Diversity and Spread of Acetolactate Synthase Allelic Variants at Position 574 Endowing Resistance in Amaranthus hybridus in Italy
Abstract
:1. Introduction
2. Results
2.1. Pattern of Resistance to ALS Inhibitors
2.2. Amaranthus Species Identification
2.3. Resistance Mechanism
2.3.1. DNA Extraction from Single Seeds
2.3.2. ALS Partial Amplification and Sequencing
2.3.3. Allele-Specific PCR Assay (PASA) Development and Application
2.4. Susceptibility to Pre-Emergence Herbicides
3. Discussion
4. Materials and Methods
4.1. Sampling and Plant Material
4.2. Pattern of Resistance to ALS Inhibitors
4.3. Amaranthus Species Identification
4.4. Resistance Mechanism
4.4.1. DNA Extraction from Single Seeds
4.4.2. ALS Partial Amplification and Sequencing
4.4.3. Allele-Specific PCR Assay (PASA) Development and Application
4.5. Susceptibility to Pre-Emergence Herbicides
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Oerke, E.-C. Crop Losses to Pests. J. Agric. Sci. 2006, 144, 31–43. [Google Scholar] [CrossRef]
- Riemens, M.; Sønderskov, M.; Moonen, A.-C.; Storkey, J.; Kudsk, P. An Integrated Weed Management Framework: A Pan-European Perspective. Eur. J. Agron. 2022, 133, 126443. [Google Scholar] [CrossRef]
- Heap, I. The International Herbicide-Resistant Weed Database. Available online: http://www.weedscience.org/ (accessed on 1 September 2022).
- Shergill, L.S.; Bish, M.D.; Jugulam, M.; Bradley, K.W. Molecular and Physiological Characterization of Six-Way Resistance in an Amaranthus Tuberculatus Var. Rudis Biotype from Missouri. Pest Manag. Sci. 2018, 74, 2688–2698. [Google Scholar] [CrossRef]
- Wychen, V. Survey of the Most Common and Troublesome Weeds in Broadleaf Crops, Fruits & Vegetables in the United States and Canada. Available online: http://wssa.net/wp-content/uploads/2016-Weed-Survey_Broadleaf-crops.xlsx (accessed on 10 September 2022).
- Yu, Q.; Powles, S.B. Resistance to AHAS Inhibitor Herbicides: Current Understanding. Pest Manag. Sci. 2014, 70, 1340–1350. [Google Scholar] [CrossRef]
- Hamouzová, K.; Košnarová, P.; Salava, J.; Soukup, J.; Hamouz, P. Mechanisms of Resistance to Acetolactate Synthase-Inhibiting Herbicides in Populations of Apera Spica-Venti from the Czech Republic. Pest Manag. Sci. 2014, 70, 541–548. [Google Scholar] [CrossRef]
- Milani, A.; Scarabel, L.; Sattin, M. A Family Affair: Resistance Mechanism and Alternative Control of Three Amaranthus Species Resistant to Acetolactate Synthase Inhibitors in Italy. Pest Manag. Sci. 2020, 76, 1205–1213. [Google Scholar] [CrossRef]
- Milani, A.; Lutz, U.; Galla, G.; Scarabel, L.; Weigel, D.; Sattin, M. Population Structure and Evolution of Resistance to Acetolactate Synthase (ALS)-Inhibitors in Amaranthus Tuberculatus in Italy. Pest Manag. Sci. 2021, 77, 2971–2980. [Google Scholar] [CrossRef] [PubMed]
- Torra, J.; Royo-Esnal, A.; Romano, Y.; Osuna, M.D.; León, R.G.; Recasens, J. Amaranthus Palmeri a New Invasive Weed in Spain with Herbicide Resistant Biotypes. Agronomy 2020, 10, 993. [Google Scholar] [CrossRef]
- Kanatas, P.; Tataridas, A.; Dellaportas, V.; Travlos, I. First Report of Amaranthus Palmeri S. Wats. in Cotton, Maize and Sorghum in Greece and Problems with Its Management. Agronomy 2021, 11, 1721. [Google Scholar] [CrossRef]
- Milani, A.; Panozzo, S.; Farinati, S.; Iamonico, D.; Sattin, M.; Loddo, D.; Scarabel, L. Recent Discovery of Amaranthus Palmeri S. Watson in Italy: Characterization of ALS-Resistant Populations and Sensitivity to Alternative Herbicides. Sustainability 2021, 13, 7003. [Google Scholar] [CrossRef]
- Scarabel, L.; Varotto, S.; Sattin, M. A European Biotype of Amaranthus Retroflexus Cross-Resistant to ALS Inhibitors and Response to Alternative Herbicides. Weed Res. 2007, 47, 527–533. [Google Scholar] [CrossRef]
- GIRE® Italian Herbicide Resistance Working Group. Available online: http://resistenzaerbicidi.it/ (accessed on 10 September 2022).
