Genome-Wide Identification and Expression Analysis of the PLATZ Transcription Factor in Tomato
Abstract
:1. Introduction
2. Results
2.1. Identification and Chromosomal Localization of PLATZ Gene Family Members in Tomato
2.2. Analysis of the Structure, Conserved Domain, and Motif of the SlPLATZ Gene
2.3. Phylogenetic Analysis of the PLATZ Family
2.4. Analysis of Collinearity and Selection Pressure on the Tomato PLATZ Gene Family
2.5. Analysis of Cis-Acting Regulatory Elements of SlPLATZ Genes
2.6. Interaction between PLATZ Proteins in Tomato
2.7. Tissue-Specific Expression Patterns of PLATZ Genes
2.8. Expression Profiles of SlPLATZ Genes
3. Discussion
4. Materials and Methods
4.1. Plant Materials, Growth Conditions, and Treatment
4.2. Identification of PLATZ Gene Families
4.3. Conserved Structural Domains and Cis-Regulatory Elements of the PLATZ Gene
4.4. Selection Pressure Analysis, Interspecies Collinearity, and Phylogenetic Analysis of the PLATZ Gene
4.5. Interaction Network and Expression Analysis
4.6. Expression Profile of SlPLATZ
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Samad, A.F.A.; Sajad, M.; Nazaruddin, N.; Fauzi, I.A.; Murad, A.M.A.; Zamri, Z.; Ismanizan, I. MicroRNA and transcription factor: Key players in plant regulatory network. Front. Plant Sci. 2017, 8, 565. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Li, P.; Fan, L.; Wu, M. The nuclear transportation routes of membrane-bound transcription factors. Cell Commun. Signal. 2018, 16, 12. [Google Scholar] [CrossRef] [PubMed]
- Nath, V.S.; Mishra, A.K.; Kumar, A.; Matoušek, J.; Jakše, J. Revisiting the role of transcription factors in coordinating the defense response against citrus bark cracking viroid infection in commercial hop (Humulus lupulus L.). Viruses 2019, 11, 5. [Google Scholar]
- Nagano, Y.; Furuhashi, H.; Inaba, T.; Sasaki, Y. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences. Nucleic Acids Res. 2001, 29, 4097–4105. [Google Scholar] [CrossRef] [Green Version]
- Fu, Y.; Cheng, M.; Li, M.; Guo, X.; Wu, Y.; Wang, J. Identification and characterization of PLATZ transcription factors in wheat. Int. J. Mol. Sci. 2020, 21, 8934. [Google Scholar] [CrossRef]
- Zhang, S.-C.; Yang, R.; Huo, Y.-Q.; Liu, S.-S.; Yang, G.-D.; Huang, J.-G.; Zheng, C.-C.; Wu, C.-G. Expression of cotton PLATZ1 in transgenic Arabidopsis reduces sensitivity to osmotic and salt stress for germination and seedling establishment associated with modification of the abscisic acid, gibberellin, and ethylene signalling pathways. BMC Plant Biol. 2018, 18, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.H.; Kim, J.; Jun, S.E.; Park, S.; Timilsina, R.; Kwon, D.S.; Kim, Y.; Park, S.J.; Hwang, J.Y.; Nam, H.G.; et al. ORESARA15, a PLATZ transcription factor, mediates leaf growth and senescence in Arabidopsis. New Phytol. 2018, 220, 609–623. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, A.; Hou, Q.-Q.; Si, L.; Huang, X.-H.; Luo, J.-H.; Lu, D.-F.; Zhu, J.-J.; Shangguan, Y.-Y.; Miao, J.-S.; Xie, Y.-F. The PLATZ transcription factor GL6 affects grain length and number in rice. Plant Physiol. 2019, 180, 2077–2090. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, S.R.; Xue, H.W. The rice PLATZ protein SHORT GRAIN6 determines grain size by regulating spikelet hull cell division. J. Integr. Plant Biol. 2019, 62, 847–864. [Google Scholar] [CrossRef]
