. Opin. Plant Biol. 2010, 13, 266–273. [Google Scholar] [CrossRef]
  38. Bouguyon, E.; Brun, F.; Meynard, D.; Kubeš, M.; Pervent, M.; Leran, S.; Lacombe, B.; Krouk, G.; Guiderdoni, E.; Zažímalová, E.; et al. Multiple mechanisms of nitrate sensing by Arabidopsis nitrate transceptor NRT1.1. Nat. Plants 2015, 1, 15015. [Google Scholar] [CrossRef]
  39. Zhao, Z.; Li, M.; Xu, W.; Liu, J.H.; Li, C. Genome-Wide Identification of NRT Gene Family and Expression Analysis of Nitrate Transporters in Response to Salt Stress in Poncirus trifoliata. Genes 2022, 13, 1115. [Google Scholar] [CrossRef]
  40. Cheng, J.; Tan, H.; Shan, M.; Duan, M.; Ye, L.; Yang, Y.; He, L.; Shen, H.; Yang, Z.; Wang, X. Genome-wide identification and characterization of the NPF genes provide new insight into low nitrogen tolerance in Setaria. Front. Plant Sci. 2022, 13, 1043832. [Google Scholar] [CrossRef]
  41. You, H.G.; Liu, Y.M.; Minh, T.N.; Lu, H.R.; Zhang, P.M.; Li, W.F.; Xiao, J.L.; Ding, X.D.; Li, Q. Genome-wide identifification and expression analyses of nitrate transporter family genes in wild soybean (Glycine soja). J. Appl. Genet. 2020, 61, 489.9–501.9. [Google Scholar] [CrossRef] [PubMed]
  42. Chao, H.B.; He, J.J.; Cai, Q.Q.; Zhao, W.G.; Fu, H.; Hua, Y.P.; Li, M.T.; Huang, J.Y. The expression characteristics of NPF genes and their response to vernalization and nitrogen defificiency in rapeseed. Int. J. Mol. Sci. 2021, 22, 4944. [Google Scholar] [CrossRef]
  43. Le, D.T.; Nishiyama, R.; Watanabe, Y.; Mochida, K.; Yamaguchi-Shinozaki, K.; Shinozaki, K.; Tran, L.S. Genome-wide survey and expression analysis of the plant-specifific NAC transcription factor family in soybean during development and dehydration stress. DNA Res. 2011, 18, 263–276. [Google Scholar] [CrossRef] [PubMed]
  44. Lv, M.; Dong, T.; Wang, J.; Zuo, K. Genome-wide identification of nitrate transporter genes from Spirodela polyrhiza and characterization of SpNRT1.1 function in plant development. Front. Plant Sci. 2022, 13, 945470. [Google Scholar] [CrossRef]
  45. Han, D.; Tan, J.; Yue, Z.; Tao, P.; Lei, J.; Zang, Y.; Hu, Q.; Wang, H.; Zhang, S.; Li, B.; et al. Genome-Wide Identification and Expression Analysis of ESPs and NSPs Involved in Glucosinolate Hydrolysis and Insect Attack Defense in Chinese Cabbage (Brassica rapa subsp. pekinensis). Plants 2023, 12, 1123. [Google Scholar] [CrossRef] [PubMed]
  46. Liang, G.H.; Hua, Y.P.; Zhou, T. Bioinformatics analysis and response to nitrate-cadmium stress of NRT1.5 and NRT1.8 family genes in Brassica napus. Acta Agron. Sin. 2019, 45, 365. [Google Scholar] [CrossRef]
  47. Bilas, R.; Szafran, K.; Hnatuszko-Konka, K.; Kononowicz, A.K. Cis-regulatory elements used to control gene expression in plants. Plant Cell Tissue Organ Cult. 2016, 127, 269–287. [Google Scholar] [CrossRef]
  48. Dodd, I.C.; Tan, L.P.; He, J. Do increases in xylem sap pH and/or ABA concentration mediate stomatal closure following nitrate deprivation? J. Exp. Bot. 2003, 54, 1281–1288. [Google Scholar] [CrossRef]