- Iamonico, D. Taxonomic Revision of the Genus Amaranthus (Amaranthaceae) in Italy. Phytotaxa 2015, 199, 001–084. [Google Scholar] [CrossRef] [Green Version]
- Schneider, A. GPS Visualizer: Do-It-Yourself Mapping. Available online: https://www.gpsvisualizer.com (accessed on 10 April 2022).
- Mascanzoni, E.; Perego, A.; Marchi, N.; Scarabel, L.; Panozzo, S.; Ferrero, A.; Acutis, M.; Sattin, M. Epidemiology and Agronomic Predictors of Herbicide Resistance in Rice at a Large Scale. Agron. Sustain. Dev. 2018, 38, 68. [Google Scholar] [CrossRef] [Green Version]
- Amaro-Blanco, I.; Romano, Y.; Palmerin, J.A.; Gordo, R.; Palma-Bautista, C.; De Prado, R.; Osuna, M.D. Different Mutations Providing Target Site Resistance to ALS- and ACCase-Inhibiting Herbicides in Echinochloa Spp. from Rice Fields. Agriculture 2021, 11, 382. [Google Scholar] [CrossRef]
- Loubet, I.; Caddoux, L.; Fontaine, S.; Michel, S.; Pernin, F.; Barrès, B.; Le Corre, V.; Délye, C. A High Diversity of Mechanisms Endows ALS-Inhibiting Herbicide Resistance in the Invasive Common Ragweed (Ambrosia artemisiifolia L.). Sci. Rep. 2021, 11, 19904. [Google Scholar] [CrossRef] [PubMed]
- Menchari, Y.; Délye, C.; Le Corre, V. Genetic Variation and Population Structure in Black-Grass (Alopecurus Myosuroides Huds.), a Successful, Herbicide-Resistant, Annual Grass Weed of Winter Cereal Fields. Mol. Ecol. 2007, 16, 3161–3172. [Google Scholar] [CrossRef] [PubMed]
- Kersten, S.; Chang, J.; Huber, C.D.; Voichek, Y.; Lanz, C.; Hagmaier, T.; Lang, P.; Lutz, U.; Hirschberg, I.; Lerchl, J.; et al. Standing Genetic Variation Fuels Rapid Evolution of Herbicide Resistance in Blackgrass. bioRxiv 2021. [Google Scholar] [CrossRef]
- Tranel, P.J.; Wright, T.R. Resistance of Weeds to ALS-Inhibiting Herbicides: What Have We Learned? Weed Sci. 2002, 50, 700–712. [Google Scholar] [CrossRef]
- Costea, M.; Tardif, F.J. The Biology of Canadian Weeds. 126. Amaranthus albus L., A. Blitoides S. Watson and A. blitum L. Can. J. Plant Sci. 2003, 83, 1039–1066. [Google Scholar] [CrossRef] [Green Version]
- Trucco, F.; Jeschke, M.R.; Rayburn, A.L.; Tranel, P.J. Amaranthus Hybridus Can Be Pollinated Frequently by A. Tuberculatus under Field Conditions. Heredity 2005, 94, 64–70. [Google Scholar] [CrossRef]
- McNaughton, K.E.; Letarte, J.; Lee, E.; Tardif, F.J. Mutations in ALS Confer Herbicide Resistance in Redroot Pigweed (Amaranthus Retroflexus) and Powell Amaranth (Amaranthus Powellii). Weed Sci. 2005, 53, 17–22. [Google Scholar] [CrossRef]
- Whaley, C.M.; Wilson, H.P.; Westwood, J.H. ALS Resistance in Several Smooth Pigweed (Amaranthus Hybridus) Biotypes. Weed Sci. 2006, 54, 828–832. [Google Scholar] [CrossRef]
- Guo, J.; Riggins, C.W.; Hausman, N.E.; Hager, A.G.; Riechers, D.E.; Davis, A.S.; Tranel, P.J. Nontarget-Site Resistance to ALS Inhibitors in Waterhemp (Amaranthus Tuberculatus). Weed Sci. 2015, 63, 399–407. [Google Scholar] [CrossRef] [Green Version]
- Pacanoski, Z.; Mehmeti, A. Efficacy and Selectivity of Pre-Em Herbicide on Dependence of Soil Types and Precipitation in Sunflower Crop. Agraarteadus 2021, 32, 100–110. [Google Scholar] [CrossRef]
- Raimondi, M.A.; Oliveira, R.S., Jr.; Constantin, J.; Biffe, D.F.; Arantes, J.G.Z.; Franchini, L.H.; Rios, F.A.; Blainski, E.; Osipe, J.B. Residual Activity of Herbicides Applied to the Soil in Relation to Control of Four Amaranthus Species. Planta Daninha 2010, 28, 1073–1085. [Google Scholar] [CrossRef] [Green Version]
- Food and Agriculture Organization (FAO) Crops and Livestock Products. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 10 September 2022).
- Italian National Institute of Statistics (ISTAT) Crop an Livestock Products. Available online: http://dati.istat.it/ (accessed on 10 September 2022).
- Hess, M.; Barralis, G.; Bleiholder, H.; Buhr, L.; Eggers, T.; Hack, H.; Stauss, R. Use of the Extended BBCH Scale - General for the Descriptions of the Growth Stages of Mono- and Dicotyledonous Weed Species. Weed Res. 1997, 37, 433–441. [Google Scholar] [CrossRef]
- Thomson, D.; Henry, R. Single-Step Protocol for Preparation of Plant Tissue for Analysis by PCR. Biotechniques 1995, 19, 394–400. [Google Scholar]
- Sommer, S.S.; Groszbach, A.R.; Bottema, C.D. PCR Amplification of Specific Alleles (PASA) Is a General Method for Rapidly Detecting Known Single-Base Changes. Biotechniques 1992, 12, 82–87. [Google Scholar]
- Délye, C.; Duhoux, A.; Pernin, F.; Riggins, C.W.; Tranel, P.J. Molecular Mechanisms of Herbicide Resistance. Weed Sci. 2015, 63, 91–115. [Google Scholar] [CrossRef] [Green Version]
- Bui, M.; Liu, Z. Simple Allele-Discriminating PCR for Cost-Effective and Rapid Genotyping and Mapping. Plant Methods 2009, 5, 1. [Google Scholar] [CrossRef]
- R Core Team R. A Language and Environment for Statistical Computing; R Core Team R: Vienna, Austria, 2021. [Google Scholar]
- R Studio Team. Integrated Development Environment for R; R Core Team R: Vienna, Austria, 2022. [Google Scholar]
for/rev | Primer Name | 5′-3′ Sequence |
---|---|---|
Reverse | UTR3 | TGGCTGATGAAAGGCAACAC |
Forward | AS-Trp | ACATTTAGGTATGGTTGTTCACTG |
AS-Leu | ACATTTAGGTATGGTTGTTCACTT | |
AS-Met | ACATTTAGGTATGGTTGTTCACAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Milani, A.; Panozzo, S.; Pinton, S.; Danielis, R.A.; Sattin, M.; Scarabel, L. Diversity and Spread of Acetolactate Synthase Allelic Variants at Position 574 Endowing Resistance in Amaranthus hybridus in Italy. Plants 2023, 12, 332. https://doi.org/10.3390/plants12020332
Milani A, Panozzo S, Pinton S, Danielis RA, Sattin M, Scarabel L. Diversity and Spread of Acetolactate Synthase Allelic Variants at Position 574 Endowing Resistance in Amaranthus hybridus in Italy. Plants. 2023; 12(2):332. https://doi.org/10.3390/plants12020332
Chicago/Turabian StyleMilani, Andrea, Silvia Panozzo, Samuele Pinton, Renato Antonio Danielis, Maurizio Sattin, and Laura Scarabel. 2023. "Diversity and Spread of Acetolactate Synthase Allelic Variants at Position 574 Endowing Resistance in Amaranthus hybridus in Italy" Plants 12, no. 2: 332. https://doi.org/10.3390/plants12020332