- Yamada, M.; Han, X.; Benfey, P.N. RGF1 controls root meristem size through ROS signalling. Nature 2020, 577, 85–88. [Google Scholar] [CrossRef]
- Li, Q.; Wang, J.-C.; Ye, J.-W.; Zheng, X.-X.; Xiang, X.-L.; Li, C.-S.; Fu, M.-M.; Wang, Q.; Zhang, Z.-Y.; Wu, Y.-R. The maize imprinted gene Floury3 encodes a PLATZ protein required for tRNA and 5S rRNA transcription through interaction with RNA polymerase III. Plant Cell 2017, 29, 2661–2675. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.-C.; Ji, C.; Li, Q.; Zhou, Y.; Wu, Y.-R. Genome-wide analysis of the plant-specific PLATZ proteins in maize and identification of their general role in interaction with RNA polymerase III complex. BMC Plant Biol. 2018, 18, 1–12. [Google Scholar] [CrossRef]
- Chao, Q.; Gao, Z.F.; Zhang, D.; Zhao, B.G.; Dong, F.Q.; Fu, C.X.; Liu, L.J.; Wang, B.C. The developmental dynamics of the Populus stem transcriptome. Plant Biotechnol. J. 2019, 17, 206–219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hande, A.S.; Katageri, I.S.; Jadhav, M.P.; Adiger, S.; Gamanagatti, S.; Padmalatha, K.V.; Dhandapani, G.; Kanakachari, M.; Kumar, P.A.; Reddy, V.S. Transcript profiling of genes expressed during fibre development in diploid cotton (Gossypium arboreum L.). BMC Genom. 2017, 18, 675. [Google Scholar] [CrossRef] [Green Version]
- Kasirajan, L.; Hoang, N.V.; Furtado, A.; Botha, F.C.; Henry, R.J. Transcriptome analysis highlights key differentially expressed genes involved in cellulose and lignin biosynthesis of sugarcane genotypes varying in fiber content. Sci. Rep. 2018, 8, 11612. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Wang, Y.; Xiao, Q.; Luo, L.; Zhang, C.; Mao, C. Transcription factor ZmPLATZ2 positively regulate the starch synthesis in maize. Plant Growth Regul. 2021, 93, 291–302. [Google Scholar] [CrossRef]
- González-Morales, S.I.; Chávez-Montes, R.A.; Hayano-Kanashiro, C.; Alejo-Jacuinde, G.; Rico-Cambron, T.Y.; de Folter, S.; Herrera-Estrella, L. Regulatory network analysis reveals novel regulators of seed desiccation tolerance in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 2016, 113, E5232–E5241. [Google Scholar] [CrossRef]
- Liu, S.-S.; Yang, R.; Liu, M.; Zhang, S.-Z.; Yan, K.; Yang, G.-D.; Huang, J.-G.; Zheng, C.-C.; Wu, C.-G. PLATZ2 negatively regulates salt tolerance in Arabidopsis seedlings by directly suppressing the expression of the CBL4/SOS3 and CBL10/SCaBP8 genes. J. Exp. Bot. 2020, 71, 5589–5602. [Google Scholar] [CrossRef] [PubMed]
- So, H.A.; Choi, S.J.; Chung, E.; Lee, J.H. Molecular characterization of stress-inducible PLATZ gene from soybean (Glycine max L.). Plant Omics. 2015, 8, 479. [Google Scholar]
