Next Article in Journal
Exploring the Anticancer Potential of Premna resinosa (Hochst.) Leaf Surface Extract: Discovering New Diterpenes as Heat Shock Protein 70 (Hsp70) Binding Agents
Previous Article in Journal
Bacillus cabrialesii: Five Years of Research on a Novel Species of Biological Control and Plant Growth-Promoting Bacteria
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Crocus heuffelianus—A New Species for the Bulgarian Flora from Series Verni (Iridaceae)

by
Tsvetanka Raycheva
1,
Kiril Stoyanov
1,*,
Samir Naimov
2 and
Elena Apostolova-Kuzova
2
1
Department of Botany and Agrometeorology, Agricultural University, 4000 Plovdiv, Bulgaria
2
Department of Plant Physiology and Molecular Biology, University of Plovdiv, 4000 Plovdiv, Bulgaria
*
Author to whom correspondence should be addressed.
Plants 2023, 12(13), 2420; https://doi.org/10.3390/plants12132420
Submission received: 26 May 2023 / Revised: 19 June 2023 / Accepted: 20 June 2023 / Published: 22 June 2023
(This article belongs to the Section Plant Systematics, Taxonomy, Nomenclature and Classification)

Abstract

In the Pirin Mountains, at an elevation of around 1000 m, three populations of a new species of Bulgarian flora from the genus Crocus, series Verni, were discovered. The species was compared to the morphologically related C. veluchensis, and presented with diagnostic morphological and anatomical features. Despite the high degree of morphological similarity, the molecular analysis, which included sequences from all related species (C. cvijicii, C. dalmaticus, C. jablanicensis, C. rujanensis, C. sieberi subsp. atticus, and C. veluchensis), distinguished the Pirin Mountains’ populations, and revealed the closest relationship to C. heuffelianus. Despite the C. heuffelianus/C. verni complex’s uncertain taxonomic status, our findings on the local population, based on morphometric, anatomical, molecular, and geographic analyses, indicate its belonging to the putative allotetraploid C. heuffelianus of south-eastern Europe and the Balkans, and an expansion of its range to the southeast. Given the taxonomic uncertainty and unclear phylogenetic relationships of the taxa in the Crocus vernus complex, we considered it appropriate to accept our taxon as Crocus heuffelianus. So far, only C. tommasinianus Herb. has been found in Bulgarian flora from the Crocus series Verni, but in terms of altitude and morphological features, the species from our collection is close to the Balkan endemic C. veluchensis, which belongs to the C. sieberi aggregate. Morphologically, it differs by the dark, heart-shaped spots on the tip of the tepals, and the presence of one bract. A detailed comparative anatomical analysis between the three species of crocuses from the series Verni in Bulgaria shows discrete differences: the width of the white stripe and lacunar area are good distinguishing features, as are the number of conducting vessels.

Graphical Abstract

1. Introduction

The genus Crocus contains over 235 species worldwide [1]. One of the centres of biological diversity is the Balkan Peninsula [2]. In Mathew’s (1982) monograph, the genus was divided into the sections Crocus Mathew (series Verni Mathew, Scardici Mathew, Crocus Mathew) and Nudiscapus Mathew (series Reticulati Mathew, Biflori Mathew, Flavi Mathew) [2]. There are controversies and uncertainties related to the systematics and phylogenetic relationships within taxonomic groups. One critical group is the Verni series, with mostly spring-flowering crocuses from central and southern Europe, some of which are important ornamentals [3]. So far, C. tommasinianus Herb is the only known Bulgarian flora from the series Verni. In February 2023, a large population of a species unknown to our flora, with a V-shaped to heart-shaped spot on the tips of their purple tepals, was discovered above the town of Bansko. The species was determined to be the closest in comparative morphological characters to Crocus heuffelianus Herb., which belongs to the series Verni. During field surveys in the Pirin region, distant from the first population, two more populations of the same taxon were observed. In terms of altitude, ecological conditions, and morphological features, our species is close to the Balkan endemic C. veluchensis Herb., which belongs to the C. sieberi aggregate [4,5]. Crocus vernus (L.) Hill. is a European alpine species with a general distribution west to the Pyrenees and Alps, east to Ukraine, and south to Sicily and Albania [2,6]. Mathew accepted Crocus heuffelianus in the synonymy of C. vernus ssp. Vernus, and has also included C. scepusiensis (Rehm. et Wol.) Borb., C. napolitanus Mord. Laun et Lois, and C. purpureus Weston within it. [2]. However, more recent studies support the recognition of C. heuffelianus as a distinct taxon [7,8,9,10,11].
Crocus heuffelianus is distributed east to Austria, throughout the Balkan Peninsula, with the southern border in Albania [7]. It extends east into Romania and Ukraine and also extends into northeast Italy [8], with the northern distribution limit in Poland [6,9,10]. Crocus heuffelianus is closely related to several taxa with ambiguous taxonomic ranks accepted by different authors, e.g., C. scepusiensis (Rehmer & Wol.) Borbás ex Kulcz., C. vittatus Schloss. & Vuk., nom. illeg. Crocus vernus is a European alpine species, with a general distribution in the Pyrenees and Alps, east to Ukraine, and south to Sicily and Albania [2,6]. Recent phylogenetic analyses of polyploid lines from C. heuffelianus [3] testify to an allotetraploid origin resulting from the multiple reciprocal crosses between diploid genotypes of C. heuffelianus and C. vernus.
A good taxonomic marker in crocuses can be found in the literature at the level of leaf micromorphology [11,12,13,14,15,16,17,18]. Comparative anatomical studies of leaves in different taxa of the Verni series with different geographical origins have been carried out [18,19].
The phylogenetic relationships in the group are unclear. There are difficulties related to species differentiation, nomenclature, synonymy, and taxonomic affiliation [3,18]. A study of the populations of ser. Verni by morphology, anatomy, karyology, and molecular genetic markers proves allopolyploidy as a result of introgression between C. heuffelianus and C. vernus. The range of C. heuffelianus s.str. is in the Carpathians, and the western Balkans have occurred only tetraploids of C. cf. heuffelianus [3].
Due to taxonomic difficulties and unclear species status, a comparative morphological and anatomical study of the newly discovered taxon was made with the morphologically similar species C. veluchensis and the closely related C. tommasinianus. On the other hand, morphological differences do not always reflect kinship relationships. For this reason, we undertook sequencing of the internal transcribed spacer region (ITS: ITS1 + 5.8S rDNA + ITS2), which has already been successfully used in phylogenetic studies in the genus Crocus [20,21].

2. Results

2.1. Morphological Description Based on Bulgarian Materials

Crocus heuffelianus Herb., J. Hort. Soc. 2: 273 (1847) [22]

Crocus heuffellianus is a spring synanthous geophyte (Figure 1). The plant is 12–25(–32) cm tall. The corm is ovate-rotundate, with a diameter of 1.2–2.4 cm; with tunics of parallel fibres, unclearly reticulated on the tip; and without separating basal rings. Prophylls are missing. Kataphylls are present, 2–3(–4), white. The leaves are 2–3, in bloom shorter than the flowers, prolonging later, 2.8–4.4 mm wide. Bracts are present. Bracteoles are not present. The flowers are 1–2. The colour of the perigone is violet to purple, rarely pale, as the perigone segments (tepals) have a V-shaped or heart-shaped spot on the tip. The throat is visibly pubescent inside. The filaments are white. The anthers are yellow with white connectives. The stigma is exerted above the anthers, reddish orange, divided into three spathulate with wide lobes, each one indistinctly toothed. The capsule is ellipsoid, 12–14 mm long, 7–10 mm wide. The seeds are rounded, reddish, 1.8–2.6 mm in diameter, with distinct margins and a slightly developed caruncle (Figure 2A).
The key parameters, compared with those of C. tommasinianus and C. veluchensis, are shown in Table 1. The species is morphologically similar to C. vernus. The key parameters for distinguishing C. heuffelianus from C. vernus are compared with the Bulgarian populations in Table 2.

2.2. Distribution and Habitats

Three localities of C. heuffelianus were observed, all in the Pirin Mountains (north) floristic region (Figure 3). The populations share the same distribution as C. veluchensis, but they remain intact. Mixed populations of these two species were not found. The populations were found in temporary or often humid meadows and open places, or on the borders of beach and pine forests, where there is a seasonal dominant of the early spring vegetation with a projective covering of between 3 and 5% (Figure 4). The first locality was found on the urbanized margin of the town of Bansko. The habitat was open land, a former forest of Pinus sylvestris. The other two localities were found on wet meadows in mixed forests of Fagus sylvatica and Pinus sylvestris. The registered accompanying species were: Crocus chrysantus Herbert (Herbert), Scila bifolia L., Ficaria verna Huds., Alchemilla sp., Achillea sp., Erythronium dens-canis, Viola sp., Sanicula europaea L., Corydalis sp., Oxalis acetosella L., Gagea reticulata (Pall.) Schult. & Schult. f. mosses, and grasses of Poaceae in an early phase.
The localities where C. heuffelianus occurred were outside the territory of the Pirin National Park, on unprotected land. The population in Bansko was on the territory of the town, on one of the former meadows still without building activities. The other two localities were on the bank of the Desilitsa River, under slight anthropogenic pressure (namely roads and extensive tourism).