  49. Wu, T.; Qin, Z.W.; Fan, L.X.; Xue, C.B.; Zhou, X.Y.; Xin, M.; Du, Y.L. Involvement of CsNRT1.7 in nitrate recycling during senescence in cucumber. J. Plant Nutr. Soil Sci. 2014, 177, 714–721. [Google Scholar] [CrossRef]
  50. Wang, Y.; Wei, K.; Ruan, L.; Bai, P.; Wu, L.; Wang, L.; Cheng, H. Systematic Investigation and Expression Profifiles of the Nitrate Transporter 1/Peptide Transporter Family (NPF) in Tea Plant (Camellia sinensis). Int. J. Mol. Sci. 2022, 23, 6663. [Google Scholar] [CrossRef]
  51. Banedjschafifie, S.; Bastani, S.; Widmoser, P.; Mengel, K. Improvement of water use and N fertilizer efficiency by subsoil irrigation of winter wheat. Eur. J. Agron. 2008, 28, 1–7. [Google Scholar] [CrossRef]
  52. Léran, S.; Garg, B.; Boursiac, Y.; Corratgé-Faillie, C.; Brachet, C.; Tillard, P.; Gojon, A.; Lacombe, B. AtNPF5.5, a nitrate transporter affecting nitrogen accumulation in Arabidopsis embryo. Sci. Rep. 2015, 5, 7962. [Google Scholar] [CrossRef] [PubMed]
  53. Qiu, D.Y.; Hu, R.; Li, J.; Li, Y.; Ding, J.R.; Xia, K.F.; Zhong, X.H.; Fang, Z.M.; Zhang, M.Y. Peptide Transporter OsNPF8.1 Contributes to Sustainable Growth under Salt and Drought Stresses, and Grain Yield under Nitrogen Deficiency in Rice. Rice Sci. 2023, 30, 113–126. [Google Scholar]
  54. Chen, R.Y.; Yang, Y.B.; Qin, L.; Zhang, H.W.; Liu, B.; Wang, H.L.; Chen, G.L.; Yu, S.T.; Guan, Y.A. Evaluation of Nitrogen Efficient Cultivars of Foxtail Millet and Analysis of the Related Characters at Seedling Stage. Sci. Agric. Sin. 2016, 49, 3286–3296. [Google Scholar]
  55. Li, R.Q.; Yu, C.; Li, Y.R.; Lam, T.W.; Yiu, S.M.; Kristiansen, K.; Wang, J. SOAP2: An improved ultrafast tool for short read alignment. Bioinformatics 2009, 25, 1966–1967. [Google Scholar] [CrossRef]
  56. Makhoul, J.; Schwartz, R. What is a hidden Markov model? IEEE Spectr. 1997, 34, 44–45. [Google Scholar]
  57. Guo, A.Y.; Zhu, Q.H.; Chen, X.; Luo, J.C. GSDS: A gene structure display server. Hereditas 2007, 29, 1023–1026. [Google Scholar] [CrossRef]
  58. Chen, C.J.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.H.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
  59. Mortazavi, A.; Williams, B.A.; Mccue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef]
  60. Audic, S.; Claverie, J.M. The significance of digital gene expression profiles. Genome Res. 1997, 7, 986. [Google Scholar] [CrossRef]
  61. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  62. Anwar, S.; Almatroudi, A.; Allemailem, K.S.; Joseph, R.J.; Khan, A.A.; Rahmani, A.H. Protective effects of ginger extract against glycation and oxidative stress-induced health complications: Anin vitrostudy. Processes 2020, 8, 468. [Google Scholar] [CrossRef]
Plants 12 03882 g001
Figure 1. The unrooted phylogenetic tree of NRT proteins in Chinese cabbage.
Figure 1. The unrooted phylogenetic tree of NRT proteins in Chinese cabbage.
Plants 12 03882 g001