- Zenda, T.; Liu, S.; Wang, X.; Liu, G.; Jin, H.; Dong, A.; Yang, Y.; Duan, H. Key maize drought-responsive genes and pathways revealed by comparative transcriptome and physiological analyses of contrasting inbred lines. Int. J. Mol. Sci. 2019, 20, 1268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hou, D.; Zhao, Z.; Hu, Q.; Li, L.; Vasupalli, N.; Zhuo, J.; Zeng, W.; Wu, A.; Lin, X. PeSNAC-1 a NAC transcription factor from moso bamboo (Phyllostachys edulis) confers tolerance to salinity and drought stress in transgenic rice. Tree Physiol. 2020, 40, 1792–1806. [Google Scholar] [CrossRef]
- Yamaguchi-Shinozaki, K.; Shinozaki, K. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters. Trends Plant Sci. 2005, 10, 88–94. [Google Scholar] [CrossRef] [PubMed]
- Ventura, I.; Brunello, L.; Iacopino, S.; Valeri, M.C.; Novi, G.; Dornbusch, T.; Perata, P.; Loreti, E. Arabidopsis phenotyping reveals the importance of alcohol dehydrogenase and pyruvate decarboxylase for aerobic plant growth. Sci. Rep. 2020, 10, 16669. [Google Scholar] [CrossRef]
- Margaritopoulou, T.; Kryovrysanaki, N.; Megkoula, P.; Prassinos, C.; Samakovli, D.; Milioni, D.; Hatzopoulos, P. HSP90 canonical content organizes a molecular scaffold mechanism to progress flowering. Plant J. 2016, 87, 174–187. [Google Scholar] [CrossRef] [PubMed]
- Koning, A.J.; Rose, R.; Comai, L. Developmental expression of tomato heat-shock cognate protein 80. Plant Physiol. 1992, 100, 801–811. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, X.; Rong, H.; Tian, Y.; Qu, Y.; Xu, M.; Xu, L.-A. Genome-Wide Identification of PLATZ Transcription Factors in Ginkgo biloba L. and Their Expression Characteristics During Seed Development. Front. Plant Sci. 2022, 13. [Google Scholar] [CrossRef] [PubMed]
- Wai, A.H.; Rahman, M.M.; Waseem, M.; Cho, L.-H.; Naing, A.H.; Jeon, J.-S.; Lee, D.-j.; Kim, C.-K.; Chung, M.-Y. Comprehensive Genome-Wide Analysis and Expression Pattern Profiling of PLATZ Gene Family Members in Solanum lycopersicum L. under Multiple Abiotic Stresses. Plants 2022, 11, 3112. [Google Scholar] [CrossRef]
- Grabowski, E.; Miao, Y.; Mulisch, M.; Krupinska, K. Single-stranded DNA-binding protein Whirly1 in barley leaves is located in plastids and the nucleus of the same cell. Plant Physiol. 2008, 147, 1800–1804. [Google Scholar] [CrossRef] [Green Version]
- Krause, K.; Krupinska, K. Nuclear regulators with a second home in organelles. Trends Plant Sci. 2009, 14, 194–199. [Google Scholar] [CrossRef]
- Knowles, D.G.; Mclysaght, A. High rate of recent intron gain and loss in simultaneously duplicated Arabidopsis genes. Mol. Biol. Evol. 2006, 23, 1548–1557. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cao, J.; Shi, F. Dynamics of arginase gene evolution in metazoans. J. Biomol. Struct. Dyn. 2012, 30, 407–418. [Google Scholar] [CrossRef] [PubMed]
- Nekrutenko, A.; Makova, K.D.; Li, W.-H. The KA/KS ratio test for assessing the protein-coding potential of genomic regions: An empirical and simulation study. Genome Res. 2002, 12, 198–202. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Azim, J.B.; Khan, M.F.H.; Hassan, L.; Robin, A.H.K. Genome-wide characterization and expression profiling of plant-specific PLATZ transcription factor family genes in Brassica rapa L. Plant Breed. Biotechnol. 2020, 8, 28–45. [Google Scholar] [CrossRef]