2.3. Leaf Anatomy

The anatomical features of C. heuffelianus from the evaluated populations are presented in Table 3.
The cross-sections of the leaves of C. heuffelianus, C. tommasinianus, and C. veluchensis showed distinguishable bifacial profiles (Figure 5). The typical white stripe in Crocus (lacuna area) has a different ratio to leaf width. The ratio between the white stripe and the section width is 1/5 in C. tommasinianus and 1/4 in C. heuffelianus and C. veluchensis.
The keel of C. heuffelianus is almost rectangular. The widest vascular bundles are concentrated on the keel base. The keel base has almost straight angles, without ribs (Figure 6). This makes the white stripe wider than the keel base.
The parenchyma of the shoulders is uniform in the three species, with a slight difference in the rows of cells in the palisade area. Most of the sections of C. tommasinianus show one row of palisade parenchyma, rarely with a second layer with shorter cells. The palisade parenchyma of both C. heuffelianus and C. veluhensis has two layers of cells, rarely only one. The spongy parenchyma does not show any differences.
The count of the vascular bundles varies between 21 and 27, and does not show notable differences. The difference is in the ratio between the large vascular bundles (Figure 7). The vascular bundles are collateral, situated on one layer. The larger bundles of C. heuffelianus are four: two at the edges (terminal) and two at the keel (the largest). Crocus veluchensis has six larger vascular bundles: two terminal bundles, two on the bottom of the keel, and two at the blade near the lacuna area (the corner bundles). Similar is the ratio of the vascular bundles in C. tommasinianus, but not as clearly visible, and sometimes with larger bundles in the blade. According to the broadest bundles in the cross-section, C. veluchensis has the largest terminal vascular bundles, and this size is due to the larger cap of sclerenchyma. Crocus heuffelianus has the smallest terminal vascular bundles, according to the maximum size in the cross-section. The corner vascular bundle is 20% of the maximum in C. heuffelianus, as the other species have a higher value of this characteristic (Table 3, Figure 8).
The stomata are of the anomocyte type [13], arranged on the abaxial surface of the leaf blade and both lateral sides of the keel. The three species have sporadic single stomata on the adaxial epidermis. The three examined species have similar stomatal indexes. The major difference is in the shape of the cells of the abaxial epidermis (Figure 9). Those of C. tommasinianus have wavy borders, while the other species have straight cell borders.

2.4. ITS1/2 Region and Phylogenetic Tree

The alignment of the ITS1/2 regions of the evaluated species showed significant differences between C. heuffelianus and C. veluschensis, and similarities to the samples of both taxa found in the NCBI Nucleotide database (Table A1). The difference between the collected samples is visible, e.g., the big gaps in ITS1/2 in the group of C. heuffelianus (Figure A1: positions 33, 37, 397, 481, 503, and 530), as are the other evaluated samples, following the accepted taxonomy. The difference between C. heuffelianus and C. tommasinianus is visible as point replacements (Figure A1): the transitions G/A (positions 33, 37) and T/C (position 116), and the transversion T/A (position 439).
The phylogenetic tree (Figure 10) follows the phylogeny published before [20,21]. The samples of ser. Verni are grouped in their clade, as are the samples of C. veluchensis collected in the neighbourhood with C. heuffelianus (SOA 063356, Figure 10, OQ920186), which are grouped in another one. While the branch of C. agg. sieberii contains unconstrained samples of C. veluchensis, our samples of this species remain grouped in a subclade, which also contains the sequence of a sample from Hungary (HE801155). The rest of the sequences are grouped in the clade of C. sieberii, which also contains C. rujanensis, C. atticus, C. dalmaticus, and C. robertianus.

3. Discussion

The morphological features of the Bulgarian specimens coincide with the morphological data for C. heuffelianus [1], except for the pubescence mark on the perigonal tube. By this parameter, our samples match the Balkan populations of C. cf. heuffelianus [19].
The corm tunics of the three species are fibrous, without detaching rings, and with unclear interweaving at the tips. The heart-shaped purple spot on the tepal tips is a key morphological feature of C. heuffelianus. The quantitative differences between the tepal sizes are not discrete, but the largest tepals are those of C. heuffelianus (33–58 × 7–8 mm), followed by C. veluchensis (18–55 × 6–7 mm), and C. tommasinianus (22–43 × 6–7 mm).
A significant feature is the lack of bracteoles and the presence of a bract in Verni, as well as the fact that C. veluchensis has bracteoles but no bracts. The tinted tepal tip is a constant feature in the observed populations. Despite the data for a smooth perigone throat in C. heuffelianus [6,10], the collected plants from Bulgaria have pubescent throats, supporting the idea that the Balkan populations of C. heuffelianus have pubescent throats [20]. The shape of the stylodia is another significant difference between C. heuffelianus and C. tommasinianus (Figure 11).
The size of the fruit capsules in the evaluated species is too variable (Table 1). Therefore, they do not have a high diagnostic value.
Although seed morphology is highlighted as a diagnostic feature in Crocus taxonomy [23], information is available in the literature [24] for a small number of taxa. The difficulties are connected with the fact that the ripening of the seeds is between 3 and 5 months after the bloom [25], and that is why the collection in natural populations is difficult. Therefore, we have carefully obtained them from planted specimens. The seed macromorphology, sculpture, and ornamentation in C. heuffelianus, C. tommasinianus, and C. veluchensis (Figure 2) show clear differentiation by groups. The caruncle of C. veluchensis is over 1 mm, while those of C. heuffelianus and C. tommasinianus are visibly smaller, up to 0.5 mm. This corresponds with the position of C. heuffelianus in the section Verni together with C. tommasinianus, and the outstanding position of C. veluchensis.
The anatomical diagnostic features of C. veluchensis are the thicker spongy parenchyma, narrower white stripe, lack of hairs on the keel, and bigger terminal vascular bundles. These parameters, together with the height of the keel, are bigger in the leaves of C. heuffelianus, as noted in the populations from Serbia [18]. The epidermis of C. tommasinianus stands out with clearly undulating tangential walls, while the cell walls of C. heuffelianus and C. veluchensis are straight or slightly undulating (Figure 9). The count of the stomata on the abaxial epidermis variates between 200 and 400 per mm2. Their sizes are similar—about 20 × 31 μm, making these characteristics unreliable for taxonomic purposes.
A commonly used characteristic is the width of the white stripe running axillary along the central part of the leaf as a ratio to the diameter of the leaf [25]. This ratio in the samples of C. tommasinianus is 1/5, while in C. veluchensis and C. heuffelianus it is 1/4. More exact differences could be seen in the ratio between the white stripe and the base of the keel. The stripe of C. heuffelianus is usually wider than the keel, as the white stripes of C. veluchensis and C. tommasinianus take up 80% (4/5) of the width of the keel.
Another important difference is the shape of the keel (Figure 6). The keel of C. heuffelianus is almost rectangular. In comparison, the keel of C. tommasinianus has two thin ribs on the bottom. The two species above have keels with a straight base. In contrast, the keel of C. veluchensis is widely arcuate, with a central vascular bundle placed in the curve. The keel angles of C. heuffelianus and C. tommasinianus are covered with papillae, which can be seen on the whole surface of the leaf, just as the keel angles of C. veluchensis look without papillae.
The total number of vascular bundles in a cross-section could be a significant taxonomic feature [14]. The number of vascular bundles in C. heuffelianus varies more (19–42) than in C. tommasinianus (20–25) and C. veluchensis (21–28). Despite the wider variation in C. heuffelianus, this parameter could not be used as a single criterion. Combined with ratios of the major vascular bundles (terminal, keel, and corner towards the larger size), it could set a usable way to recognize C. heuffelianus (average 49%, 78%, 16%), C. tommasinianus (71%, 80%, 39%), and C. veluchensis (64%, 37%, 37%). This fact demonstrates the close relationship between both taxa. According to the literature [1], these species are very different in morphology and karyology. The collected samples from Bulgaria are in agreement with the description of C. heuffelianus (Table 2). An exception is the indumentum of the throat, as noticed in all Balkan populations of this species [18,19].
The major features in the ITS1/2 regions of the evaluated species are the types of conservative nucleotide differences. The species Ser. Verni can be recognized by only three mutation points in the evaluated part of the ITS1/2 region: two constant transitions and one transversion. The ITS sequences of the collected samples are identical to the ITS sequence of a specimen with origins in the Western Balkans. Additionally, the aligned sequence regions of all samples of C. heuffelianus are completely identical to those of C. vernus, as noticed before [3].
Currently, there is no information regarding the chromosome number of the Bulgarian populations of C. heuffelianus. According to the morphology, leaf profile, and ITS similarity with C. vernus, the observed specimens are similar to those described as tetraploid C. cf. heuffelianus from the Western Balkans [3], and suggest an expansion of the populations of this taxon to the southeast could be inferred.
The evolutional events (substitutions, insertions, and deletions) between Ser. Verni and our samples of C. veluchensis are illustrated by big gaps in the sequences. The lack of such evolutionary events inside ser. Verni illustrates the close relationship between C. heuffelianus, C. vernus, and C. tommasinianus. They are young taxa with a common ancestor, and C. veluchensis is not their sister taxon.
The phylogenetic tree (Figure 10) confirms the phylogeny published before [20,21]. It also proves the presence of C. heuffelianus sensu lato in the flora of Bulgaria. Following the reason above, the members of Ser. Verni are grouped in a single branch, as are the samples of C. veluchensis. All samples of C. veluchensis from Bulgaria have almost identical ITS1/2 sequences with that of a referent specimen from Hungary. The other samples, annotated as C. veluchensis, stand in another branch.
The evaluated taxon is new to the country, and is morphologically close to the description of C. heuffelianus sensu lato. The species have been neglected because of the visual similarity with C. veluchensis, and the insufficient investigations in the genus Crocus in Bulgaria.
Given the presence of polyploidy in ser. Verni, further studies of Bulgarian representatives should be focused on karyological aspects, namely chromosome number and genome size.