Plants 12 03882 g002
Figure 2. Gene structure and conserved protein motif organization of NRT1 genes in Chinese cabbage.
Figure 2. Gene structure and conserved protein motif organization of NRT1 genes in Chinese cabbage.
Plants 12 03882 g002
Plants 12 03882 g003
Figure 3. Expression heatmap of BrNRT1 genes in Chinese cabbage.
Figure 3. Expression heatmap of BrNRT1 genes in Chinese cabbage.
Plants 12 03882 g003
Plants 12 03882 g004
Figure 4. qRT-PCR validation of DEGs from high-throughput sequencing analyses. Relative expression levels were calculated as a reference gene using the formula 2−∆∆CT. The values indicated are the means of three biological replicates ± SEs.
Figure 4. qRT-PCR validation of DEGs from high-throughput sequencing analyses. Relative expression levels were calculated as a reference gene using the formula 2−∆∆CT. The values indicated are the means of three biological replicates ± SEs.
Plants 12 03882 g004
Table 1. DEGs identified related to LN stress conditions.
Table 1. DEGs identified related to LN stress conditions.
Gene IDChr.StartEndlog2 (LN/CK)
ShootRoot
L14L40L14L40
NRT1.1BraA06g009470.3CA065,167,0895,168,3241.73ns1.421.94
NRT1.1BraA08g031180.3CA0820,956,82920,960,518ns1.55ns1.13
NRT1.1BraA09g060970.3CA0942,614,33642,618,089nsnsns1.31
NRT1.5BraA05g023200.3CA0517,088,57517,091,980−2.86nsnsns
NRT1.7BraA02g019460.3CA0211,150,40411,157,116ns−2.42nsns
NRT1.8BraA01g012370.3CA016,414,1446,416,1712.29−1.281.19−1.5
NRT1.8BraA03g049670.3CA0325,372,93525,374,9412.61nsnsns
NRT1.9BraA09g056980.3CA0940,666,91840,669,296ns1.8nsns
NRT1.11BraA06g002150.3CA061,283,0121,287,130nsnsns−1.81
NPF2.10BraA01g024830.3CA0114,570,61114,572,963ns1.27ns−3.49
NPF2.10BraA06g019030.3CA0610,801,26810,803,925nsnsns−1.1
NPF2.11BraA09g007360.3CA094,260,3204,262,091ns1.911.752.04
NPF3.1BraA02g018550.3CA0210,436,20110,443,396nsns−1.561.7
NPF3.1BraA07g030700.3CA0722,416,61022,420,494nsns1.69ns
NPF4.1BraA03g041540.3CA0320,827,73720,829,854ns−2.4nsns
NPF4.1BraA03g041550.3CA0320,839,54920,842,211ns1.8ns2.81
NPF4.3BraA09g017570.3CA0910,925,11210,930,083ns−1.02ns1.46
NPF4.4BraA09g031580.3CA0924,492,20924,495,098ns−3.07nsns
NPF4.5BraA07g013380.3CA0712,534,29212,537,206−1.01ns−3.75−1.43
NPF6.4BraA01g025490.3CA0115,182,95915,184,900ns4.67−1.92ns
NPF6.4BraA01g032090.3CA0121,885,38021,889,127ns1.31ns−1.49
NPF6.4BraA05g025490.3CA0519,200,39719,202,444nsns1.28ns
NPF8.1BraA09g045140.3CA0934,557,78334,560,452ns−1.21ns−1.86
NPF8.3BraA09g059270.3CA0941,823,59841,826,639nsnsns−1.85
Note: “ns” represents that there was no significant difference in the gene expression levels between the shoot and the root.
Table 2. The hydroponic nutrient solution content for each treatment.
Table 2. The hydroponic nutrient solution content for each treatment.
Nutrient Solution FormulaTreatment
CK (6.0 mM)Low N (0.2 mM)
MEKNO33 mM0.1 mM
KCl0.0 mM3 mM
KH2PO41.5 mM1.5 mM
K2HPO41.5 mM1.5 mM
(NH4)SO40.75 mM25 mM
MgCl21 mM1 mM
K2SO42 mM2 mM
Ca(NO3)20.75 mM0.75 mM