- Biłas, R.; Szafran, K.; Hnatuszko-Konka, K.; Kononowicz, A.K. Cis-regulatory elements used to control gene expression in plants. Plant Cell Tiss. Org. 2016, 127, 269–287. [Google Scholar] [CrossRef] [Green Version]
- León, J.; Castillo, M.C.; Gayubas, B. The hypoxia–reoxygenation stress in plants. J. Exp. Bot. 2020, 72, 5841–5856. [Google Scholar] [CrossRef]
- Azevedo, C.; Sadanandom, A.; Kitagawa, K.; Freialdenhoven, A.; Shirasu, K.; Schulze-Lefert, P. The RAR1 interactor SGT1, an essential component of R gene-triggered disease resistance. Science 2002, 295, 2073–2076. [Google Scholar] [CrossRef]
- Watanabe, E.; Mano, S.; Nomoto, M.; Tada, Y.; Hara-Nishimura, I.; Nishimura, M.; Yamada, K.J. HSP90 stabilizes auxin-responsive phenotypes by masking a mutation in the auxin receptor TIR1. Plant Cell Physiol. 2016, 57, 2245–2254. [Google Scholar] [CrossRef] [Green Version]
- Riechmann, J.L.; Heard, J.; Martin, G.; Reuber, L.; Jiang, C.-Z.; Keddie, J.; Adam, L.; Pineda, O.; Ratcliffe, O.J.; Samaha, R.R. Arabidopsis transcription factors: Genome-wide comparative analysis among eukaryotes. Science 2000, 290, 2105–2110. [Google Scholar] [CrossRef]
- Kiełbowicz-Matuk, A. Involvement of plant C2H2-type zinc finger transcription factors in stress responses. Plant Sci. Int. J. Exp. Plant Biol. 2012, 185–186, 78–85. [Google Scholar] [CrossRef]
- Lian, L.; Xu, H.; Zhang, H.; He, W.; Zhang, J.F. Overexpression of OsSPL14 results in transcriptome and physiology changes in indica rice ‘MH86. ’ Plant Growth Regul. 2020, 90, 265–278. [Google Scholar] [CrossRef] [Green Version]
- Finn, R.D.; Clements, J.; Eddy, S.R. HMMER web server: Interactive sequence similarity searching. Nucleic Acids Res. 2011, 39, W29–W37. [Google Scholar] [CrossRef] [Green Version]
- Artimo, P.; Jonnalagedda, M.; Arnold, K.; Baratin, D.; Csardi, G.; De Castro, E.; Duvaud, S.; Flegel, V.; Fortier, A.; Gasteiger, E. ExPASy: SIB bioinformatics resource portal. Nucleic Acids Res. 2012, 40, W597–W603. [Google Scholar] [CrossRef] [PubMed]
- Horton, P.; Park, K.-J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35, W585–W587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bailey, T.L.; Williams, N.; Misleh, C.; Li, W.-W. MEME: Discovering and analyzing DNA and protein sequence motifs. Nucleic Acids Res. 2006, 34, W369–W373. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant. 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
- Rombauts, S.; Déhais, P.; Van Montagu, M.; Rouzé, P. PlantCARE, a plant cis-acting regulatory element database. Nucleic Acids Res. 1999, 27, 295–296. [Google Scholar] [CrossRef] [Green Version]
- Wang, D.-P.; Zhang, Y.-B.; Zhang, Z.; Zhu, J.; Yu, J. KaKs_Calculator 2.0: A toolkit incorporating gamma-series methods and sliding window strategies. Genom. Proteom. Bioinf. 2010, 8, 77–80. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.-P.; Tang, H.-B.; Debarry, J.-D.; Tan, X.; Li, J.-P.; Wang, X.-Y.; Lee, T.-H.; Jin, H.-Z.; Marler, B.; Guo, H. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.-Y.; Zhu, J.-Q.; Ge, C.; Wang, Y.; Zhao, Z.-M.; Ma, S.-J.; Hoffmann, A.A.; Endersby, N.M.; Liu, Q.-X.; Yu, W.-D. Molecular phylogeny and historical biogeography of the butterfly tribe Aeromachini Tutt (Lepidoptera: Hesperiidae) from China. Cells 2019, 8, 294. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
- Su, G.; Morris, J.H.; Demchak, B.; Bader, G.D. Biological Network Exploration with Cytoscape 3. Curr. Protoc. Bioinf. 2014, 47, 8.13.1–8.13.24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fei, Z.; Joung, J.-G.; Tang, X.; Zheng, Y.; Huang, M.; Lee, J.M. Tomato Functional Genomics Database: A Comprehensive Resource and Analysis Package for Tomato Functional Genomics. Nucleic Acids Res. 2011, 39, D1156–D1163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bolger, A.; Scossa, F.; Bolger, M.; Lanz, C.; Maumus, F.; Tohge, T. The genome of the stress-tolerant wild tomato species Solanum pennellii. Nat. Genet. 2014, 46, 1034–1038. [Google Scholar] [CrossRef]
- Swift, M.L. GraphPad prism, data analysis, and scientific graphing. J. Chem. Inform. Comput. Sci. 1997, 37, 411–412. [Google Scholar] [CrossRef]
Gene Name | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
---|---|---|
SIPLATZ1 | CGGGTTTAGACGATGGTCAA | GTTTCTTCCTTACCACCTCTGTTG |
SIPLATZ2 | TGGAAGAGATGATGAAACCTGC | GAGGATGTGAGTGATGTTGTGG |
SIPLATZ4 | GCCACATTCTGGGTCTGTCT | CCACATTCTGGGTCTGTCTCAT |
SIPLATZ5 | ATTGCTTTGAATCCTCTGCCAC | TGAAACGGAGGGAGAGAAATG |
SIPLATZ12 | GCTTTGAATCCTCTGCCACA | CATCGCCAAACAACCACT |
SIPLATZ14 | CTTTGAATCCTCTGCCACATTG | CTTCGTCTCAACAATCTTTCCC |
SIPLATZ19 | TTGCGTTGCTACAGACGAAC | TTATGTGGCAGCGGATTCA |
SIPLATZ20 | ACAGACAAACACAATGGGCA | GCAGCGGATTCAAAGCAAC |
SIPLATZ21 | GGTTGAAGCCATTGTTGAAGG | CGATGACCTCCGAATCTGAAT |
SIPLATZ23 | TGCCGCTCATCTAAACACAA | TGCCACTGCTCTTTGGTTG |
SIPLATZ24 | GCTAAAGCACCACAAGGACCT | ATGGCTCGTCATTGTCCACG |
Actin | CAGGGTGTTCTTCAGGAGCAA | GGTGTTATGGTCGGAATGGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, L.; Yang, T.; Wang, Z.; Zhang, F.; Li, N.; Jiang, W. Genome-Wide Identification and Expression Analysis of the PLATZ Transcription Factor in Tomato. Plants 2023, 12, 2632. https://doi.org/10.3390/plants12142632
Zhang L, Yang T, Wang Z, Zhang F, Li N, Jiang W. Genome-Wide Identification and Expression Analysis of the PLATZ Transcription Factor in Tomato. Plants. 2023; 12(14):2632. https://doi.org/10.3390/plants12142632
Chicago/Turabian StyleZhang, Lifang, Tao Yang, Zepeng Wang, Fulin Zhang, Ning Li, and Weijie Jiang. 2023. "Genome-Wide Identification and Expression Analysis of the PLATZ Transcription Factor in Tomato" Plants 12, no. 14: 2632. https://doi.org/10.3390/plants12142632
APA StyleZhang, L., Yang, T., Wang, Z., Zhang, F., Li, N., & Jiang, W. (2023). Genome-Wide Identification and Expression Analysis of the PLATZ Transcription Factor in Tomato. Plants, 12(14), 2632. https://doi.org/10.3390/plants12142632