4. Materials and Methods

4.1. Evaluated Specimens

The study was based on fresh individuals collected from Bulgaria: three populations of C. heuffelianis, one of C. tommasinianus, and eight of C. veluchensis. Crocus tommasinianus is protected by Bulgarian environmental law. In this case, the plants were collected after permission from the Bulgarian Ministry of Environment and Water (authorization 871/24.04.2021). For comparative specimens, plant materials were used from the herbaria SOA (Agricultural University, Plovdiv) and SOM (Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Science), as well as high-resolution images from foreign herbaria downloaded from GBIF.org [26,27,28,29,30,31,32]. The distribution map of Bulgarian specimens (Figure A1) was built using QGIS [33] on a layer from http://openstreetmap.org (accessed on 8 November 2022).
The morphological analysis was made on 30 fresh individuals of C. heuffelianus, compared with fresh and dry specimens of C. tommasinianus and C. veluchensis. The metric values were measured using a calliper. The images of seeds and small parts were photographed using a stereomicroscope (Leica EZ4W).
The fresh specimens collected in this study are represented below by floristic region (subregion in brackets), MGRS square, locality description, decimal coordinates (if available), altitude, date (collectors), herbarium acronym [34], and specimen numbers. All evaluated specimens are described in Appendix B. The compared specimens from images are cited with their origin databases.
Crocus heuffelianus
BULGARIA: Pirin (North): 34TGM03: Bansko, 1020 m, N41.821668 E23.476085, 2023-03-06 (G. Gerdjikov) SOA 063340; 1018 m, N41.82177 E23.47616, 2023-03-16 (coll. T.Raycheva and K.Stoyanov) SOA 063342 (GenBank OQ918262); 34TGM13: Between Dobrinishte and the hut Goce Delchev, on the bank of Desilitsa River, 1000 m, N41.796684 E23.567387, 2023-03-17 (coll. Ts. Raycheva and K. Stoyanov) SOA 063351 (GenBank OQ918261); 34TGM12: Between Dobrinishte and the hut Goce Delchev, under Mogilata Peak, 1015 m, N41.78486 E23.55544, 2023-03-17 (coll. T.Raycheva and K.Stoyanov) SOA 063348 (GenBank OQ918260).
Crocus veluchensis
BULGARIA: Stara Planina (Central): 35TLH03: Beklemeto Narrow, 1440 m, N42.767 E24.611, 2022-04-12 (coll. T. Raycheva and K. Stoyanov) SOA 063262;35TLH04: Beklemeto Narrow, 1270 m, N42.79673 E24.62651; 2019-04-04 (coll. N. Trifonov) SOA 062631; 35TLH53: Ispolin Peak, 1523 m, N42.7386111 E25.2522222, 2018-04-05 (coll. Y. Marinov) SOA 062486; Vitosha region: 34TFN81: above Akademika sport base, under Skoparnika Peak, 1905 m, N42.54838 E23.31165, 2018-04-21 (coll. K. Stoyanov) SOA 062475; under Trite Komini peak, 2223 m, N42.55867 E23.28389, 2019-06-10 (coll. K. Stoyanov) SOA 063121; 34TFN91: above the panoramic path, 1080 m, N42.60176 E23.3234, 2019-04-11 (coll. K. Stoyanov) SOA 062632; Pirin (North): 34TFM92: 34TFM93: Betolovoto locality, on the bank of Byala Reka, 1112 m, N41.84798 E23.39011, 2021-06-26 (coll. T. Raycheva and K. Stoyanov) SOA 063230, 2022-03-29 (coll. Ts. Raycheva and K. Stoyanov) SOA 063259; 34TFM94: Predela Narrow, 1054 m, N41.892357 E23.330803, 2023-03-17 (coll. T. Raycheva and K. Stoyanov) SOA 063350; 34TGM12: Between Dobrinishte and the hut Goce Delchev, under Mogilata Peak, 1015 m, N41.781837 E23.549747, 2023-03-17 (coll. T.Raycheva and K. Stoyanov) SOA 063356 (GenBank OQ920186); Rhodopi Mts. (West): 34TGM35: Artificial pine forest between Sveta Petka and Yundola, 1327 m, N42.046604 E23.869862, 2022-03-27 (coll. T. Raycheva and K. Stoyanov) SOA 063260; Open places over Avramovo Railway Station, 1270 m, N42.03593 E23.81844, 2023-03-16 (coll. T. Raycheva and K. Stoyanov) SOA 063341, 063343; 34TGM36. Meadows around Yundola, 1091 m, N42.0638889 E23.8475, 2022-04-22 (coll. T.Raycheva and K. Stoyanov) SOA 063228 (GenBank OQ920187); 35TKG84: Wet meadow between Ravnogor and Atolouka localities, 1354 m, N41.9578778 E24.3486111, 2020-06-19 (coll. T. Raycheva and K. Stoyanov) SOA 063208; Rhodopi Mts. (Central): 35TKG94: Around Vurkhovrukh Hut, 1980-04-26 (coll. M. Popova) SOA 041385; 1982-04-17 (coll. M. Popova) SOA 039223, 039833; 1488 m, N41.9611667 E24.5338889, 2019-03-24 (coll. T. Raycheva) SOA 062589 (GenBank OQ920183); 35TKG95: Between Peroushtitsa and Skobelevo, 960 m, N42.0162778 E24.5505833, 2019-03-24 (coll. T. Raycheva) SOA 062584 (GenBank OQ920184); 812 m, N42.02534 E24.54629, 2019-03-24 (coll. T. Raycheva) SOA 062588; 2020-04-19 (coll. T. Raycheva) SOA 062784; 35TLG04: the road to Stoudenets, N41.96896 E24.68819, 1420 m, 2019-04-11 (coll. G. Karaycheva and T. Raycheva) SOA 062634, 062635; 35TLG05: Boykovo, in the village, N42.00169 E24.62325, 1086 m, 2018-04-01 (coll. K. Stoyanov) SOA 062482; Around the Zdravets hut, 1185 m, N42.0041667 E24.6930556, 2018-03-10 (coll. Ts. Raycheva) SOA 062485 (GenBank OQ920185); 35TLG11: Rozhen narrow, 1425 m, N41.67148 E24.72673, 2021-06-11 (coll. T. Raycheva and K. Stoyanov) SOA 063158; Momchilovtsi 2022-04-06 (coll. V. Trifonov) SOA 063257.
Crocus tommasinianus
BULGARIA: Forebalkan (West): 34TFP14: Darkov-Dol locality, 378 m, N43.78833 E22.41325, 2020-03-13 (coll. T. Raycheva, K. Stoyanov and K. Uzundzhalieva) SOA 062847; 34TFP34: Yonov-Bair hill, 348 m, N43.76794 E22.72396, 2020-03-13 (coll. T. Raycheva, K. Stoyanov and K. Uzundzhalieva) SOA 062849; 34TFP15: Vagleshtarnika locality, 377 m, N43.80896 E22.39386, 2020-02-29 (coll. T. Raycheva, K. Stoyanov and K. Uzundzhalieva) SOA 062848.

4.2. Anatomical Investigations

Quantitative measurements and observations of qualitative features of fresh samples for the morphological analyses were conducted. To examine the leaf anatomy, 10 individuals per population, from 3 populations in total, were collected during the flowering time and conserved in 75% ethanol. Transverse cross-sections and epidermal areas of leaves from each individual were manually constructed from the middle part. The epidermis was peeled using a surgical scalpel. The microscopic slides were fixed with glycerine. The snapshots of the microscope slides were taken using the Leica 750 and Motic Panthera digital microscopes, while the measurements of the characters were completed using Micam 2.4 software [35]. The 24 anatomical features included section width and height, arm length, white stripe width, the number and size of vascular bundles, palisade tissue height, the height and width of palisade and spongy cells, and the height and width of the adaxial and abaxial epidermal cells. Abaxial epidermal cells, including the size of the stomata, were measured in the area of the stomatal rows (between the ribs). The values were expressed through the basic statistical parameters: mean, standard deviation, maximum, and minimum.

4.3. Molecular Methods

The plant genomic DNA was purified as described using the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany), as described earlier [36].
The quality of the resulting DNA was assessed spectrophotometrically, using the Epoch™ Microplate Spectrophotometer, Agilent Technologies, Santa Clara, CA, USA, and DNA integrity was evaluated by 1% agarose gel electrophoresis.
The DNA fragment encoding for the ITS1–5.8S rDNA–ITS2 cluster was amplified using the following primers: ITS-A (5′–GGAAGGA-GAAGTCGTAACAAGG–3′) and ITS-B (5′–CTTTTCCTCCGCTTATTGATATG–3′) [37,38]. The reactions, set in a final volume of 50 μL contained 1x reaction buffer, 200 μM of dNTPs, 0.2 μM of each primer, 100 ng of genomic DNA, and one unit of Q5 High Fidelity DNA polymerase (New England Biolabs). The PCR amplification was conducted under the following parameters: initial denaturation at 94 °C for 45 s, followed by 30 cycles at 94 °C for 10 s for denaturation, 10 s at 62 °C for primer annealing, 30 s at 72 °C for primer extension, and a final elongation step of 2 min at 72 °C. Amplified PCR products were separated by 0.8% agarose gel electrophoresis, excised from the gel, and purified using a QIAquick Gel Extraction Kit (QIAGEN). The purified DNA fragments were bidirectionally sequenced in a Eurofins facility. All evaluated ITS sequences from Crocus heuffelianus, C. veluchensis and other referent species are described in Appendix A.

4.4. Phylogenetic Analysis

The obtained nucleotide sequences were blasted against those from the NCBI Nucleotide database [39,40]. The best hits were downloaded and used for phylogenetic analysis. The alignment of the sequences was achieved using ClustalW multiple alignments [41]. The result of the alignment was visualized in Figure A1 using the CLC Sequence Viewer [42]. The phylogenetic analysis was conducted using Bayesian phylogenetic inference with Mr Bayes 3.2 [43]. The parameters of the analysis were the same as described by Harpke et al. [21]: 2 × 4 chains for two million generations, nuclear data set ΓTP + G + I, sampling tree per 1000 generations, two independent runs. The result was visualized as a tree using TreeGraph 2 [44]. The analysis included 31 nucleotide sequences, cited as numbers of GenBank entries in the phylogenetic tree (Figure 10, Table A1). We accepted the series Crocus for the outgroup.