CaCl23.25 mM3.25 mM
FeNa2Fe-EDTA40 µM40 µM
TEH3BO360 µM60 µM
MnSO414 µM14 µM
ZnSO41 µM1 µM
CuSO40.6 µM0.6 µM
NiCl20.4 µM0.4 µM
H2MoO40.3 µM0.3 µM
CoCl220 nM20 nM
Note: ME: macroelement; Fe: ferrum; TE: trace element.
Table 3. Sequences of primers used in the study.
Table 3. Sequences of primers used in the study.
GenesForward PrimerReverse Primer
Bra-ActionATACCAGGCTTGAGCATACCGGCCAAAGAGGCCATCAGACAA
BraA01g012370.3CGAAGGTGGAGAGTGGATCAACAAGAGTGAAGCCATCTGAGTG
BraA01g024830.3CTGGCATCGCTCGTGTTATAGCTGGTCCGAGTATTTGAGTGTAG
BraA01g025490.3CGTCATAGTCGGAATTGGAGAGGTGTAGAAGCATATCCCAATCACC
BraA02g004850.3CTCTGTCTTCGTCCCTATCACCGCGTAATGTCTCCTGTAGTTCTC
BraA02g018550.3CAGATATGTGAGAAACTGGCGGAGTTAGTGAGAGTGTTGGCTG
BraA03g019780.3CTTGGTTGTGGAAGTCTAGCTGTGAATGTCCCAAAGAGTCCTG
BraA03g021460.3CAGTCACCTGAGGAAATGCAGTTATCCCCAATCCAACTCTTCC
BraA04g005820.3CCTGAAATCTATGGAGTCGCCGTGGCAACATCCGTGAGAATAG
BraA05g001710.3CACGTTTAGCTCCTTTTCGGGTGCC ATAACCTAAACCCCAC
BraA05g025490.3CTCTGGGAGTGTTGCTGTTGATGGTGAAGTCTCCTGAAGTC
BraA06g002150.3CTGTACTTATCGCGTTCACTGGCTTGCTCACATTGCGTCTAAC
BraA06g026380.3CTCGGTGTTGGAGGTATAAAAGGCGACCGTGACCGCTATTAAG
BraA07g013380.3CTTCTCACAATCCAAGCCCGACAGTCCCACAAATAGAAGCG
BraA07g030700.3CAACACTCTCACTAACTTCGCCTCGTAAGCAATGTCATCCCG
BraA09g017570.3CTCATCTTCCTCGTCCCTCTCCAGTCCAAATCCTATCCGAGTC
BraA09g021560.3CTGGCACTGAGAGGTATAGACTCAAGAACGAATCAGCCATACCC
BraA09g021570.3CAACTTTAGCATCCCGCtAGCTCCCATTCGTTGAAGCAAAG
BraA09g044870.3CGTCATGGCTACTTCGCTTTTGATCATTGGGACGAGGAAGATG
BraA09g045140.3CACCAGTTCATTGTCCCCTTCCGAGACCTATTCCCATACGTTG
BraA10g026590.3CTCCCAAGTCCATGTCAAGCGTGTCCCTCGTTTATATCCTCTG
BraA06g019030.3CCTGTCATCGCTTGTTTTCTGGCGCTAAACCCAACATCAGAAAC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, Y.; Ritonga, F.N.; Zhang, S.; Wang, F.; Li, J.; Gao, J. Genome-Wide Identification of the NRT1 Family Members and Their Expression under Low-Nitrate Conditions in Chinese Cabbage (Brassica rapa L. ssp. pekinensis). Plants 2023, 12, 3882. https://doi.org/10.3390/plants12223882

AMA Style

Zhang Y, Ritonga FN, Zhang S, Wang F, Li J, Gao J. Genome-Wide Identification of the NRT1 Family Members and Their Expression under Low-Nitrate Conditions in Chinese Cabbage (Brassica rapa L. ssp. pekinensis). Plants. 2023; 12(22):3882. https://doi.org/10.3390/plants12223882

Chicago/Turabian Style

Zhang, Yihui, Faujiah Nurhasanah Ritonga, Shu Zhang, Fengde Wang, Jingjuan Li, and Jianwei Gao. 2023. "Genome-Wide Identification of the NRT1 Family Members and Their Expression under Low-Nitrate Conditions in Chinese Cabbage (Brassica rapa L. ssp. pekinensis)" Plants 12, no. 22: 3882. https://doi.org/10.3390/plants12223882

APA Style

Zhang, Y., Ritonga, F. N., Zhang, S., Wang, F., Li, J., & Gao, J. (2023). Genome-Wide Identification of the NRT1 Family Members and Their Expression under Low-Nitrate Conditions in Chinese Cabbage (Brassica rapa L. ssp. pekinensis). Plants, 12(22), 3882. https://doi.org/10.3390/plants12223882

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop