Molecular Markers for Detecting Inflorescence Size of Brassica oleracea L. Crops and B. oleracea Complex Species (n = 9) Useful for Breeding of Broccoli (B. oleracea var. italica) and Cauliflower (B. oleracea var. botrytis)
Abstract
1. Introduction
2. Results
2.1. Bio-Morphometric Analysis
2.2. Identification of the Best Molecular Marker by the Association between Their Allelic Variants and the Bio-Morphometric Traits
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. DNA Extraction and PCR
4.3. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Jiang, G.L. Molecular Markers and Marker-Assisted Breeding in Plants. In Plant Breeding from Laboratories to Fields; Andersen, S.B., Ed.; InTech: London, UK, 2013; Volume 3, pp. 45–83. [Google Scholar]
- Collard, B.C.Y.; Mackill, D.J. Marker-assisted selection: An approach for precision plant breeding in the twenty-first century. Philos. Trans. R. Soc. B Biol. Sci. 2008, 363, 557–572. [Google Scholar] [CrossRef] [PubMed]
- Snogerup, S.; Gustafsson, M.; Von Bothmer, R. Brassica sect. Brassica (Brassicaceae) I. Taxonomy and Variation. Willdenowia 1990, 19, 271–365. [Google Scholar]
- Sadowski, J.; Kole, C. Genetics, Genomics and Breeding of Vegetable Brassicas; CRC Press: Boca Raton, FL, USA, 2011; p. 436. [Google Scholar]
- Maggioni, L.; Bothmer, R.; Poulsen, G.; Branca, F. Origin and Domestication of Cole Crops (Brassica oleracea L.): Linguistic and Literary Considerations 1. Econ. Bot. 2010, 64, 109–123. [Google Scholar] [CrossRef]
- Gray, J.; Pearson, T. Objective Selection of Sensitive Species Indicative of Pollution-Induced Change in Benthic Communities. I. Comparative Methodology. Mar. Ecol. Prog. Ser. 1982, 9, 111–119. [Google Scholar] [CrossRef]
- Bellostas, N.; Kachlicki, P.; Sørensen, J.C.; Sørensen, H. Glucosinolate profiling of seeds and sprouts of B. oleracea varieties used for food. Sci. Hortic. 2007, 114, 234–242. [Google Scholar] [CrossRef]
- Picchi, V.; Lo Scalzo, R.; Tava, A.; Doria, F.; Argento, S.; Toscano, S.; Treccarichi, S.; Branca, F. Phytochemical Characterization and In Vitro Antioxidant Properties of Four Brassica Wild Species from Italy. Molecules 2020, 25, 3495. [Google Scholar] [CrossRef]
- Ben Ammar, H.; Picchi, V.; Arena, D.; Treccarichi, S.; Bianchi, G.; Lo Scalzo, R.; Marghali, S.; Branca, F. Variation of Bio-Morphometric Traits and Antioxidant Compounds of Brassica oleracea L. Accessions in Relation to Drought Stress. Agronomy 2022, 12, 2016. [Google Scholar] [CrossRef]
- Lannér, C. Genetic Relationships within the Brassica oleracea Cytodeme: Comparison of Molecular Marker Systems; Swedish University of Agricultural Sciences: Uppsala, Sweden, 1997. [Google Scholar]
- Geraci, A.; Divaret, I.; Raimondo, F.M.; Chevre, A.M. Genetic relationships between Sicilian wild populations of Brassica analysed with RAPD markers. Plant Breed. 2001, 120, 193–196. [Google Scholar] [CrossRef]
- Choi, S.R.; Teakle, G.R.; Plaha, P.; Kim, J.H.; Allende, C.J.; Beynon, E.; Piao, Z.Y.; Soengas, P.; Han, T.H.; King, G.J.; et al. The reference genetic linkage map for the multinational Brassica rapa genome sequencing project. Theor. Appl. Genet. 2007, 115, 777–792. [Google Scholar] [CrossRef]
- Maggioni, L.; Jørgensen, R.B.; Von Bothmer, R.; Poulsen, G.; Branca, F. Signs of Inter-crossing between Leafy Kale Landraces and Brassica rupestris in South Italy. Acta Hortic. 2013, 1005, 165–172. [Google Scholar] [CrossRef]
- Allender, C.J.; Allainguillaume, J.; Lynn, J.; King, G.J. Simple sequence repeats reveal uneven distribution of genetic diversity in chloroplast genomes of Brassica oleracea L. and (n = 9) wild relatives. Theor. Appl. Genet. 2007, 114, 609–618. [Google Scholar] [CrossRef] [PubMed]
- Maggioni, L. Domestication of Brassica oleraceae L.; Acta Universitatis Agriculturae Sueciae: Uppsala, Sweden, 2015. [Google Scholar]
- Maggioni, L.; von Bothmer, R.; Poulsen, G.; Lipman, E. Domestication, diversity and use of Brassica oleracea L., based on ancient Greek and Latin texts. Genet. Resour. Crop Evol. 2018, 65, 137–159. [Google Scholar] [CrossRef]
- Stansell, Z.; Hyma, K.; Fresnedo-Ramírez, J.; Sun, Q.; Mitchell, S.; Björkman, T.; Hua, J. Genotyping-by-sequencing of Brassica oleracea vegetables reveals unique phylogenetic patterns, population structure and domestication footprints. Hortic. Res. 2018, 5, 38. [Google Scholar] [CrossRef]
- Stansell, Z.; Björkman, T. From landrace to modern hybrid broccoli: The genomic and morphological domestication syndrome within a diverse B. oleracea collection. Hortic. Res. 2020, 7, 159. [Google Scholar] [CrossRef]
- Mabry, M.E.; Turner-Hissong, S.D.; Gallagher, E.Y.; McAlvay, A.C.; An, H.; Edger, P.P.; Moore, J.D.; Pink, D.A.C.; Teakle, G.R.; Stevens, C.J. The Evolutionary History of Wild, Domesticated, and Feral Brassica oleracea (Brassicaceae). Mol. Biol. Evol. 2021, 38, 4419–4434. [Google Scholar] [CrossRef] [PubMed]
- Treccarichi, S.; Di Gaetano, C.; Di Stefano, F.; Gasparini, M.; Branca, F. Using Simple Sequence Repeats in 9 Brassica Complex Species to Assess Hypertrophic Curd Induction. Agriculture 2021, 11, 622. [Google Scholar] [CrossRef]
- Louarn, S.; Torp, A.M.; Holme, I.B.; Andersen, S.B.; Jensen, B.D. Database derived microsatellite markers (SSRs) for cultivar differentiation in Brassica oleracea. Genet. Resour. Crop Evol. 2007, 54, 1717–1725. [Google Scholar] [CrossRef]
- Ofori, A.; Becker, H.C. Breeding of Brassica rapa for Biogas Production: Heterosis and Combining Ability of Biomass Yield. BioEnergy Res. 2008, 1, 98–104. [Google Scholar] [CrossRef]
- Moghaddam, M.J.; Pourdad, S.S. Genotype × environment interactions and simultaneous selection for high oil yield and stability in rainfed warm areas rapeseed (Brassica napus L.) from Iran. Euphytica 2011, 180, 321–335. [Google Scholar] [CrossRef]
- Leroy, X.J.; Leon, K.; Branchard, M. Characterisation of Brassica oleracea L. by microsatellite primers. Plant Syst. Evol. 2000, 225, 235–240. [Google Scholar] [CrossRef]
- Rounsley, S.D.; Ditta, G.S.; Yanofsky, M.F. Diverse roles for MADS box genes in Arabidopsis development. Plant Cell 1995, 7, 1259–1269. [Google Scholar] [PubMed]
- Bowman, J.L.; Smyth, D.R.; Meyerowitz, E.M. Genes directing flower development in Arabidopsis. Plant Cell 1989, 1, 37–52. [Google Scholar] [PubMed]
- Irish, V.F.; Sussex, I.M. Function of the apetala-1 gene during Arabidopsis floral development. Plant Cell. 1990, 2, 741–753. [Google Scholar] [PubMed]
- Duclos, D.V.; Björkman, T.N. Temperature Effects on Meristem Identity Genes Controlling the Reproductive Development of Cauliflower (Brassica oleracea var. botrytis) and Broccoli (Brassica oleracea var. italica). HortScience 2005, 40, 1015D. [Google Scholar] [CrossRef]
- Smith, L.B.; King, G.J. The distribution of BoCAL-a alleles in Brassica oleracea is consistent with a genetic model for curd development and domestication of the cauliflower. Mol. Breed. 2000, 6, 603–613. [Google Scholar] [CrossRef]
- Tonguç, M.; Griffiths, P.D. Genetic relationships of Brassica vegetables determined using database derived simple sequence repeats. Euphytica 2004, 137, 193–201. [Google Scholar] [CrossRef]
- Burgess, B.; Mountford, H.; Hopkins, C.J.; Love, C.; Ling, A.E.; Spangenberg, G.C.; Edwards, D.; Batley, J. Identification and characterization of simple sequence repeat (SSR) markers derived in silico from Brassica oleracea genome shotgun sequences: PRIMER NOTE. Mol. Ecol. Notes 2006, 6, 1191–1194. [Google Scholar] [CrossRef]
- Branca, F.; Chiarenza, G.L.; Cavallaro, C.; Gu, H.; Zhao, Z.; Tribulato, A. Diversity of Sicilian broccoli (Brassica oleracea var. italica) and cauliflower (Brassica oleracea var. botrytis) landraces and their distinctive bio-morphological, antioxidant, and genetic traits. Genet. Resour. Crop Evol. 2018, 65, 485–502. [Google Scholar] [CrossRef]
- Sheng, X.G.; Zhao, Z.Q.; Wang, J.S.; Yu, H.F.; Shen, Y.S.; Zeng, X.Y.; Gu, H.H. Genome wide analysis of MADS-box gene family in Brassica oleracea reveals conservation and variation in flower development. BMC Plant Biol. 2019, 19, 106. [Google Scholar] [CrossRef]
- Branca, F.; Maggioni, L. Exploiting Sicilian Brassica oleracea L. complex species for the innovation of the agricultural systems and products: A review analysis. Acta Hortic. 2020, 1267, 187–196. [Google Scholar] [CrossRef]
- Gaebelein, R.; Schiessl, S.V.; Samans, B.; Batley, J.; Mason, A.S. Inherited allelic variants and novel karyotype changes influence fertility and genome stability in Brassica allohexaploids. New Phytol. 2019, 223, 965–978. [Google Scholar] [CrossRef] [PubMed]
- Timpanaro, G.; Di Vita, G.; Foti, V.T.; Branca, F. Landraces in Sicilian peri-urban horticulture: A participatory approach to Brassica production system. Acta Hortic. 2013, 1005, 213–220. [Google Scholar] [CrossRef]
- Gomes, M.H.; Rosa, E. Free amino acid composition in primary and secondary inflorescences of 11 broccoli (Brassica oleracea var italica) cultivars and its variation between growing seasons. J. Sci. Food Agric. 2001, 81, 295–299. [Google Scholar] [CrossRef]
- Branca, F.; Argento, S.; Tribulato, A. Assessing genetic reserves in Sicily (Italy): The Brassica wild relatives case study. In Agrobiodiversity Conservation: Securing the Diversity of Crop Wild Relatives and Landraces, 1st ed.; Maxted, N., Ehsan Dulloo, M., Ford-Lloyd, B.V., Frese, L., Iriondo, J.M., Pinheiro de Carvalho, M.A.A., Eds.; CABI: Wallingford, UK, 2012; pp. 52–58. [Google Scholar]
- Branca, F.; Ragusa, L.; Tribulato, A.; Bagatta, M.; Lo Scalzo, R.; Picchi, V. Evaluation of Sicilian wild Brassica species (n = 9) for glucosinolate profile and antioxidant compounds. Acta Hortic. 2013, 1005, 181–188. [Google Scholar] [CrossRef]
- Branca, F.; Ragusa, L.; Tribulato, A.; Di Gaetano, C.; Calì, F. Genetic relationships of Brassica vegetables and wild relatives in Southern Italy determined by five SSR. Acta Hortic. 2013, 1005, 189–196. [Google Scholar] [CrossRef]



| Accession | IW | IH | ID2 | ID1 | IS | IA |
|---|---|---|---|---|---|---|
| CVF1.1 | 1095.8 (21.1) * | 11.1 (8.4) | 42.3 (8.5) | 18.0 (8.7) | 0.6 (9.6) | 110.0 (21.9) |
| CV1 | 965.7 (37.4) | 15.4 (14.6) | 39.8 (16.4) | 20.7 (17.4) | 0.7 (16.6) | 105.0 (19.4) |
| CV4 | 666.6 (42.5) | 15.2 (13.2) | 34.1 (19.6) | 21.1 (15.0) | 0.7 (12.1) | 112.0 (20.4) |
| CI1 | 628.8 (33.7) | 16.8 (16.6) | 38.1 (18.5) | 19.7 (14.6) | 0.9 (14.6) | 101.0 (22.5) |
| CVF1.2 | 605.0 (33.8) | 8.9 (16.7) | 31.0(10.3) | 16.9 (11.8) | 0.5 (12.1) | 113.0 (13.3) |
| CV5 | 567.3 (38.2) | 14.5 (15.6) | 37.0 (19.8) | 19.5 (13.1) | 0.7 (17.29) | 113.0 (13.5) |
| CV6 | 564.9 (37.0) | 14.5 (20.7) | 34.6 (12.6) | 20 (15.1) | 0.7 (18.7) | 104.0 (16.7) |
| CV7 | 554.5 (56.7) | 18.8 (20.4) | 30.8 (26.9) | 19.5 (19.3) | 0.9 (29.8) | 107.0 (17.7) |
| CVF1.3 | 541.5 (54.7) | 13.7 (24.4) | 32.3 (21.9) | 18.9 (29.6) | 0.7 (18.3) | 112.0 (22.3) |
| CV8 | 503.9 (35.4) | 16.8 (28.4) | 32.4 (18.1) | 16.5 (17.9) | 1.0 (34.4) | 100.0 (27.4) |
| CVF1.4 | 467.1 (41.1) | 7.5 (20.9) | 30.0 (13.3) | 14.6 (15.7) | 0.5 (11.1) | 101.0 (15.6) |
| CVF1.5 | 461.8 (47.1) | 10.8 (16.1) | 33.0 (13.9) | 17.5 (16.4) | 0.6 (17.4) | 110.0 (19.3) |
| CV9 | 453.5 (49.7) | 11 (17.2) | 35.6 (17.9) | 18.1 (27.3) | 0.6 (22.5) | 117.0 (15.8) |
| CV10 | 443 (55.9) | 12.7 (23.0) | 36.4 (24.2) | 16.7 (23.8) | 0.8 (32.4) | 91.0 (26.5) |
| CVF1.6 | 438.8 (84.4) | 17.6 (24.4) | 28.8 (28.1) | 16.8 (29.4) | 1.1 (34.2) | 93.0 (17.7) |
| CI2 | 378.3 (46.2) | 10.2 (21.0) | 36.8 (16.9) | 17.2 (19.5) | 0.6 (17.8) | 113.0 (17.5) |
| BRF1.1 | 319.8 (40.9) | 14.1 (26.8) | 3.5 (19.5) | 12.3 (26.7) | 1.2 (44.4) | 76.0 (29.8) |
| CVF1.7 | 317.4 (42.0) | 17.2 (22.2) | 29.2 (28.1) | 14.8 (16.0) | 1.2 (33.1) | 98.0 (21.6) |
| CV11 | 305.7 (68.2) | 8.7 (20.7) | 31.7 (18.1) | 15.4 (22.8) | 0.6 (19.7) | 92.0 (25.2) |
| BR1 | 279 (39.0) | 16.6 (18.1) | 3.8 (17.3) | 11.1 (23.7) | 1.5 (28.2) | 57.0 (21.5) |
| BR2 | 266.9 (33.4) | 22.2 (30.9) | 3.2 (13.2) | 8.5 (32.7) | 2.7 (37.4) | 58.0 (19.4) |
| CV2 | 263.6 (56.1) | 11.2 (28.3) | 34.2 (18.8) | 14.4 (22.0) | 0.8 (21.2) | 91.0 (23.4) |
| BR3 | 226.4 (39.6) | 18.2 (12.9) | 3.1 (26.8) | 7.9 (29.4) | 2.3 (30.5) | 49.0 (27.8) |
| BR4 | 217.7 (58.3) | 18.2 (18.2) | 2.9 (29.8) | 9.5 (31.6) | 1.9 (29.4) | 54.0 (26.3) |
| BRF1.2 | 212.8 (36.3) | 12.8 (12.2) | 3.1 (15.0) | 7. 8 (23.1) | 1.9 (16.5) | 46.0 (24.1) |
| BR5 | 188.3 (51.8) | 16.6 (23.4) | 2.9 (24.3) | 7.7 (28.3) | 2.2 (24.2) | 46.0 (24.1) |
| CV3 | 186.6 (41.3) | 8.4 (17.5) | 28.6 (16.7) | 13.6 (15.1) | 0.6 (18.2) | 85.0 (24.8) |
| BR6 | 164.0 (49.0) | 16.5 (17.9) | 3.3 (32.4) | 8.3 (29.5) | 2.0 (52.3) | 46.0 (32.8) |
| BR7 | 143.9 (42.2) | 16.0(29.0) | 2.7 (22.7) | 7.8 (29.0) | 2.1 (22.6) | 48.0 (26.7) |
| BR8 | 109.5 (30.8) | 15.5 (9.5) | 2.6 (20.2) | 7.9 (25.8) | 2.0 (23.4) | 41.0 (34.2) |
| BR9 | 63.1 (41.7) | 16.9 (23.5) | 2.7 (18.9) | 4.7 (22.3) | 3.6 (15.5) | 27.0 (15.2) |
| BU1 | 33.3 (28.3) | 27.6 (15.5) | 16.2 (20.2) | 3.1 (17.9) | 0.2 (21.2) | 14.0 (11.7) |
| BU2 | 28.7 (1.6) | 19.5(1.5) | 19.3 (3.3) | 4.1 (0.2) | 0.21 (0.1) | 15.0 (0.9) |
| BY1 | 27.7 (3.7) | 20.4 (1.0) | 22.5 (4.5) | 3.3(0.7) | 0.1 (0.1) | 13.5 (2.1) |
| BM | 26.6 (5.9) | 16.7 (4.6) | 9.6 (2.5) | 2.7 (0.4) | 0.3 (0.1) | 11.3 (2.6) |
| BU3 | 22.4 (0.4) | 23.5 (4.0) | 19.6 (1.5) | 2.0 (0.3) | 0.1 (0.1) | 9.5 (0.7) |
| BU4 | 21.1 (0.8) | 19.2 (2.2) | 18.9(3.6) | 2.2(0.1) | 0.1 (0.1) | 13.5 (2.1) |
| BY2 | 20.6 (1.3) | 20.8 (0.6) | 18.5 (1.6) | 2.8 (0.4) | 0.2 (0.1) | 11.5 (0.7) |
| BV | 19.7 (0.6) | 14.8 (0.4) | 19.0 (1.2) | 2.4 (0.2) | 0.1 (0.1) | 10.5 (0.7) |
| Genotype | IW | IH | ID2 | ID1 | IS | IA |
|---|---|---|---|---|---|---|
| IW | 1 | |||||
| IH | 0.024 | 1 | ||||
| ID2 | 0.680 ** | −0.035 | 1 | |||
| ID1 | 0.880 ** | −0.066 | 0.724 ** | 1 | ||
| IS | −0.117 | −0.068 | −0.638 ** | −0.107 | 1 | |
| IA | 0.847 ** | −0.033 | 0.706 ** | 0.980 ** | −0.086 | 1 |
| Allelic Variant | IW | IH | ID2 | ID1 | IS | IA |
|---|---|---|---|---|---|---|
| P1_155 | 0.622 ** | −0.471 ** | 0.521 ** | 0.622 ** | 0.032 | 0.677 ** |
| P1_156 | −0.101 | 0.156 | 0.219 | −0.097 | 0.202 | −0.135 |
| P1_164 | −0.375 | 0.072 | −0.082 | −0.334 | −0.283 | −0.306 |
| P2_153 | −0.288 | 0.189 | 0.219 | 0.308 | 0.00 | −0.264 |
| P2_157 | −0.338 * | 0.405 ** | −0.088 | −0.372 * | −0.376 * | −0.372 * |
| P2_162 | −0.152 | −0.029 | −0.418 ** | −0.266 | 0.196 | −0.175 |
| P2_165 | −0.461 * | −0.220 | 0.583 ** | 0.594 ** | −0.014 | 0.538 ** |
| P2_168 | 0.160 | 0.021 | 0.226 | 0.205 | 0.050 | 0.204 |
| P3_180 | 0.010 | 0.033 | 0.069 | 0.046 | −0.003 | 0.095 |
| P3_184 | −0.455 ** | 0.440 ** | 0.123 | −0.455 ** | −0.477 ** | −0.433 * |
| P3_186 | −0.233 | 0.296 | −0.214 | −0.257 | 0.062 | −0.187 |
| P3_190 | 0.257 | −0.440 * | 0.268 | 0.303 | 0.192 | 0.226 |
| P3_192 | 0.418 * | −0.324 | 0.222 | 0.424 ** | 0.156 | 0.436 ** |
| P3_194 | 0.140 | −0.015 | −0.068 | 0.068 | 0.146 | 0.174 |
| P4_282 | −0.139 | 0.199 | −0.097 | −0.184 | −0.168 | −0.232 |
| P4_288 | 0.460 ** | −0.333 * | 0.308 | 0.522 ** | 0.172 | 0.568 ** |
| P4_291 | −0.462 ** | 0.381 * | −0.462 ** | −0.477 ** | 0.148 | 0.485 ** |
| P5_294 | −0.343 * | 0.410 ** | 0.078 | −0.376 * | −0.391 * | 0.384 * |
| P5_304 | 0.306 | 0.050 | 0.089 | 0.217 | 0.165 | 0.330 * |
| P5_308 | 0.384 * | −0.474 ** | 0.132 | 0.449 ** | 0.478 ** | 0.380 * |
| PC1 | PC2 | PC3 | |
|---|---|---|---|
| IW | 0.900 | 0.093 | −0.155 |
| IH | −0.564 | 0.108 | 0.132 |
| ID2 | 0.670 | 0.653 | −0.045 |
| ID1 | 0.938 | 0.135 | −0.049 |
| IS | 0.200 | −0.858 | 0.147 |
| IA | 0.919 | 0.131 | −0.213 |
| P1_155 | 0.671 | 0.197 | −0.112 |
| P2_153 | −0.350 | −0.035 | 0.067 |
| P2_157 | −0.482 | 0.422 | 0.074 |
| P2_162 | −0.183 | −0.396 | −0.411 |
| P2_165 | 0.579 | 0.283 | 0.462 |
| P2_168 | −0.269 | −0.041 | −0.041 |
| P3_184 | −0.570 | 0.503 | 0.089 |
| P3_186 | −0.353 | −0.196 | −0.144 |
| P3_190 | 0.323 | −0.085 | 0.693 |
| P3_192 | 0.509 | −0.150 | −0.287 |
| P4_288 | 0.673 | −0.066 | 0.098 |
| P4_291 | −0.643 | −0.162 | 0.031 |
| P5_294 | −0.503 | 0.523 | 0.027 |
| P5_304 | 0.226 | −0.046 | −0.765 |
| P5_308 | 0.526 | −0.361 | 0.571 |
| Variance (%) | 32.60 | 11.57 | 9.68 |
| PC1 | PC2 | |
|---|---|---|
| IW | 0.910 | −0.058 |
| IH | −0.554 | −0.119 |
| ID2 | 0.741 | −0.595 |
| ID1 | 0.952 | −0.060 |
| IS | 0.101 | 0.888 |
| IA | 0.941 | −0.100 |
| P1_155 | 0.752 | −0.078 |
| P2_165 | 0.631 | −0.031 |
| P3_192 | 0.506 | 0.258 |
| P4_288 | 0.644 | 0.156 |
| P5_308 | 0.524 | 0.641 |
| Variance (%) | 49.08 | 15.29 |
| Accession Code | Laboratory Code | Origin | Species |
|---|---|---|---|
| UNICT 583 | BR 46 | Vittoria | BR1 |
| UNICT 658 | BR 45 S1 | Acireale | BR2 |
| UNICT 658 | BR 129 | Roccella Valdemone | BR3 |
| UNICT 657 | BR 128 | Roccella Valdemone | BR4 |
| UNICT 655 | BR 126 | Adrano | BR5 |
| UNICT 637 | BR 106 | Cefalù | BR6 |
| UNICT 3675 | BR 94 S1 | Francavilla | BR7 |
| UNICT 3668 | BR 115 S1 | Troina | BR8 |
| UNICT 574 | BR 36 | Biancavilla | BR9 |
| UNICT 3578 | BR 165 Marathon | Esasem | BRF1.1 |
| UNICT 651 | BR 122 Packman | Petoseed | BRF1.2 |
| UNICT 4145 | BR 13 S3 AC | Modica | CI1 |
| UNICT 579 | BR 41 | Modica | CI2 |
| UNICT 3190 | BR 15 S 1 A | Modica | CV1 |
| UNICT 3669 | BR 17 S2 | Ragusa | CV2 |
| UNICT 3674 | CV 19 S2 A | Piazza Armerina | CV3 |
| UNICT 4137 | CV 99 S2 B | Adrano | CV4 |
| UNICT 4138 | CV 76 S2 | Acireale | CV5 |
| UNICT 3652 | CV 159 | Catania | CV6 |
| UNICT 3900 | BR 13 A X CV98/21 | Di3A | CV7 |
| UNICT 3895 | CV 98/2 X CV 136 EG | Di3A | CV8 |
| UNICT 3089 | CV 75 S3AC | Acireale | CV9 |
| UNICT 3906 | CV 24 S4 | Biancavilla | CV10 |
| UNICT 3671 | CV 72 S2 | Catania | CV11 |
| UNICT 3876 | CV 171 Menhir F1 | ISI sementi | CVF1.1 |
| UNICT 3878 | CV 173 Freedom | 3878 Royal Sluis | CVF1.2 |
| UNICT 3902 | CV 33 S1 | Royal Sluis | CVF1.3 |
| UNICT 3880 | CV 175 White Flash | Sakata | CVF1.4 |
| UNICT 3879 | CV 174 Graffiti | ISI sementi | CVF1.5 |
| UNICT 3892 | CV 98/2 X BR 13 S3 | DISPA 3 | CVF1.6 |
| UNICT 3893 | CV 136 EG X CV98/2 | DISPA 1 | CVF1.7 |
| UNICT 342 | Brassica macrocarpa 1 | Favignana | BM |
| UNICT 733 | Brassica rupestris 1 | San Vito Lo Capo | BU1 |
| UNICT 3270 | Brassica rupestris 2 | Bivongi | BU2 |
| UNICT 732 | Brassica rupestris 3 | Roccella Valdemone | BU3 |
| UNICT 736 | Brassica rupestris 4 | Ragusa Ibla | BU4 |
| UNICT 3040 | Brassica villosa 1 | Marianopoli | BV |
| UNICT 3512 | Brassica incana 1 | Agnone Bagni | BY1 |
| UNICT 4158 | Brassica incana 2 | Sortino | BY2 |
| Name | SSR Motif | Primer Sequence (Forward, Reverse) | C | Position (from–to); (bp) | Code |
|---|---|---|---|---|---|
| BoAP1 | (AT)9-1 | GGAGGAACGACCTTGATT GCCAAAATATACTATGCGTCT | C6 | 33,883,667–33,887,357 | P1 |
| BoTHL1 | (CTT)7 | GCCAAGGAGGAAATCGAAG AAGTGTCAATAAGGCAACAAGG | C9 | 17,254,558–17,255,176 | P2 |
| BoABI1 | (TC)16 | TATCAGGGTTTCCTGGGTTG GTGAACAAGAAGAAAAGAGAGCC | C1 | 1,229,915,511–12,992,170 | P3 |
| BoPLD1 | (CT)7(AT)7-1 | GACCACCGACTCCGATCTC AGACAAGCAAAATGCAAGGAA | C5 | 46037340–46,037,606 | P4 |
| PBCGSSRBo39 | [GGTCG]4 | AACGCATCCATCCTCACTTC TAAACCAGCTCGTTCGGTTC | C7 | 50595248–50595537 | P5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Treccarichi, S.; Ben Ammar, H.; Amari, M.; Cali, R.; Tribulato, A.; Branca, F. Molecular Markers for Detecting Inflorescence Size of Brassica oleracea L. Crops and B. oleracea Complex Species (n = 9) Useful for Breeding of Broccoli (B. oleracea var. italica) and Cauliflower (B. oleracea var. botrytis). Plants 2023, 12, 407. https://doi.org/10.3390/plants12020407
Treccarichi S, Ben Ammar H, Amari M, Cali R, Tribulato A, Branca F. Molecular Markers for Detecting Inflorescence Size of Brassica oleracea L. Crops and B. oleracea Complex Species (n = 9) Useful for Breeding of Broccoli (B. oleracea var. italica) and Cauliflower (B. oleracea var. botrytis). Plants. 2023; 12(2):407. https://doi.org/10.3390/plants12020407
Chicago/Turabian StyleTreccarichi, Simone, Hajer Ben Ammar, Marwen Amari, Riccardo Cali, Alessandro Tribulato, and Ferdinando Branca. 2023. "Molecular Markers for Detecting Inflorescence Size of Brassica oleracea L. Crops and B. oleracea Complex Species (n = 9) Useful for Breeding of Broccoli (B. oleracea var. italica) and Cauliflower (B. oleracea var. botrytis)" Plants 12, no. 2: 407. https://doi.org/10.3390/plants12020407
APA StyleTreccarichi, S., Ben Ammar, H., Amari, M., Cali, R., Tribulato, A., & Branca, F. (2023). Molecular Markers for Detecting Inflorescence Size of Brassica oleracea L. Crops and B. oleracea Complex Species (n = 9) Useful for Breeding of Broccoli (B. oleracea var. italica) and Cauliflower (B. oleracea var. botrytis). Plants, 12(2), 407. https://doi.org/10.3390/plants12020407