Author Contributions

Conceptualization, K.S. and T.R.; methodology, T.R, K.S., E.A.-K. and S.N.; validation, T.R., K.S. and E.A.-K.; formal analysis, T.R., K.S., E.A.-K. and S.N.; investigation, T.R., K.S. and E.A.-K.; resources, T.R., K.S., E.A.-K. and S.N.; data curation, K.S.; writing—original draft preparation, T.R., K.S., E.A.-K. and S.N.; writing—review and editing, T.R., K.S., E.A.-K. and S.N.; visualization, K.S. and T.R.; supervision, T.R.; project administration, T.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Bulgarian National Science Fund, grant number KP-06-N31/5.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Acknowledgments

We express our gratitude to Rossen Vassilev and Georgi Gerdzhikov for providing the first materials (SOA 063340) with precise coordinates, and thus provoking our research.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Appendix A

Figure A1. Alignment of the evaluated ITS sequences from Crocus heuffelianus, C. veluchensis and other referent species: visualization [42].
Figure A1. Alignment of the evaluated ITS sequences from Crocus heuffelianus, C. veluchensis and other referent species: visualization [42].
Plants 12 02420 g0a1aPlants 12 02420 g0a1b
Table A1. Referent sequences used in the phylogenetic analysis.
Table A1. Referent sequences used in the phylogenetic analysis.
TaxonGenBank EntryVoucher
Specimen
OriginAuthors
Publication
C. heuffelianusHG518176BEOU:31682 Harpke et al. 2014. [22]
C. vernusHE801156GAT:7402 Harpke et al. 2013 [21]
C. vernusAM503892 ItalyLi et al. 2008 [45]
Crocus tommasinianusHG518178 BEOU:31679 Harpke et al. 2014. [22]
Crocus tommasinianusHG518177 BEOU:31678 Harpke et al. 2014 [22]
Crocus kosaniniiHE801169GAT:7258SerbiaHarpke et al. 2013 [21]
Crocus kosaniniiHG518189BEOU:31680 Harpke et al. 2014 [22]
Crocus malyiHE801170GAT:7259CroatiaHarpke et al. 2013 [21]
Crocus banaticusHE801147GAT:7285RomaniaHarpke et al. 2013 [21]
Crocus scardicusHE663961B:10 0112048North MacedoniaHarpke et al. 2013 [21]
Crocus veluchensisHE801155GAT:7400HungaryHarpke et al. 2013 [21]
Crocus jablanicensisLT222443GAT34711 Miljkovic et al. 2016 [46]
Crocus cvijiciiLT222444GAT34710 Miljkovic et al. 2016 [46]
Crocus sieberiHE663966GAT:7265GreeceHarpke et al. 2013 [21]
Crocus rujanensisLT222441GAT230022 Miljkovic et al. 2016 [46]
Crocus veluchensisLT222436GAT s.n. Miljkovic et al. 2016 [46]
Crocus veluchensisLT222437GAT s.n. Miljkovic et al. 2016 [46]
Crocus veluchensisLT222438GAT s.n. Miljkovic et al. 2016 [46]
Crocus atticusLT222442GAT s.n. Miljkovic et al. 2016 [46]
Crocus veluchensisLT222440GAT s.n. Miljkovic et al. 2016 [46]
Crocus veluchensisLT222439GAT s.n. Miljkovic et al. 2016 [46]
Crocus dalmaticusHE801137GAT:7253CroatiaHarpke et al. 2013 [21]
Crocus sieberi subsp. sublimisHE663963GAT:7266GreeceHarpke et al. 2013 [21]
Crocus robertianusHE801134GAT:7231GreeceHarpke et al. 2013 [21]
Crocus sieberi subsp. nivalisHE801158GAT:7409GreeceHarpke et al. 2013 [21]
Crocus pallasiiLS398402NisNorth MacedoniaHarpke, unpublished
Crocus pallasiiLS398400GAT47264UkraineHarpke, unpublished
Crocus pallasiiLS398401GAT47264UkraineHarpke, unpublished

Appendix B. Examined Voucher Specimens

Crocus heuffelianus
BULGARIA: Pirin (North): 34TGM03: Bansko, 1020 m, N41.821668 E23.476085, 2023-03-06 (coll. G. Gerdjikov) SOA 063340; 1018 m, N41.82177 E23.47616, 2023-03-16 (coll. T. Raycheva and K. Stoyanov) SOA 063342 (GenBank OQ918262); 34TGM13: Between Dobrinishte and the hut Goce Delchev, on the bank of Desilitsa River, 1000 m, N41.796684 E23.567387, 2023-03-17 (coll. Ts. Raycheva and K. Stoyanov) SOA 063351 (GenBank OQ918261); 34TGM12: Between Dobrinishte and the hut Goce Delchev, under Mogilata Peak, 1015 m, N41.78486 E23.55544, 2023-03-17 (coll. T.Raycheva and K.Stoyanov) SOA 063348 (GenBank OQ918260).
CROATIA: 1888-05-01 (coll. C.E. Correns) CHE003944 [27]
CZECHIA: 1928-04-02 (coll. V. Krist) BR0000033054414 [28], U.1342748 [26];
HUNGARY: 1907-04-13 (coll. B. Lanyi) UVMVT113139 [31]; 1975-03-13 (coll. D. Gotthard) P00041474 [27]
MOLDOVA: 1973-04-05 (coll. C. Dobrescu and I. Turcu) BR0000033054605 [28]
POLAND: 1929-04-29 (coll. L. Domaniewska) US 1658771 [29], BR0000033054490 [28]; 1957-04-06 (coll. A. Jasiewicz) US 233412 [29]
ROMANIA: 1923-03-18 (coll. A. Borza, I. Grintescu, E. Nyárády and C. Gürler) US 1272280 [29], BR0000033054476 [28]; 1923-04-05 (coll. E. Nyárády) US 1272283 [29]; 1965-03-22 (coll. M. Păun, Mariana Olaru, D. Cîrtu and Gh. Popescu) BR0000033054483 [28].
SLOVAKIA: 1929-05 (coll. J. Suza, V. Krist and R. Doležal) BR0000033054346 [28], U.1342749 [26]; 1935-04-13 (coll. L. Krajinicova) US 3222340; 1936-03-12 (coll. J. Zapletálek) US 1704898 [29]
SLOVENIA: 1928-04-02 (coll. V. Krist) US 1595253 [29].
UKRAINE: 1964-06-01 (coll. L.V. Denisova) BR0000033054346; MW0293823; 1966-06-15 (coll. Boyarintseva) MW0293825; 1958-06-08 (coll. V. Petrov) MW0293824; 1975-06-10 (coll. G.N. Ogureeva) MW0293822 [29]; 1953-04-30 MHA0011056, 1968-06-11 (coll. I. Krylova) MHA0011049; 1968-06-12 (coll. I. Krylova) MHA0011049; 1980-06-19 (coll. N.V. Trulevich) MHA0011051, MHA0011054; 1980-06-19 (coll. E.M. Egorova) MHA0011052, MHA0011053; 1986-04-02 (coll. M.I. Zagul’skiy) MHA0011048 [31].
Crocus tommasinianus
BULGARIA: Forebalkan (West): 34TFP14: Darkov-Dol locality, 378 m, N43.78833 E22.41325, 2020-03-13 (coll. T. Raycheva, K. Stoyanov, K. Uzundzhalieva) SOA 062847; 34TFP15: Vrushka-Chouka, 1969-04-06 (coll. M. Popova) SOA 025887; 1973-03-30 (coll. M. Popova) SOA 025888, 025889, 025890; 2000-03-25 (coll. R. Tsonev) SO 100704, Rakovitsa, 1979-03-29 (coll. M. Popova) SOA 036506, 038567, 036568; 1980-03-25 (coll. M. Popova) SOA 039467; 34TFP25: Poletkovtsi, 1958-03-00 (coll. P. Petrov) SO 21297;34TFP34: Yonov-Bair hill, 348 m, N43.76794 E22.72396, 2020-03-13 (coll. T. Raycheva, K. Stoyanov, K. Uzundzhalieva) SOA 062849; 34TFP15: Vagleshtarnika locality, 377 m, N43.80896 E22.39386, 2020-02-29 (coll. T. Raycheva, K. Stoyanov, K. Uzundzhalieva) SOA 062848.
SERBIA: 34TEP99: Deli Jovan 1989-03-15 (coll. B. Lapadatovic, rev. V. Ranđelović) SOM 147855, 1989-03-16 (coll. V. Sravnic rev. V. Ranđelović) SOM 147856.
Crocus veluchensis
BULGARIA: Stara Planina (West): 34TFN68: Under Kom Peak, 2016 m, 1968 (coll. M. Popova) SOA 025897; 34TFN77: Petrohan narrow, 1885-05-10 (coll. A. Yavashov) SOM 13963; 1903 (coll. I. Urumov) SOM 13927; 34TFP31: Chuprene, 2000-03-25 (coll. R. Tsonev) SO 100705; 34TGN08: Sokolets peak, 1939-04-16 SOM 13919; 1976-05-07 (coll. J. Cherneva) SOM 13307; 34TGN14: Mourgash peak, 1930-04-20 SOM 13957; Stara Planina (Central): 35TLH63: Buzloudja; 1930-04-13 (coll. A. Yurkovskiy) SOM 13937; 1923-08-06 (coll. D. Jordanov) SO 13397; 35TKH93: Rozino, 1897-03-25 (coll. G. Toshev and T. Georgiev) SO 13398; 35TLH03: Beklemeto Narrow, 1440 m, N42.767 E24.611, 2022-04-12 (coll. T. Raycheva and K. Stoyanov) SOA 063262;35TLH04: Beklemeto Narrow, 1270 m, N42.79673 E24.62651; 2019-04-04 (coll. N. Trifonov) SOA 062631; 35TLH13: Alpean pastures under Ambaritsa peak, 1895 (coll. I. Urumov) SOM 13940; 35TLH14: Smesite locality, Dolno Sahrane, 1986-04 (coll. M. Popova) SOA 045074; 35TLH22: Ravnets peak, 1898 (coll. I. Urumov) SOM 13915; 35TLH53: Ispolin Peak, 1523 m, N42.7386111 E25.2522222, 2018-04-05 (coll. Yulian Marinov) SOA 062486; Ouzana, 1899-04 (coll. I. Neicev) SO 13396, SOM 13916; 1900-04 (coll. I. Neicev) SO 13390; Sofia Region: Lyulin mt., 1930-04-06 (coll. F. Trifonov) SOM 13920, 13921; 1930-03-23 (coll. G. Trifonov) SOM 13923; Znepole Region: Milevska Mt., grass places NW of Treklyano, 1960-03-27 (coll. D. Jordanov and A. Yanev) SO 92289; 34TFN55: Dragoman 1923-04 (coll. I. Mrkvicka) SOM 13932; Vitosha Region: 1891-05-30 (coll. S. Georgiev) SO 13402, 1895 (coll. S. Georgiev) SO 13404; 1920-05-16 (coll. D. Jordanov) SO 13403; 1930-04 (coll. V. Stribrny) SOA 04291; 1911-04-15 (coll. T. Georgiev) 2258; 34TFN71: Foothills near Kladnitsa, 1915 (coll. N. Stoyanov) SOA 2251; 34TFN81: Yurushki grob locality, 1968-04-02 (coll. N. Vichodzevsky) SO 13419; Between Bistritsa and Aleko hut, 1970-04-05 (coll. M. Popova) SOA 025895; Zlatni Mostove locality, 1920-04-17 (coll. B. Akhtarov) SOM 13943; 1965-04-05 (coll. B. Kitanov) SO 13417; near Planinarska Pesen hut, 1972-04-12 (coll. F. Gerdanovsky and V. Naseva) SO 29540; Kouminite, 1963-06-19 (coll. A. Yanev) SO 30092; above Akademika sport base, under Skoparnika Peak, 1905 m, N42.54838 E23.31165, 2018-04-21 (coll. K. Stoyanov) SOA 062475; under Trite Komini peak, 2223 m, N42.55867 E23.28389, 2019-06-10 (coll. K. Stoyanov) SOA 063121; 1962-05-26 SOM 105894; Aleko hut, 1750 m, 1966-05-27 (coll. N. Minchev) SO 13418; Between Aleko hut and Koupena peak, 1981-05-23 (coll. D. Stoyanov) SO 90969; 34TFN82: Around Tintyava hut, 1951-03-25 (coll. N. Efremov and B. Kitanov) SO 13407, SOM 13930; The station of BAS, 1957-04-05 (coll. N. Vihodzevsky) SO 13409; Kopitoto peak, 1968-04-02 (coll. N. Vihodzevsky) SO 13412; Over Dragalevtsi, 1892-05-04 (coll. B. Davidov) SOM 13914; Vladaya, 1901-05 (coll. A. Drenovsky) SOM 13935; 34TFN91: above the panoramic path, 1080 m, N42.60176 E23.3234, 2019-04-11 (coll. K. Stoyanov) SOA 062632; Plana Mt., meadows above Kokalyane monastery, 1970-04-22 (coll. N. Vihodzevsky) SO 25826; West Frontier Mountains: 34TFM26: Osogovo Mt. toward Rouen peak, 1974-06 (coll. V. Dimitrov and B. Kitanov) SO 66302; 34TFM37: Osogovo Mt., 1895-07-01 (coll. D.Mihaylov) SO 13405; Osogovo, Stouden Kladenets hut, 2001-03-24 (coll. B. Sidjimova) SO 101337; Belasitsa Mt.: 34TFL88: Belasitsa supra urbem Petric, 1929 (coll. Jekoff) SOA 2259; Slavyanka Mt.: 1932-03-18 (coll. B. Akhtarov) SOM 13944; 34TFN82: Vladaya, 1902-06-20 (coll. I. Mrkvicka) SOM 13967; 34TGL28: 1600-1700 m, 1933-05-18 (coll. A.Drenovski) SO 82544, 82545, 1952-05-02 (coll. A. Drenovski) 107984; Alibotush -Tsarev Vrah, 1892-05-04 SOM 13914; 1933-05-25 SOM 13419; 1966-07-13 SOA 04300; 34TGL29: Paril, 1500 m, 1991-04-07 (coll. Pashaliev) SOM 151596; Pirin (South): 1915 (coll. I. Urumov) SOM 13954, 13912; between Popovi Livadi hut and Toupouvishka river, 1984-05-26 (coll. D. Stoyanov) SO 92539; 34TGM20: Popovi-Livadi locality, 1949-04-23 (coll. B.Kitanov) SOM 13959; 1986-04-02 (coll. Ts. Denchev) SOM 145055; Pirin (North): 34TFM92: Gergiitsa River, 1800 m, 1982-06-29 (coll. Ts. Denchev) SO 9345; Bayuvi-Dupki, 1975-06-21 (coll. N. Andreev) SOM 133299; 34TFM93: Betolovoto locality, on the bank of Byala Reka, 1112 m, N41.84798 E23.39011, 2021-06-26 (coll. T. Raycheva and K. Stoyanov) SOA 063230, 2022-03-29 (coll. Ts. Raycheva and K. Stoyanov) SOA 063259; Razlojki-Suhodol locality, 1958-07-04 (coll. H. Kochev and M. Kolev) SOM 99248; 34TFM94: Predela Narrow, 1959-04-06 (coll. B. Kitanov) SOM 103212; 1979-03-26 (coll. I. Cheschmedzhiev) SOA 034916; 1054 m, N41.892357 E23.330803, 2023-03-17 (coll. T. Raycheva and K. Stoyanov) SOA 063350; 34TGM02: near melting snows on the grassy places in Malak Kazan locality, 2970-06-12 (coll. S. Dimitrov and D. Delipavlov) SOA 050454; above Vihren hut, 1970-06-11 (coll. M. Popova) SOA 050453; 34TGM01: around Planinets, 1968-04-02 (coll. N. Vichodzevsky) SO 13411; over Begovitsa hut toward Pirin hut, 1982-06-16 (coll. D. Stoyanov) SO 90970; 34TGM02: Popovo Lake, 1949-04-23 (coll. B. Kitanov) SO 83711; under Bunderitsa hut, 1985-04-06 (coll. D. Stoyanov) SO 92701; Kazanite locality, 1935-07-12 (coll. D. Stoyanov) SO 92848; 34TGM10: Baba Peak, 1900 m, 1941-06-01 (coll. B. Kitanov) SO 93578; Meadows of Orelyak peak, 1982-06-10 (coll. D. Stoyanov) SO 90971; 34TGM12: Between Dobrinishte and the hut Goce Delchev, under Mogilata Peak, 1015 m, N41.781837 E23.549747, 2023-03-17 (coll. T. Raycheva and K. Stoyanov) SOA 063356 (OQ920186); Rila Mt.: 1929-06-22 (coll. B. Stefanov) SOA 2253; 1931-06-25 (coll. B. Stefanov) SOA 2250; 34TFM86: Musov Peak, 1932-05-29 (coll. N. Fenenko), SOM 13910; 34TFM95: Parangalitsa, 1500 m, 1932-04-09 (coll. N. Fenenko) SOM 13945, 13961; Parangalitsa Reserve, 1975-05-07 (coll. Bondev, Meshinev, Andreev) SOM 132244; 34TFM96: Brichebor, 1968-05-21 (coll. M. Vladimirova) SO 14886; Tsarev-Vrakh Peak, 2100-2300 m, 1932-05-29 (coll. N. Fenenko) SOM 13947, 13931, 13942, 13950, 13962; 34TFM97: the eastern slope of Kalbura peak over Malyovitsa hut, 2300 m, 1970-06-25 (coll. N. Vichodzevsky) SO 18301; Malyovitsa, 173-04-16 (coll. V. Krumov, N. Vichodzevsky) SO 82832; 1985-06-16 (coll. S. Tsoneva) SOM 144760; Razhdavitsa locality, 1970-06-24 (coll. N. Vichodzevsky) SO 18302; Belia—Ulej sub Eleni—Vrch, 2100 m, 1912-05-22 SOM 14243; 14244, 14251; 34TGM04: Around Razlog, 1964-03-27 (coll. D. Delipavlov) SOA 04295; 34TGM17: wet alpean meadow above Musalensko Lake, 2600 m, 1968-04-21 (coll. N. Vichodzevsky) SO 13410; 34TGM05: Semkovo, 1560 m, 1949-04-25 (coll. B. Kitanov) SOM 13960, 102764; 34TGM06: Zeleni Peak, 1912-05-25 (coll. B. Davidov) SOM 13934; 34TGM06: Ribni lakes, 2000 m, 1901-06-25 SOM 13949; 34TGM14: Belitsa, 1978-05-14 (coll. N. Andreev) SOM 137629; 34TGM17: Mousala Hut, 1959-06-27 (coll. N. Vichodzevsky) SOM 103214; Mousala Peak, 2900 m, 1957-07-04 (coll. I. Bondev) SOM 109100; 34TGM18: Borovets, 1915 (coll. Trifonov) SOM 13956; 1931-05-02 (coll. A. Toshev) SOM 13955; 1979-03-29 (coll. M. Popova) SOA 036570, 063571; Pashanitsa, 1050 m, 1909-05-20 (coll. D. Yordanov) SO 83712; 34TGM27: Kameniti Peak, 1915-07-01 (coll. B. Davidov) SOM 13922; Pashanitsa, 1909-03-20 (coll. B. Davidov) SOM 13924; 1909-05-21 (coll. B. Davidov) SOM 13951; Lukovitsa river, 1909-03-10 (coll. B. Davidov) SOM 13929; 34TGM29: Parchovitsa, 1910-04-04 (coll. B. Davidov) SOM 13933; 34TGM37: Belmeken, 2007-04-26 (coll. A. Vitkova) SOM 163515, 163516, 163517; Sredna Gora (West): 35TKH72. Near Pavel Deliradev hut, 1110 m, 1968-04-05 (M. Simeonovsky) SO 13413, 13414; 35TKH82: Over Koprivshtitsa, 1968-04-07 (coll. M. Simeonovski) SO 13416; 35TKH91. Around Buntovna hut, 1977-03-26 (coll. M. Popova) SOA 031153; 35TKH92: Over Bogdan hut, 1550 m, 1968-04-07 (coll. M. Simeonovsky) SO 13415; Rhodopi Mts. (West): 34TGM25: Yakoruda, 1904 (coll. I. Urumov) SOM 13928; 34TGM35: Artificial pine forest between veta Petka and Yundola, 1327 m, N42.046604 E23.869862, 2022-03-27 (coll. T. Raycheva and K. Stoyanov) SOA 063260; Open places over Avramovo Railway Station, 1270 m, N42.03593 E23.81844, 2023-03-16 (coll. T. Raycheva and K. Stoyanov) SOA 063341, 063343; 34TGM36. Yundola, 1912 (coll. I. Urumov) SOM 13938; Meadows around Yundola, 1091 m, N42.0638889 E23.8475, 2022-04-22 (coll. T.Raycheva and K. Stoyanov) SOA 063228 (GenBank OQ920187); 35TKG52: Sarnitsa, Ezeroto locality, 1964-04-02 (coll. S. Dimitrov) SOA 04296, 04297; 35TKG63: Beglika locality, 1955-07 SOA 19148; 1958-05-12 SOA 04380, 04381; 1960-02-28 (coll. M. Popova) SOA 050332, 050333, 050334; 1976-04-18 (coll. M. Popova) SOA 032955; 1991-04-07 (coll. M. Boyadzhiysky) SOM 142179; 35TKG64: Tzigov Chark locality, 1978-03-03 (coll. M. Popova) SOA 034902 034903, 034904; 35TKG83: Selcha, 1909 (coll. I. Urumov) SOM 13918, 13925; 13926; 35TKG84: Wet meadow between Ravnogor and Atolouka locality, 1354 m, N41.9578778 E24.3486111, 2020-06-19 (coll. T. Raycheva and K. Stoyanov) SOA 063208; Rhodopi Mts. (Central): 35TKG93: Golyam Persenk Peak, 1909-03 (coll. B. Kitanov) SOM 13941; 35TKG94: Around Vurkhovrukh Hut, 1980-04-26 (coll. M. Popova) SOA 041385; 1982-04-17 (coll. M. Popova) SOA 039223, 039833; 1488 m, N41.9611667 E24.5338889, 2019-03-24 (coll. T. Raycheva) SOA 062589 (GenBank OQ920183); 35TKG95: Between Peroushtitsa and Skobelevo, 960 m, N42.0162778 E24.5505833, 2019-03-24 (coll. T. Raycheva) SOA 062584 (GenBank OQ920184); 812 m, N42.02534 E24.54629, 2019-03-24 (coll. T. Raycheva) SOA 062588; 2020-04-19 (coll. T. Raycheva) SOA 062784; 35TLG00: Smolyan, 1971-04-09 (coll. S. Petkova) SO 30390; 35TLG01: Ardashla locality, 1973-05-26 (coll. M. Popova) SOA 029650; 35TLG02: Chepelare (coll. I. Urumov) SOA 2256; 1902-04-03 (coll. V. Iliev) SO 13400; 35TLG04: the road to Stoudenets, N41.96896 E24.68819, 1420 m, 2019-04-11 (coll. G. Karaycheva and T. Raycheva) SOA 062634, 062635; 35TLG05: Markovo, 1905-03 (coll. V. Stribrny) SOA 4290; above Hrabrino, 1965-04-03 (coll. I. Cheschmedzhiev) SOA 04298, 04299; Ravnishta hut, 1970-04-05 (coll. M. Popova) SOA 030153; Road between Boykovo and Ravnishta hut, 1970-05-02 (coll. M. Popova) SOA 025893, 025894; Boykovo, in the village, N42.00169 E24.62325, 1086 m, 2018-04-01 (coll. K. Stoyanov) SOA 062482; Between huts Zdravets and Komsomolkska, 1985-03-16 (coll. M. Popova) SOA 045620, 045640; Around Zdravets hut, 1968 (coll. M. Popova) SOA 025896, 1971-03-28 (coll. M. Popova) SOA 050746; 1971-03-29 (coll. M. Popova) SOA 050668, 050669, 050670, 050671, 050672; 1976-03-24 (coll. M. Popova) SOA 032587, 032603; 1185 m, N42.0041667 E24.6930556, 2018-03-10 (coll. Ts. Raycheva) SOA 062485 (GenBank OQ920185); Koprivkite locality, 1974-03-24 (coll. M. Popova) SOA 032604; 35TLG11: Rozhen narrow, 1425 m, N41.67148 E24.72673, 2021-06-11 (coll. T. Raycheva and K. Stoyanov) SOA 063158; Momchilovtsi 2022-04-06 (coll. V. Trifonov) SOA 063257; 35TLG15: Between the huts Zdravets and Rouen, 1971-03-28 (coll. M. Popova) SOA 050733, 050747; Under Rouen hut, 1968-03-24 (coll. M. Popova) SOA 050674, 050675; Kaleto locality, above Kouklen, 1970-02-20 (coll. S. Dimitrov) SOA 050659; Yavrovo, 1900-04 (coll. V. Stribrny); 35TLG24: Momina Skala locality, 1979-03-24 (coll. S. Dimitrov and M. Popova) SOA 036573; The slopes of Diva Voda peak above Bachkovo, 1928-02-19 (coll. N. Stoyanov) SOA 2255; in the area of Chervenata Stena reserve, 1979-03-18 (coll. M. Popova) SOA 042540; Dobrostan, 1915-03 (coll. V. Stribrny) SOM 13964; 35TLG31: Davidkovo, 1961-04-05 (coll. Shopova and Vichodzevsky) SO 46578;
GREECE: 34TEL20: Babchor, 1927-04-30 (coll. A. Popnikolov) SO 13392; 34TGL17: Falakro Mt., Hionotripa Peak, 1942-06-09 (coll. B. Kitanov) SO 13394;
NORTH MACEDONIA: 34TDM82: Soushitsa, 1972-03-01 (coll. A. Drenovsky) SO 30389; 34TEL57: Belovoditsa, 1917-04-10 (coll. T. Nikolov) SO 13390; 34TEL63 Nidje Planina, 1916-05-03 (coll. I. Mrkviscka) SOM 34TEL63; 34TEM61: Veles, 1916-05-03 (coll. I. Mrkvicka) SOM 13966;
SERBIA: 34TFN04: Crna Trava Mt., 1895-06-22 (coll. D. Mihaylov) SO 13391.

References

  1. Rukšāns, J. The World of Crocuses; Latvian Academy of Sciences: Riga, Latvia, 2017; p. 568. [Google Scholar]
  2. Mathew, B. The Crocus. A Revision of the Genus Crocus (Iridaceae); B.T. Batisford Ltd.: London, UK, 1982. [Google Scholar]
  3. Raca, I.; Blattner, F.R.; Waminal, N.E.; Kerndorff, H.; Ranđelović, V.; Harpke, D. Disentangling Crocus Series Verni and Its Polyploids. Biology 2023, 12, 303. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Ranđelović, N.; Hill, D.A.; Stamenković, V.; Ranđelović, V. A New Species of Crocus from Yugoslavia. Kew Mag. 1990, 7, 182–186. [Google Scholar]
  5. Ranđelović, N.; Ranđelović, V.; Hristovski, N. Crocus jablanicensis (Iridaceae), a new species from the Republic of Macedonia, Balkan Peninsula. Ann. Bot. Fenn. 2012, 49, 99–102. [Google Scholar] [CrossRef] [Scilit]
  6. Mosolygo, A.; Sramko, G.; Barabas, S.; Czegledi, L.; Javor, A.; Molnar, A.; Suranyi, G. Molecular genetic evidence for allotetraploid hybrid speciation in the genus Crocus L. (Iridaceae). Phytotaxa 2016, 258, 121–136. [Google Scholar] [CrossRef] [Scilit]
  7. Gjeta, E.; Hallac, B. Crocus heuffelianus Herb. and Goniolimon tataricum Boiss., two new species for the flora of Albania, distribution and ecology. In Proceedings of the Book of Abstracts of the 7th Balkan Botanical Congress, Novi Sad, Serbia, 10–14 September 2018. [Google Scholar]
  8. Peruzzi, L. Crocus heuffelianus (Iridaceae), a new record for the Italian flora. Phytotaxa 2016, 261, 291–294. [Google Scholar] [CrossRef] [Scilit]
  9. Brighton, C. Cytological problems in the genus Crocus (Iridaceae): I. Crocus vernus aggregate. Kew Bull. 1976, 31, 33–46. [Google Scholar] [CrossRef] [Scilit]
  10. Mihaly, A.; Kricfalusy, V. Population biology and ecology of Crocus heuffelianus Herb. (Iridaceae) in Ukraine. Linz. Biol. Beiträge 1997, 29, 641–681. [Google Scholar]
  11. Rudall, P.; Mathew, B. Leaf anatomy in Crocus (Iridaceae). Kew Bull. 1990, 45, 535–544. [Google Scholar] [CrossRef] [Scilit]
  12. Erol, O.; Küçüker, O. Leaf Anatomy of Some Endemic Crocus L. (Iridaceae) Taxa from Western Anatolia. Int. J. Bot. 2007, 3, 290–295. [Google Scholar] [CrossRef] [Scilit]
  13. Satıl, F.; Selvi, S. An anatomical and ecological study of some Crocus L. taxa (Iridaceae) from the west part of Turkey. Acta Bot. Croat. 2007, 66, 25–33. [Google Scholar]
  14. Candan, F. Comparative morphological and leaf anatomical investigations of Crocus flavus Weston from Turkey. Int. J. Agric. For. Fish. 2015, 3, 99–104. [Google Scholar]
  15. Kandemir, N. Comparative leaf anatomy of some endemic Crocus L. taxa from Turkey. Bangladesh J. Bot. 2010, 40, 155–162. [Google Scholar] [CrossRef] [Scilit]
  16. Kandemir, N.; Çelik, A.; Yayla, F. Comparative anatomic and ecologic investigation on some endemic Crocus taxa (Iridaceae) in Turkey. Pak. J. Bot. 2012, 44, 1065–1074. [Google Scholar]
  17. Coşkun, F.; Selvi, S.; Satıl, F. Phylogenetic relationships of some Turkish Crocus (Iridaceae) taxa based on morphological and anatomical characters. Turk. J. Bot. 2010, 34, 171–178. [Google Scholar] [CrossRef] [Scilit]
  18. Raca, I.; Ljubisavljević, I.; Jušković, M.; Ranđelović, N.; Ranđelović, V. Comparative anatomical study of the taxa from series Verni Mathew (Crocus L.) in Serbia. Biol. Nyssana 2017, 8, 15–22. [Google Scholar] [CrossRef]
  19. Raca, I.; Jovanovic, M.; Ljubisavljević, I.; Juskovic, M.; Ranđelović, V. Morphological and leaf anatomical variability of Crocus cf. heuffelianus Herb. (Iridaceae) populations from the different habitats of the Balkan Peninsula. Turk. J. Bot. 2019, 43, 645–658. [Google Scholar] [CrossRef] [Scilit]
  20. Harpke, D.; Meng, S.; Kerndorff, H.; Rutten, T.; Blattner, F.R. Phylogeny of Crocus (Iridaceae) based on one chloroplast and two nuclear loci: Ancient hybridization and chromosome number evolution. Mol. Phylogenetic. Evol. 2013, 66, 617–627. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Harpke, D.; Carta, A.; Tomović, G.; Ranđelović, V.; Ranđelović, N.; Blattner, F.R.; Peruzzi, L. Phylogeny, karyotype evolution and taxonomy of Crocus series Verni (Iridaceae). Plant Syst. Evol. 2014, 300, 309–325. [Google Scholar] [CrossRef] [Scilit]
  22. Herbert, W. A history of the species of Crocus. J. Hortic. Soc. Lond. 1847, 2, 273. Available online: https://www.biodiversitylibrary.org/item/148085#page/290/mode/1up (accessed on 5 May 2023).
  23. Maw, G. A synopsis of the genus Crocus. Gard. Chron. Wkly. Illus. J. Hortic. Allied Subj. 1881, 16, 367–368. Available online: https://www.biodiversitylibrary.org/item/84372#page/2/mode/1up (accessed on 5 May 2023).
  24. Karaismailoğlu, M.C.; Şik, L.; Gemicioğlu, A.; Erol, O. Seed structure of some taxa of the genus Crocus L. (Iridaceae) series Crocus. Turk. J. Bot. 2018, 42, 5. [Google Scholar] [CrossRef] [Scilit]
  25. Kerndorff, H.; Pasche, E.; Harpke, D. The Genus Crocus (Liliiflorae, Iridaceae): Lifecycle, Morphology, Phenotypic Characteristics, and Taxonomical Parameters. Stapfia 2015, 103, 27–65. [Google Scholar]
  26. Bijmoer, R.; Scherrenberg, M.; Creuwels, J. Naturalis Biodiversity Center (NL)—Botany. 2023. Available online: https://www.gbif.org/dataset/15f819bd-6612-4447-854b-14d12ee1022d (accessed on 21 May 2023).
  27. MNHN; Chagnoux, S. The Vascular Plants Collection (P) at the Herbarium of the Muséum National d’Histoire Naturelle (MNHN—Paris). Version 69.311. MNHN—Museum National d’Histoire Naturelle, 2023. Available online: https://www.gbif.org/fr/dataset/b5cdf794-8fa4-4a85-8b26-755d087bf531 (accessed on 21 May 2023).
  28. Meise Botanic Garden. Meise Botanic Garden Herbarium (BR). Version 1.29. Meise Botanic Garden, 2023. Available online: https://www.gbif.org/dataset/b740eaa0-0679-41dc-acb7-990d562dfa37 (accessed on 21 May 2023).
  29. Orrell, T.; Informatics Office. NMNH Extant Specimen Records (USNM, US). Version 1.68. National Museum of Natural History, Smithsonian Institution, 2023. Available online: https://www.gbif.org/dataset/821cc27a-e3bb-4bc5-ac34-89ada245069d (accessed on 21 May 2023).
  30. Seregin, A. Moscow University Herbarium (MW). Version 1.281. Lomonosov Moscow State University, 2023. Available online: https://www.gbif.org/dataset/902c8fe7-8f38-45b0-854e-c324fed36303 (accessed on 21 May 2023).
  31. Seregin, A.; Stepanova, N. MHA Herbarium: Collections of Vascular Plants. Version 1.188. Tsitsin Main Botanical Garden Russian Academy of Sciences, 2023. Available online: https://www.gbif.org/dataset/af5f680a-e0cc-46c8-b623-ceeaab70aa9e (accessed on 21 May 2023).
  32. The University of Vermont Pringle Herbarium. University of Vermont, Pringle Herbarium. 2023. Available online: https://www.gbif.org/dataset/e42c4be9-dc6d-466b-8df2-60ac8c47fadd (accessed on 21 May 2023).
  33. QGIS Version 3.28.1-Firenze. Available online: https://qgis.org/en/site/ (accessed on 10 December 2022).
  34. Index Herbariorum. Available online: https://sweetgum.nybg.org/science/ih/ (accessed on 14 April 2023).
  35. Van Westen, M. Micam 2.4. Available online: https://science4all.nl (accessed on 10 October 2019).
  36. Apostolova, E.; Raycheva, T.; Stoyanov, K.; Naimov, S. A study of Genetic Relationships of Crocus Taxa, Series Biflori (Iridaceae) from Bulgaria by ISSR Markers. Comptes Rendus L’académie Bulg. Sci. 2022, 75, 992–999. [Google Scholar] [CrossRef] [Scilit]
  37. Tirel, C.; Jérémie, J.; Lobreau-Callen, D. Corchorus neocaledonicus (Tiliaceae), véritable identité de l’’énigmatique Oceanopapaver. Bull. Muséum. Natl. D’histoire Nat. 1996, 18, 35–43. [Google Scholar]
  38. Raycheva, T.; Stoyanov, K.; Naimov, S.; Apostolova-Kuzova, E.; Marinov, Y. Crocus pallidus (Iridaceae)—A Neglected Species for the Bulgarian Flora and Critical Taxon in the Balkans. Plants 2022, 11, 686. [Google Scholar] [CrossRef] [Scilit]
  39. NCBI GenBank Nucleotide Database. Available online: https://www.ncbi.nlm.nih.gov/genbank/ (accessed on 10 January 2022).
  40. NCBI. Standard Nucleotide BLAST. Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 10 January 2022).
  41. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [Scilit]
  42. CLC Sequence Viewer 8.0, QIAGEN. Available online: https://clc-sequence-viewer.software.informer.com/8.0/ (accessed on 7 December 2021).
  43. Ronquist, F.; Teslenko, M.; Van der Mark, P.; Ayres, D.L.; Darling, A.; Hohna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [Scilit]
  44. Stöver, B.C.; Müller, K.F. TreeGraph 2: Combining and visualizing evidence from different phylogenetic analyses. BMC Bioinform. 2010, 11, 7. [Google Scholar] [CrossRef] [Scilit]
  45. Li, M.; Wunder, J.; Bissoli, G.; Scarponi, E.; Gazzani, S.; Barbaro, E.; Saedler, H.; Varotto, C. Development of COS genes as universally amplifiable markers for phylogenetic reconstructions of closely related plant species. J. Cladistics 2008, 24, 727–745. [Google Scholar] [CrossRef] [Scilit]
  46. Miljkovic, M.; Ranđelović, V.; Harpke, D. A new species of Crocus (Iridaceae) from southern Albania (SW Balkan Peninsula). Phytotaxa 2016, 265, 39–49. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Morphology of Crocus heuffelianus (SOA 063351, grid 1 mm): (A) whole plant; (B) stylodia; (C) anthers; (D) hairs of the throat; (E) capsule; (F) corm neck; (G) tunics.
Figure 1. Morphology of Crocus heuffelianus (SOA 063351, grid 1 mm): (A) whole plant; (B) stylodia; (C) anthers; (D) hairs of the throat; (E) capsule; (F) corm neck; (G) tunics.
Plants 12 02420 g001
Figure 2. Seeds of (A) Crocus heuffelianus, (B) C. tommasinianus and (C) C. veluchensis (grid 1 mm).
Figure 2. Seeds of (A) Crocus heuffelianus, (B) C. tommasinianus and (C) C. veluchensis (grid 1 mm).
Plants 12 02420 g002
Figure 3. Observations of Crocus heuffelianus and C. veluchensis and position of the localities of C. heuffelianus in Bulgaria (the red dot numbers are explained in the text).
Figure 3. Observations of Crocus heuffelianus and C. veluchensis and position of the localities of C. heuffelianus in Bulgaria (the red dot numbers are explained in the text).
Plants 12 02420 g003
Figure 4. Habitat and group of Crocus heuffelianus (SOA 063351).
Figure 4. Habitat and group of Crocus heuffelianus (SOA 063351).
Plants 12 02420 g004
Figure 5. Leaf sections of (A) Crocus heuffelianus, (B) C. tommasinianus and (C) C. veluchensis (objective 4x, scale 200 μm): ad—adaxial epidermis, ab—abaxial epidermis, la—lacuna area, ws—white stripe, tvb—terminal vascular bundles, kvb—keel vascular bundles, cvb—corner vascular bundles.
Figure 5. Leaf sections of (A) Crocus heuffelianus, (B) C. tommasinianus and (C) C. veluchensis (objective 4x, scale 200 μm): ad—adaxial epidermis, ab—abaxial epidermis, la—lacuna area, ws—white stripe, tvb—terminal vascular bundles, kvb—keel vascular bundles, cvb—corner vascular bundles.
Plants 12 02420 g005
Figure 6. Keel shape of (A) Crocus heuffelianus, (B) C. tommasinianus and (C) C. veluchensis (magnification 10×, scale 200 μm).
Figure 6. Keel shape of (A) Crocus heuffelianus, (B) C. tommasinianus and (C) C. veluchensis (magnification 10×, scale 200 μm).
Plants 12 02420 g006
Figure 7. Ratios between the commented parameters (minimum, maximum, average, and standard deviation) in C. heuffelianus (heu), C. veluchensis (vel) and C. tommasinianus (tom).
Figure 7. Ratios between the commented parameters (minimum, maximum, average, and standard deviation) in C. heuffelianus (heu), C. veluchensis (vel) and C. tommasinianus (tom).
Plants 12 02420 g007
Figure 8. Terminal vascular bundle in (A) Crocus heuffelianus, (B) C. tommasinianus, and (C) C. veluchensis (magnification 40×, scale 100 μm).
Figure 8. Terminal vascular bundle in (A) Crocus heuffelianus, (B) C. tommasinianus, and (C) C. veluchensis (magnification 40×, scale 100 μm).
Plants 12 02420 g008
Figure 9. Abaxial epidermis of (A) Crocus heuffelianus, (B) C. tommasinianus, and (C) C. veluchensis (magnification 40×, scale 100 μm).
Figure 9. Abaxial epidermis of (A) Crocus heuffelianus, (B) C. tommasinianus, and (C) C. veluchensis (magnification 40×, scale 100 μm).
Plants 12 02420 g009
Figure 10. Placement of Crocus heuffelianus in the phylogenetic tree, obtained from a Bayesian phylogenetic inference of the nuclear rDNA ITS regions using the methodology of Harpke et al. [20]. Posterior probabilities are designated by numbers. See Table A1 for details.
Figure 10. Placement of Crocus heuffelianus in the phylogenetic tree, obtained from a Bayesian phylogenetic inference of the nuclear rDNA ITS regions using the methodology of Harpke et al. [20]. Posterior probabilities are designated by numbers. See Table A1 for details.
Plants 12 02420 g010
Figure 11. Flowers of (A) C. heuffelianus, (B) C. tommasinianus, and (C) C. veluchensis.
Figure 11. Flowers of (A) C. heuffelianus, (B) C. tommasinianus, and (C) C. veluchensis.
Plants 12 02420 g011
Table 1. Morphological comparisons between the Bulgarian populations of C. heuffelianus, C. tommasinianus and C. veluchensis.
Table 1. Morphological comparisons between the Bulgarian populations of C. heuffelianus, C. tommasinianus and C. veluchensis.
CharactersC. heuffelianusC. tommasinianusC. veluchensis
Cormrounded, 12–24 mmrounded 10–15 mmrounded 10–20 mm
Tunicsparallel fibresparallel fibresparallel fibres
Bractspresentpresentmissing
Number of bracteolesmissingmissingpresent
Number of leaves2 (3)2 (3)3–4 (5)
Flower colourlavender purple, rarely pale, with a dark violet heart-shaped spot on the tippale purplelight to lavender blue, or dark purple
Perigone segments length/width33–58 × 9–25 mm22–43 × 12–18 mm18–55 × 5–20 mm
Perigone throatlilac to deep violet, pubescentpubescentpubescent
Filaments (mm)10–14 mm, white6–8 mm, white8–12 mm, white
Anthers (cm)18–22 mm10–14 mm12–18 mm
Style colouryellow to orangepale orangeyellow to orange
Style branched 3 spade-shaped lobes, exerted above the anthers3 thin lobes, under the level of the anthers3 spade-shaped lobes, exerted above the anthers
Capsule (mm)12–14 × 7–10 mm10–14 × 8–9 mm10–12 × 5–7 mm
Seed (mm)1.8–2.5 mm, slightly developed caruncle2.2–4 mm, slightly developed caruncle2.4–2.8 mm, big caruncle
Seed colourreddish brown reddish brown dark reddish to brown
Table 2. Morphological comparisons of the Bulgarian populations of C. heuffelianus with the morphological descriptions of C. heuffelianus and C. vernus from the literature [1].
Table 2. Morphological comparisons of the Bulgarian populations of C. heuffelianus with the morphological descriptions of C. heuffelianus and C. vernus from the literature [1].
CharactersC. vernus
(According to Rukšāns [1])
C. heuffelianus
(Bulgarian Specimens)
C. heuffelianus
(According to Rukšāns [1])
Tunic neckUp to 10 mm long, occasionally longer, somewhat bristly, formed by irregular prolonged fibres of the main tunicShort, 2–5 mm, formed by a bunch of tunic fibresShort, 2–3 mm long, formed by a bunch of tunic fibres
Perigone throatPubescent or hairy, mostly white, sometimes slightly shaded greyish or light violetLilac to deep violet, pubescentWhite, nude
Perigone segments size24–32 mm × 9–12 mm33–58 × 9–25 mm(23–)31–43(–55) mm × (7–)11–16(–22) mm
Outer segmentsPlain white or blue, or with a darker stripe, without a V-shaped blotchDarker than the inner, with a distinctly V-shaped blotchDarker than the inner, with a distinctly V-shaped blotch
Inner segmentsSometimes more stripedLighter than the outer,Lighter than the outer, more often emarginate
Filaments length(5-)7–10 mm10–14 mm12–14 mm
Anthers(5–)8–12 mm, as usual same length as the filaments10–14 mm12–16 mm, a little longer than the filaments
Style colourOrange to redYellow to orangeYellow to orange
Style lengthEnding deep within the anthers, rarely higher than the middle of the anthers and never equal to or overtopping themOvertopping or on the level of the anthers.Ending at the same level as the tips of the anthers to slightly overtopping them or well overtopping them
HabitatsShort mountain turf, near melting snowMeadows and open places in the forestsGrassy clearings between and near forests or sparse shrubs
Flowering timeIII–VIIII–IIIII–III(–IV)
Table 3. Comparisons between the leaf anatomical parameters in Crocus heuffelianus, C. veluchensis and C. tommasinianus.
Table 3. Comparisons between the leaf anatomical parameters in Crocus heuffelianus, C. veluchensis and C. tommasinianus.
CharacterC. heuffelianusC. veluchensisC. tommasinianus
Leaf width, μm2701–46451673–25462821–3369
3305 ± 4332121 ± 78.63042 ± 245.2
Keel height, μm562–1458505–1157691–979
1024 ± 170.1788 ± 45.6787 ± 120.8
Keel width, μm751–976615–1240553–894
890 ± 1817 ± 40.2793 ± 137
White stripe, μm836–1076303–899538–667
927 ± 55.9596 ± 48.5591 ± 64.1
White stripe/Section ratio, %19–3618–3415–23
29 ± 425 ± 2.520 ± 2.3
White stripe/Keel ratio, %87–13847–11560–98
105 ± 8.778 ± 7.276 ± 14.2
Leaf blade thickness, μm119–24381–24778–162
176.7 ± 34.7155 ± 28.6119.4 ± 24.6
Palisade parenchyma thickness, μm51–10528–10315–62
76 ± 14.265.7 ± 13.731.7 ± 14.8
Pallisade cell rows221
Palisade cells, height, μm29–6024–5119–31
43.1 ± 3.837.2 ± 524.8 ± 3.2
Spongy parenchyma thickness, μm10–9734–10642–88
58.3 ± 19.666.9 ± 27.456.9 ± 10.5
Adaxial epidermis cells length, μm147–766157–867322–562
360.3 ± 126.9434 ± 98.9422.8 ± 91.4
Adaxial epidermis cells width, μm13–319–41.412.2–23
21.5 ± 3.421.4 ± 3.817.9 ± 4.6
Adaxial epidermis cells height, μm12–3111–3215–21
23.1 ± 3.421.2 ± 2.717.3 ± 2.12
Abaxial epidermis cells length, μm32–25225–28278–265
109.4 ± 39.790 ± 33142 ± 42.5
Abaxial epidermis cells width, μm13–399–4616–25
24.3 ± 4.324.9 ± 4.920 ± 2.6
Abaxial epidermis cells height, μm14–2610–3110–21
18.2 ± 3.519.5 ± 3.415.5 ± 5.2
Stomata length, μm20–3720–4121–33
29.4 ± 3.630.1 ± 3.926.34 ± 3
Stomata width, μm15–3115–3315.4–25.2
22.8 ± 3.423 ± 2.620.1 ± 2.6
Stomata depth, μm6–145–219–11
9.1 ± 211 ± 2.29.2 ± 1.2
Stomata, count/mm2200–375200–400222–400
269.6 ± 59295.7 ± 34.9300.9 ± 48.5
All vascular bundles height, μm35–15821–26830–150
84.5 ± 34.286.3 ± 38.280.9 ± 35.1
Count of vascular bundles in section19–4220–2521–28
27.7 ± 13.222.8 ± 1.725.3 ± 3.1
All vascular bundles height, μm35–17717–15325–114
84.1 ± 33.958.3 ± 23.863.2 ± 24.4
All vascular bundles width, μm 29–10517–15325–114
60.4 ± 18.758.3 ± 23.863.2 ± 24.4
Vascular tissue height, μm10–11113–16814–92
47.5 ± 21.752.2 ± 20.351.6 ± 23.7
Vascular tissue width, μm19–8717–13821–74
47.6 ± 17.653.7 ± 21.251.6 ± 23.7
Vascular tissue section, μm2143–7585203–17,342230.9–4606.4
2029.6 ± 1652.22582.5 ± 1901.52239.3 ± 1484.4
Vascular tissues related to the vascular bundle section, %9–11218–8456–80
37.1 ± 16.644.9 ± 10.163.6 ± 10.8
Terminal vascular bundles, height, μm79–14973–181110–131
116.2 ± 18.6116.3 ± 13.2118.5 ± 9.6
Terminal vascular bundles, width, μm66–9050–16176–95
79.3 ± 6.491.6 ± 10.483.5 ± 8.2
Terminal vascular bundles, section, μm24768–9591203–22,3196912–9774
7285.3 ± 1355.68952.5 ± 2064.37802.3 ± 1325.3
Terminal vascular bundles related to the maximum size, %13–6936–9956–80
49.2 ± 11.470.5 ± 9.863.6 ± 10.8
Keel vascular bundles, height, μm118–17770–268123–150
140.6 ± 18150.9 ± 25.8136.5 ± 10.3
Keel vascular bundles, width, μm70–10547–17093–114
88.6 ± 10.2105 ± 13.8102.3 ± 8.3
Keel vascular bundles, section, μm27092–13,9012583–32,2043562.6–5112.9
9862.6 ± 2182.113,742.4 ± 3602.24547.5 ± 649.7
Keel vascular bundles, related to the maximum size, %58–10032–10029–42
77.8 ± 17.180.3 ± 1837.1 ± 5.3
Corner vascular bundles, height, μm44–8344–14884–104
43.6 ± 11.589.9 ± 14.991 ± 8
Corner vascular bundles, width, μm31–6638–10954–72
43.6 ± 15.774.7 ± 12.763.6 ± 7.4
Corner vascular bundles, section, μm21193–43021354–10,4043562–5112
2003.2 ± 911.45558 ± 17244547.5 ± 649.7
Corner vascular bundles, related to the maximum size, %9–319–6129–41
15.7 ± 739.1 ± 8.937.1 ± 5.3
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Raycheva, T.; Stoyanov, K.; Naimov, S.; Apostolova-Kuzova, E. Crocus heuffelianus—A New Species for the Bulgarian Flora from Series Verni (Iridaceae). Plants 2023, 12, 2420. https://doi.org/10.3390/plants12132420

AMA Style

Raycheva T, Stoyanov K, Naimov S, Apostolova-Kuzova E. Crocus heuffelianus—A New Species for the Bulgarian Flora from Series Verni (Iridaceae). Plants. 2023; 12(13):2420. https://doi.org/10.3390/plants12132420

Chicago/Turabian Style

Raycheva, Tsvetanka, Kiril Stoyanov, Samir Naimov, and Elena Apostolova-Kuzova. 2023. "Crocus heuffelianus—A New Species for the Bulgarian Flora from Series Verni (Iridaceae)" Plants 12, no. 13: 2420. https://doi.org/10.3390/plants12132420

APA Style

Raycheva, T., Stoyanov, K., Naimov, S., & Apostolova-Kuzova, E. (2023). Crocus heuffelianus—A New Species for the Bulgarian Flora from Series Verni (Iridaceae). Plants, 12(13), 2420. https://doi.org/10.3390/plants12132420

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop