Influence of Nitrogen Application Rate on the Importance of NO3−-N and NH4+-N Transfer via Extramycelia of Arbuscular Mycorrhiza to Tomato with Expression of LeNRT2.3 and LeAMT1.1
Abstract
1. Introduction
2. Results
2.1. Effects of AMF on Nitrogen Uptake by AMF and 15N in Shoots
2.2. Effects of AMF on Nitrogen Transporter Expression
3. Materials and Methods
3.1. Experimental Site and Design
Experimental Protocol and Treatments
3.2. Hyphal Length in HCs
3.3. Root Sampling and Relative Expression of Transporters
- 5′-CCGCCGCTTCATACATCTGCAA (forward),
- 5′-GCGAAACCAAGCTGCATGGAGA (reverse) for LeAMT1.1;
- 5′-TTCCCTCATCTCGGCAGCTCAG (forward),
- 5′-CCGCGTAGGTGGTGTTTGTGAG (reverse) for LeAMT1.2;
- 5′-GGGCTACTACACTTCCTCTGG (forward),
- 5′- CCTCCAGCTCCTGTCATACC (reverse) for LeNRT2.3;
- 5′-TCGTAAGGAGTGCCCTAATGCTGA (forward),
- 5′- CAATCGCCTCCAGCCTTGTTGTAA (reverse) for LeUBI [37].
3.4. Statistical Analysis
4. Discussion
4.1. Nitrogen Transport and Acquisition via AMF with N Levels and Forms in HCs
4.2. Transporter Genes LeAMT1.1, LeAMT1.2, and LeNRT2.3 Were Regulated by Inoculation with AMF in the Root Tissue of Tomato Plants
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Smith, S.E.; Smith, F.A. Roles of arbuscular mycorrhizas in plant nutrition and growth: New paradigms from cellular to ecosystem scales. Annu. Rev. Plant Biol. 2011, 62, 227–250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balestrini, R.; Lumini, E. Focus on mycorrhizal symbioses. Appl. Soil Ecol. 2017, 123, 299–304. [Google Scholar] [CrossRef] [Scilit]
- Smith, S.E.; Smith, F.A.; Jakobsen, I. Mycorrhizal fungi can dominate phosphate supply to plants irrespective of growth responses. Plant. Physiol. 2003, 133, 16–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ryan, M.H.; Tibbett, M.; Edmonds-Tibbett, T.; Suriyagoda, L.D.B.; Lambers, H. Carbon trading for phosphorus gain: The balance between rhizosphere carboxylates and arbuscular mycorrhizal symbiosis in plant phosphorus acquisition. Plant Cell Environ. 2012, 35, 2170–2180. [Google Scholar] [CrossRef] [Scilit]
- Nouri, E.; Breuillin-Sessoms, F.; Feller, U.; Reinhardt, D. Phosphorus and nitrogen regulate arbuscular mycorrhizal symbiosis in petunia hybrida. Public Libr. Sci. 2014, 9, e90841. [Google Scholar] [CrossRef] [Scilit]
- Mensah, J.A.; Koch, A.M.; Antunes, P.M.; Kiers, E.T.; Hart, M.; Bücking, H. High functional diversity within species of arbuscular mycorrhizal fungi is associated with differences in phosphate and nitrogen uptake and fungal phosphate metabolism. Mycorrhiza 2015, 25, 533–546. [Google Scholar] [CrossRef] [Scilit]
- Treseder, K.K. A meta-analysis of mycorrhizal responses to nitrogen, phosphorus, and atmospheric CO2 in field studies. New Phytol. 2004, 164, 347–355. [Google Scholar] [CrossRef] [Scilit]
- Hodge, A.; Storer, K. Arbuscular mycorrhiza and nitrogen: Implications for individual plants through to ecosystems. Springer Int. Publ. 2015, 386, 1–19. [Google Scholar] [CrossRef] [Scilit]
- Leigh, J.; Hodge, A.; Fitter, A.H. Arbuscular mycorrhizal fungi can transfer substantial amounts of nitrogen to their host plant from organic material. New Phytol. 2009, 181, 199–207. [Google Scholar] [CrossRef] [Scilit]
- Hodge, A. Plant nitrogen capture from organic matter as affected by spatial dispersion, interspecific competition and mycorrhizal colonisation. New Phytol. 2003, 157, 303–314. [Google Scholar] [CrossRef] [Scilit]
- Hawkins, H.J.; George, E. Effect of plant nitrogen status on the contribution of arbuscular mycorrhizal hyphae to plant nitrogen uptake. Physiol. Plant. 1999, 105, 694–700. [Google Scholar] [CrossRef] [Scilit]
- Bücking, H.; Kafle, A. Role of arbuscular mycorrhizal fungi in the nitrogen uptake of plants: Current knowledge and research gaps. Agronomy 2015, 5, 587–612. [Google Scholar] [CrossRef] [Scilit]
- Johansen, A.; Jakobsen, I.; Jensen, E.S. Hyphal transport by a vesicular-arbuscular mycorrhizal fungus of N applied to the soil as ammonium or nitrate. Biol. Fertil. Soils 1993, 16, 66–70. [Google Scholar] [CrossRef] [Scilit]
- Govindarajulu, M.; Pfeffer, P.E.; Jin, H.; Abubaker, J.; Douds, D.D.; Allen, J.W.; Bücking, H.; Lammers, P.J.; Shachar-Hill, Y. Nitrogen transfer in the arbuscular mycorrhizal symbiosis. Nature 2005, 435, 819–823. [Google Scholar] [CrossRef] [Scilit]
- Miransari, M. Arbuscular mycorrhizal fungi and nitrogen uptake. Arch. Microbiol 2011, 193, 77–81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ngwene, B.; Gabriel, E.; George, E. Influence of different mineral nitrogen sources (NO3--N vs. NH4+-N) on arbuscular mycorrhiza development and N transfer in a Glomus intraradices–-cowpea symbiosis. Mycorrhiza 2013, 23, 107–117. [Google Scholar] [CrossRef] [Scilit]
- Johansen, A.; Finlay, R.D.; Olsson, P.A. Nitrogen metabolism of external hyphae of the arbuscular mycorrhizal fungus Glomus intraradices. New Phytol. 1996, 133, 705–712. [Google Scholar] [CrossRef] [Scilit]
- Jin, H.; Pfeffer, P.E.; Douds, D.D.; Piotrowski, E.; Lammers, P.J.; Shachar-Hill, Y. The uptake, metabolism, transport and transfer of nitrogen in an arbuscular mycorrhizal symbiosis. New Phytol. 2005, 168, 687–696. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, Y.; Yano, K. Nitrogen delivery to maize via mycorrhizal hyphae depends on the form of N supplied. Plant Cell Environ. 2005, 28, 1247–1254. [Google Scholar] [CrossRef] [Scilit]
- Valentine, A.J.; Kleinert, A. Respiratory costs of P uptake in arbuscular mycorrhizal roots supplied with NH4+and NO3- nutrition. Symbiosis 2006, 41, 119–125. [Google Scholar]
- Ngwene, B.; George, E.; Claussen, W.; Neumann, E. Phosphorus uptake by cowpea plants from sparingly available or soluble sources as affected by nitrogen form and arbuscular-mycorrhiza-fungal inoculation. J. Plant Nutr. Soil Sci. 2010, 173, 353–359. [Google Scholar] [CrossRef] [Scilit]
- Baum, C.; El-Tohamy, W.; Gruda, N. Increasing the productivity and product quality of vegetable crops using arbuscular mycorrhizal fungi: A review. Sci. Hortic. 2015, 187, 131–141. [Google Scholar] [CrossRef] [Scilit]
- Burleigh, S.H. Relative quantitative RT-PCR to study the expression of plant nutrient transporters in arbuscular mycorrhizas. Plant Sci. 2001, 160, 899–904. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kobae, Y.; Tamura, Y.; Takai, S.; Banba, M.; Hata, S. Localized expression of arbuscular mycorrhiza-inducible ammonium transporters in soybean. Plant Cell Physiol. 2010, 51, 1411–1415. [Google Scholar] [CrossRef] [Scilit]
- Ono, F.; Frommer, W.B.; von Wirén, N. Coordinated Diurnal Regulation of Low- and High-Affinity Nitrate Transporters in Tomato. Plant Biology. 2000, 2, 17–23. [Google Scholar] [CrossRef] [Scilit]
- Becker, D.; Stanke, R.; Fendrik, I.; Frommer, W.B.; Hedrich, R. Expression of the NH4+-transporter gene LeAMT1;2 is induced in tomato roots upon association with N2-fixing bacteria. Planta 2002, 215, 424–429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koegel, S.; Lahmidi, N.A.; Arnould, C.; Chatagnier, O.; Walder, F.; Ineichen, K.; Boller, T.; Wipf, D.; Wiemken, A.; Courty, P.E. The family of ammonium transporters (AMT) in Sorghum bicolor: Two AMT members are induced locally, but not systemically in roots colonized by arbuscular mycorrhizal fungi. New Phytol. 2013, 198, 853–865. [Google Scholar] [CrossRef] [Scilit]
- Guether, M.; Neuhauser, B.; Balestrini, R.; Dynowski, M.; Ludewig, U.; Bonfante, P. A mycorrhizal-specific ammonium transporter from Lotus japonicus acquires nitrogen released by arbuscular mycorrhizal fungi. Plant Physiol. 2009, 150, 73–83. [Google Scholar] [CrossRef] [Scilit]
- Gomez, S.K.; Javot, H.; Deewatthanawong, P.; Torres-Jerez, I.; Tang, Y.; Blancaflor, E.B.; Udvardi, M.K.; Harrison, M.J. Medicago truncatula and Glomus intraradices gene expression in cortical cells harboring arbuscules in the arbuscular mycorrhizal symbiosis. BMC Plant Biol. 2009, 9, 10. [Google Scholar] [CrossRef] [Scilit]
- Hildebrandt, U.; Schmelzer, E.; Bothe, H. Expression of nitrate transporter genes in tomato colonized by an arbuscular mycorrhizal fungus. Physiologia Plantarum. 2002, 115, 125–136. [Google Scholar] [CrossRef] [Scilit]
- Fu, Y.L.; Yi, H.Y.; Bao, J.; Gong, J.M. LeNRT2.3 functions in nitrate acquisition and long-distance transport in tomato. FEBS Lett. 2015, 589, 1072–1079. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Neumann, E.; George, E. Extraction of extraradical arbuscular mycorrhizal mycelium from compartments filled with soil and glass beads. Mycorrhiza 2005, 15, 533–537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoagland, D.R.; Arnon, D.I. The Water-Culture Method for Growing Plants without Soil. Calif. Agric. Exp. Stn. Circular 1950, 347, 1–32. [Google Scholar]
- Phillips, J.M. Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection. Trans. Br. Mycol. Soc. 1970, 55, 158-IN18. [Google Scholar] [CrossRef] [Scilit]
- Jakobsen, I.; Abbott LKRobson, A.D. External hyphae of vesicular-arbuscular mycorrhizal fungi associated with Trifolium subterraneum L. New Phytol. 1992, 120, 371–380. [Google Scholar] [CrossRef] [Scilit]
- Miller, R.M.; Jastrow, J.D.; Reinhardt, D.R. External hyphal production of vesicular-arbuscular mycorrhizal fungi in pasture and tallgrass prairie communities. Oecologia 1995, 103, 17–23. [Google Scholar] [CrossRef] [Scilit]
- Mascia, T.; Santovito, E.; Gallitelli, D.; Cillo, F. Evaluation of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in infected tomato plants. Mol. Plant Pathol. 2010, 11, 805–816. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T. Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Jackson, L.E.; Burger, M.; Cavagnaro, T.R. Roots, nitrogen transformations, and ecosystem services. Annu. Rev. Plant. Biol. 2008, 59, 341–363. [Google Scholar] [CrossRef] [Scilit]
- Paymaneh, Z.; Gryndler, M.; Konvalinková, T.; Benada, O.; Borovička, J.; Bukovská, P.; Püschel, D.; Řezáčová, V.; Sarcheshmehpour, M.; Jansa, J. Soil Matrix Determines the Outcome of Interaction Between Mycorrhizal Symbiosis and Biochar for Andropogon gerardii Growth and Nutrition. Front. Microbiol. 2018, 27, 2862. [Google Scholar] [CrossRef] [Scilit]
- Ngwene, B.; Mertens, J.; Splettster, T.; Gabriel, E.; George, E. Influence of mineral nitrogen sources (NO3 − -N vs. NH 4 + -N) on arbuscular mycorrhiza development and N transfer in a Rhizophagus irregularis symbiosis. In Proceedings of the Eighth International Conference on Mycorrhizas (ICOM8), Flagstaff, AZ, USA, 3–7 August 2015. [Google Scholar]
- Fan, X.R.; Tang, Z.; Tan, Y.W.; Zhang, Y.; Luo, B.B.; Yang, M.; Lian, X.M.; Shen, Q.R.; Miller, A.J.; Xu, G.H. Overexpression of a pH-sensitive nitrate transporter in rice increases crop yields. Proc. Natl. Acad. Sci. USA. 2016, 113, 7118–7123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koegel, S.; Boller, T.; Lehmann, M.F.; Wiemken, A.; Courty, P.E. Rapid nitrogen transfer in the Sorghum bicolor-Glomus mosseae arbuscular mycorrhizal symbiosis. Plant Signal. Behav. 2013, 8, e25229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pérez-Tienda, J.; Corrêa, A.; Azcón-Aguilar, C.; Ferrol, N. Transcriptional regulation of host NH4+ transporters and GS/GOGAT pathway in arbuscular mycorrhizal rice roots. Plant Physiol. Biochem. 2014, 75, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lima, J.E.; Kojima, S.; Takahashi, H.; Von Wiren, N. Ammonium triggers lateral root branching in arabidopsis in an ammonium transporter1;3-dependent manner. Plant Cell 2010, 22(11), 3621–3633. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, J.; Lv, W.X.; Xu, J.; Huang, Z.; Rui, W.J.; Lei, X.H.; Ju, X.H.; Li, Z.F. Overlapping Root Architecture and Gene Expression of Nitrogen Transporters for Nitrogen Acquisition of Tomato Plants Colonized with Isolates of Funneliformis mosseae in Hydroponic Production. Plants 2022, 11, 1176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
| Treatments | 15N Abundance | 15N Transported | AMF Colonization | Hyphal Density | |
|---|---|---|---|---|---|
| (‰) | (μg·plant−1) | (%) | (cm g−1 Substrate) | ||
| HN # | NO3− | 0.074 ± 0.006 b | 20.7 ± 2.13 a | 58.3 ± 5.18 a | 22.3 ± 4.70 a |
| NH4+ | 0.083 ± 0.014 b | 20.0 ± 4.00 a | 61.7 ± 1.65 a | 10.5 ± 1.97 a | |
| LN # | NO3− | 0.097 ± 0.011 ab | 14.2 ± 1.32 a | 53.3 ± 4.09 a | 16.2 ± 5.19 a |
| NH4+ | 0.138 ± 0.015 a | 18.4 ± 2.50 a | 58.3 ± 3.18 a | 16.1 ± 3.35 a | |
| N levels& | |||||
| HN | 0.078 ± 0.021 a | 20.4 ± 2.11 a | 60.0 ± 2.59 a | 16.4 ± 3.23 a | |
| LN | 0.118 ± 0.033 b | 16.3 ± 1.53 a | 55.8 ± 2.58 a | 16.1 ± 2.86 a | |
| N forms in HCs& | |||||
| NO3− | 0.086 ± 0.021 a | 17.5 ± 1.69 a | 55.8 ± 3.20 a | 19.2 ± 3.44 a | |
| NH4+ | 0.110 ± 0.040 a | 19.2 ± 2.21 a | 60.0 ± 1.77 a | 13.3 ± 2.08 a | |
| Significance | |||||
| N levels | ** | ns | ns | ns | |
| N forms | ns | ns | ns | ns | |
| N levels * N forms | * | ns | ns | ns | |
| Treatments | HN | LN | ||||||
|---|---|---|---|---|---|---|---|---|
| N Concentration | N Uptake | P Concentration | P Uptake | N Concentration | N Uptake | P Concentration | P Uptake | |
| (%) | (mg plant−1) | (mg plant−1) | (mg plant−1) | (%) | (mg plant−1) | (mg plant−1) | (mg plant−1) | |
| Inoculation | ||||||||
| +AMF | 1.46 ± 0.10 a | 263.7 ± 23.4 a | 3.49 ± 0.23 a | 62.55 ± 1.88 a | 1.46 ± 0.03 a | 140.1 ± 4.76 a | 4.17 ± 0.06 a | 40.0 ± 1.08 a |
| −AMF | 1.49 ± 0.02 a | 259.3 ± 5.68 a | 3.31 ± 0.07 a | 57.85 ± 4.23 a | 1.24 ± 0.02 b | 114.4 ± 1.86 b | 4.24 ± 0.06 a | 39.3 ± 0.75 a |
| Nitrogen forms in HCs | ||||||||
| AMF HCs NO3− | 1.58 ± 0.19 a | 289.6 ± 44.0 a | 3.54 ± 0.37 a | 64.4 ± 7.67 a | 1.45 ± 0.03 a | 147.58 ± 6.66 a | 4.16 ± 0.11 a | 42.2 ± 1.40 a |
| AMF HCs NH4+ | 1.34 ± 0.01 a | 237.8 ± 13.0 a | 3.45 ± 0.33 a | 60.7 ± 4.75 a | 1.46 ± 0.06 a | 132.67 ± 4.93 a | 4.18 ± 0.07 a | 37.9 ± 0.73 b |
| Significance | ||||||||
| AMF | ns | ns | ns | ns | *** | *** | ns | ns |
| Nitrogen forms | ns | ns | ns | ns | ns | ns | ns | ns |
| AMF * Nitrogen forms | ns | ns | ns | ns | ns | ns | ns | * |
| Treatments | HN | LN | ||||
|---|---|---|---|---|---|---|
| Shoots | Roots | Total Plant | Shoots | Roots | Total Plant | |
| (g plant−1) | (g plant−1) | (g plant−1) | (g plant−1) | (g plant−1) | (g plant−1) | |
| Inoculation | ||||||
| +AMF | 17.9 ± 0.61 a | 1.88 ± 0.09 a | 19.8 ± 0.61 a | 9.61 ± 0.29 a | 1.12 ± 0.06 a | 10.7 ± 0.03 a |
| −AMF | 17.5 ± 0.33 a | 1.68 ± 0.14 a | 19.1 ± 0.26 a | 9.25 ± 0.08 a | 1.01 ± 0.06 a | 10.3 ± 0.12 a |
| N forms in HC | ||||||
| NO3− | 18.1 ± 0.67 a | 1.89 ± 0.09 a | 20.0 ± 0.74 a | 10.20 ± 0.36 a | 1.05 ± 0.09 a | 11.2 ± 0.35 a |
| NH4+ | 17.8 ± 1.11 a | 1.86 ± 0.18 a | 19.6 ± 1.06 a | 9.08 ± 0.27 b | 1.20 ± 0.06 a | 10.3 ± 0.32 b |
| Significance | ||||||
| ±AMF | ns | ns | ns | ns | ns | ns |
| N forms | ns | ns | ns | ns | ns | ns |
| AMF *N forms | ns | ns | ns | * | ns | ns |
| Treatments | HN | LN | ||||
|---|---|---|---|---|---|---|
| LeNRT2.3 | LeAMT1.1 | LeAMT1.2 | LeNRT2.3 | LeAMT1.1 | LeAMT1.2 | |
| Inoculation | ||||||
| +AMF | 1.12 ± 0.29 a | 1.88 ± 0.44 a | 1.26 ± 0.17 a | 1.12 ± 0.23 a | 0.72 ± 0.28 a | 0.95 ± 0.32 a |
| −AMF | 0.58 ± 0.21 a | 0.83 ± 0.29 b | 1.11 ± 0.17 a | 0.51 ± 0.12 b | 1.30 ± 0.22 a | 1.10 ± 0.16 a |
| Nitrogen forms (HCs) | ||||||
| NO3− | 0.97 ± 0.29 a | 2.67 ± 0.56 a | 1.36 ± 0.36 a | 0.68 ± 0.17 b | 0.33 ± 0.03 a | 0.73 ± 0.09 a |
| NH4+ | 1.27 ± 0.56 a | 1.09 ± 0.14 b | 1.16 ± 0.10 a | 1.56 ± 0.23 a | 1.10 ± 0.50 a | 1.18 ± 0.68 a |
| Significance | ||||||
| ±AMF | ns | ** | ns | * | ns | ns |
| Nitrogen forms (HCs) | ns | * | ns | ns | ns | ns |
| ±AMF * Nitrogen forms | ns | * | ns | * | ns | ns |
| Treatments | Root Compartment (RC) | Hyphal Compartment (HC) | |||||
|---|---|---|---|---|---|---|---|
| N | NH4+-N | NO3−-N | 15NH4+ | 15NO3− | |||
| (mg L−1) | (mg L−1) | (mg HC−1) | |||||
| HN | AMF | NH4+ | 160 | 94 | - | 10 | - |
| NO3− | 160 | - | 94 | - | 10 | ||
| NO-AMF | NH4+ | 160 | 94 | - | 10 | - | |
| NO3− | 160 | - | 94 | - | 10 | ||
| LN | AMF | NH4+ | 94 | 94 | - | 10 | - |
| NO3− | 94 | - | 94 | - | 10 | ||
| NO-AMF | NH4+ | 94 | 94 | - | 10 | - | |
| NO3− | 94 | - | 94 | - | 10 | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xie, X.; Huang, Z.; Lv, W.; Zhu, H.; Hui, G.; Li, R.; Lei, X.; Li, Z. Influence of Nitrogen Application Rate on the Importance of NO3−-N and NH4+-N Transfer via Extramycelia of Arbuscular Mycorrhiza to Tomato with Expression of LeNRT2.3 and LeAMT1.1. Plants 2023, 12, 314. https://doi.org/10.3390/plants12020314
Xie X, Huang Z, Lv W, Zhu H, Hui G, Li R, Lei X, Li Z. Influence of Nitrogen Application Rate on the Importance of NO3−-N and NH4+-N Transfer via Extramycelia of Arbuscular Mycorrhiza to Tomato with Expression of LeNRT2.3 and LeAMT1.1. Plants. 2023; 12(2):314. https://doi.org/10.3390/plants12020314
Chicago/Turabian StyleXie, Xiaocan, Zhe Huang, Weixing Lv, Houteng Zhu, Guoming Hui, Ronghua Li, Xihong Lei, and Zhifang Li. 2023. "Influence of Nitrogen Application Rate on the Importance of NO3−-N and NH4+-N Transfer via Extramycelia of Arbuscular Mycorrhiza to Tomato with Expression of LeNRT2.3 and LeAMT1.1" Plants 12, no. 2: 314. https://doi.org/10.3390/plants12020314
APA StyleXie, X., Huang, Z., Lv, W., Zhu, H., Hui, G., Li, R., Lei, X., & Li, Z. (2023). Influence of Nitrogen Application Rate on the Importance of NO3−-N and NH4+-N Transfer via Extramycelia of Arbuscular Mycorrhiza to Tomato with Expression of LeNRT2.3 and LeAMT1.1. Plants, 12(2), 314. https://doi.org/10.3390/plants12020314

