Antiviral Activity of Biosynthesized Silver Nanoparticles from Pomegranate (Punica granatum L.) Peel Extract against Tobacco Mosaic Virus
Abstract
1. Introduction
2. Results and Discussion
2.1. Pomegranate Peel Extract Mediated Ag-NPs Preparation
2.2. Instrumental Characterization of Ag-NPs
2.3. Plant Growth under Greenhouse Conditions
2.4. Effect of Ag-NP Treatment on Oxidative Stress under TMV Challenge
2.5. Effect of Ag-NP Treatment on Antioxidant Activity under TMV Challenge
2.6. Effect of Ag-NP Treatment on Polyphenolic Contents under TMV Challenge
2.7. Effect of Ag-NP Treatment on TMV Particle Accumulation and Pathogenesis-Related (PR) Gene Expression
2.8. Effect of Ag-NP Treatment on Polyphenolic Gene Expression under TMV Challenge
3. Materials and Methods
3.1. Green Synthesis of Ag-NPs through Pomegranate Peel Extract
3.2. Instrumental Characterization of the Prepared Ag-NPs
3.3. TMV Source
3.4. Tomato Source and Propagation under Greenhouse Conditions
3.5. Ag-NP Application for TMV-Controlling under Greenhouse Cultivations
3.6. Effect of Ag-NP Treatment on Oxidative Stress under TMV Challenge
3.7. Effect of Ag-NP Treatment on Antioxidant Activity under TMV Challenge
3.7.1. The Free Radical Scavenging Activity Screening
3.7.2. Evaluation of Polyphenol Oxidase Activity
3.7.3. Evaluation of Superoxide Dismutase Activity
3.7.4. Evaluation of Peroxidase Activity
3.8. Effect of Ag-NP Treatment on Polyphenolic Contents under TMV Challenge
3.9. Effect of Ag-NP Treatment on Polyphenolic and Pathogenesis-Related (PR) Genes Expression under TMV Challenge
3.10. Data Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abdelkhalek, A.; Hafez, E. Plant Viral Diseases in Egypt and Their Control. In Cottage Industry of Biocontrol Agents and Their Applications; Springer: Berlin/Heidelberg, Germany, 2020; pp. 403–421. [Google Scholar]
- Sett, S.; Prasad, A.; Prasad, M. Resistance genes on the verge of plant–virus interaction. Trends Plant Sci. 2022, 27, 1242–1252. [Google Scholar] [CrossRef] [PubMed]
- Omar, A.Z.; Hamdy, E.; Hamed, E.A.; Hafez, E.; Abdelkhalek, A. The curative activity of some arylidene dihydropyrimidine hydrazone against Tobacco mosaic virus infestation. J. Saudi Chem. Soc. 2022, 26, 101504. [Google Scholar] [CrossRef]
- Creager, A.N.H.; Scholthof, K.-B.G.; Citovsky, V.; Scholthof, H.B. Tobacco mosaic virus: Pioneering research for a century. Plant Cell 1999, 11, 301–308. [Google Scholar] [CrossRef] [PubMed]
- McDaniel, L.; Maratos, M.; Farabaugh, J. Infection of plants by tobacco mosaic virus. Am. Biol. Teach. 1998, 60, 434–439. [Google Scholar] [CrossRef]
- Peng, J.; Song, K.; Zhu, H.; Kong, W.; Liu, F.; Shen, T.; He, Y. Fast detection of tobacco mosaic virus infected tobacco using laser-induced breakdown spectroscopy. Sci. Rep. 2017, 7, 44551. [Google Scholar] [CrossRef]
- Scholthof, K.G.; Adkins, S.; Czosnek, H.; Palukaitis, P.; Jacquot, E.; Hohn, T.; Hohn, B.; Saunders, K.; Candresse, T.; Ahlquist, P. Top 10 plant viruses in molecular plant pathology. Mol. Plant Pathol. 2011, 12, 938–954. [Google Scholar] [CrossRef]
- Zhang, X.-N.; Liao, Y.-W.-K.; Wang, X.-R.; Zhang, L.; Ahammed, G.J.; Li, Q.-Y.; Li, X. Epigallocatechin-3-gallate enhances tomato resistance to tobacco mosaic virus by modulating RBOH1-dependent H2O2 signaling. Plant Physiol. Biochem. 2020, 150, 263–269. [Google Scholar] [CrossRef]
- Alengebawy, A.; Abdelkhalek, S.T.; Qureshi, S.R.; Wang, M.-Q. Heavy Metals and Pesticides Toxicity in Agricultural Soil and Plants: Ecological Risks and Human Health Implications. Toxics 2021, 9, 42. [Google Scholar] [CrossRef]
- Lowry, G.V.; Avellan, A.; Gilbertson, L.M. Opportunities and challenges for nanotechnology in the agri-tech revolution. Nat. Nanotechnol. 2019, 14, 517–522. [Google Scholar] [CrossRef]
- Adeel, M.; Farooq, T.; White, J.C.; Hao, Y.; He, Z.; Rui, Y. Carbon-based nanomaterials suppress tobacco mosaic virus (TMV) infection and induce resistance in Nicotiana benthamiana. J. Hazard. Mater. 2021, 404, 124167. [Google Scholar] [CrossRef]
- Altaf, M.A.; Shahid, R.; Ren, M.-X.; Naz, S.; Altaf, M.M.; Khan, L.U.; Tiwari, R.K.; Lal, M.K.; Shahid, M.A.; Kumar, R. Melatonin improves drought stress tolerance of tomato by modulating plant growth, root architecture, photosynthesis, and antioxidant defense system. Antioxidants 2022, 11, 309. [Google Scholar] [CrossRef] [PubMed]
- Abd-Elgawad, M.M.M. Optimizing biological control agents for controlling nematodes of tomato in Egypt. Egypt. J. Biol. Pest Control 2020, 30, 58. [Google Scholar] [CrossRef]
- Selina, P.; Bledsoe, M.E. Greenhouse/Hothouse Hydroponic Tomato Timeline; Village Farms: Liverpool, UK, 2002. [Google Scholar]
- Torres Pineda, I.; Lee, Y.D.; Kim, Y.S.; Lee, S.M.; Park, K.S. Review of inventory data in life cycle assessment applied in production of fresh tomato in greenhouse. J. Clean. Prod. 2021, 282, 124395. [Google Scholar] [CrossRef]
- El-Gendi, H.; Al-Askar, A.A.; Király, L.; Samy, M.A.; Moawad, H.; Abdelkhalek, A. Foliar Applications of Bacillus subtilis HA1 Culture Filtrate Enhance Tomato Growth and Induce Systemic Resistance against Tobacco mosaic virus Infection. Horticulturae 2022, 8, 301. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Sanan-Mishra, N. Differential expression profiles of tomato miRNAs induced by tobacco mosaic virus. J. Agric. Sci. Technol. 2019, 21, 475–485. [Google Scholar]
- Bazzini, A.A.; Hopp, H.E.; Beachy, R.N.; Asurmendi, S. Infection and coaccumulation of tobacco mosaic virus proteins alter microRNA levels, correlating with symptom and plant development. Proc. Natl. Acad. Sci. USA 2007, 104, 12157–12162. [Google Scholar] [CrossRef]
- Carr, J.P.; Murphy, A.M.; Tungadi, T.; Yoon, J.-Y. Plant defense signals: Players and pawns in plant-virus-vector interactions. Plant Sci. 2019, 279, 87–95. [Google Scholar] [CrossRef]
- Hazarika, A.; Yadav, M.; Yadav, D.K.; Yadav, H.S. An overview of the role of nanoparticles in sustainable agriculture. Biocatal. Agric. Biotechnol. 2022, 43, 102399. [Google Scholar] [CrossRef]
- Hasan, K.M.F.; Xiaoyi, L.; Shaoqin, Z.; Horváth, P.G.; Bak, M.; Bejó, L.; Sipos, G.; Alpár, T. Functional silver nanoparticles synthesis from sustainable point of view: 2000 to 2023—A review on game changing materials. Heliyon 2022, 8, e12322. [Google Scholar] [CrossRef]
- Durán, N.; Silveira, C.P.; Durán, M.; Martinez, D.S.T. Silver nanoparticle protein corona and toxicity: A mini-review. J. Nanobiotechnol. 2015, 13, 55. [Google Scholar] [CrossRef]
- Singh, P.; Mijakovic, I. Green synthesis and antibacterial applications of gold and silver nanoparticles from Ligustrum vulgare berries. Sci. Rep. 2022, 12, 7902. [Google Scholar] [CrossRef] [PubMed]
- Singh, M.; Lee, K.E.; Vinayagam, R.; Kang, S.G. Antioxidant and antibacterial profiling of pomegranate-pericarp extract functionalized-zinc oxide nanocomposite. Biotechnol. Bioprocess Eng. 2021, 26, 728–737. [Google Scholar] [CrossRef] [PubMed]
- Abdelkhalek, A.; El-Gendi, H.; Alotibi, F.O.; Al-Askar, A.A.; Elbeaino, T.; Behiry, S.I.; Abd-Elsalam, K.A.; Moawad, H. Ocimum basilicum-Mediated Synthesis of Silver Nanoparticles Induces Innate Immune Responses against Cucumber Mosaic Virus in Squash. Plants 2022, 11, 2707. [Google Scholar] [CrossRef] [PubMed]
- Cai, L.; Cai, L.; Jia, H.; Liu, C.; Wang, D.; Sun, X. Foliar exposure of Fe3O4 nanoparticles on Nicotiana benthamiana: Evidence for nanoparticles uptake, plant growth promoter and defense response elicitor against plant virus. J. Hazard. Mater. 2020, 393, 122415. [Google Scholar] [CrossRef]
- Kongala, S.I.; Mamidala, P. Harpin-loaded chitosan nanoparticles induced defense responses in tobacco. Carbohydr. Polym. Technol. Appl. 2023, 5, 100293. [Google Scholar] [CrossRef]
- Elbeshehy, E.K.F.; Hassan, W.M.; Baeshen, A.A. Controlling Pepper Mild Mottle Virus (PMMoV) Infection in Pepper Seedlings by Use of Chemically Synthetic Silver Nanoparticles. Molecules 2022, 28, 139. [Google Scholar] [CrossRef]
- Ahsan, T. Biofabrication of silver nanoparticles from Pseudomonas fluorescens to control tobacco mosaic virus. Egypt. J. Biol. Pest Control 2020, 30, 66. [Google Scholar] [CrossRef]
- Nasrollahzadeh, M.; Mahmoudi-Gom Yek, S.; Motahharifar, N.; Ghafori Gorab, M. Recent developments in the plant-mediated green synthesis of Ag-based nanoparticles for environmental and catalytic applications. Chem. Rec. 2019, 19, 2436–2479. [Google Scholar] [CrossRef]
- Nayab, D.-; Akhtar, S. Green synthesized silver nanoparticles from eucalyptus leaves can enhance shelf life of banana without penetrating in pulp. PLoS ONE 2023, 18, e0281675. [Google Scholar] [CrossRef]
- Hashem, A.H.; Saied, E.; Ali, O.M.; Selim, S.; Al Jaouni, S.K.; Elkady, F.M.; El-Sayyad, G.S. Pomegranate Peel Extract Stabilized Selenium Nanoparticles Synthesis: Promising Antimicrobial Potential, Antioxidant Activity, Biocompatibility, and Hemocompatibility. Appl. Biochem. Biotechnol. 2023, 1–24. [Google Scholar] [CrossRef]
- Ningthoujam, R.; Sahoo, B.; Ghosh, P.; Shivani, A.; Ganguli, P.; Chaudhuri, S. Green production of zero-valent iron nanoparticles using pomegranate peel extracts and its use in lindane degradation. Nanotechnol. Environ. Eng. 2023. [Google Scholar] [CrossRef]
- Hawar, S.N.; Al-Shmgani, H.S.; Al-Kubaisi, Z.A.; Sulaiman, G.M.; Dewir, Y.H.; Rikisahedew, J.J. Green Synthesis of Silver Nanoparticles from Alhagi graecorum Leaf Extract and Evaluation of Their Cytotoxicity and Antifungal Activity. J. Nanomater. 2022, 2022, 1058119. [Google Scholar] [CrossRef]
- Kaliammal, R.; Parvathy, G.; Maheshwaran, G.; Velsankar, K.; Kousalya Devi, V.; Krishnakumar, M.; Sudhahar, S. Zephyranthes candida flower extract mediated green synthesis of silver nanoparticles for biological applications. Adv. Powder Technol. 2021, 32, 4408–4419. [Google Scholar] [CrossRef]
- Joshi, N.; Jain, N.; Pathak, A.; Singh, J.; Prasad, R.; Upadhyaya, C.P. Biosynthesis of silver nanoparticles using Carissa carandas berries and its potential antibacterial activities. J. Sol-Gel Sci. Technol. 2018, 86, 682–689. [Google Scholar] [CrossRef]
- Bapat, M.S.; Singh, H.; Shukla, S.K.; Singh, P.P.; Vo, D.V.N.; Yadav, A.; Goyal, A.; Sharma, A.; Kumar, D. Evaluating green silver nanoparticles as prospective biopesticides: An environmental standpoint. Chemosphere 2022, 286, 131761. [Google Scholar] [CrossRef]
- He, Y.; Wei, F.; Ma, Z.; Zhang, H.; Yang, Q.; Yao, B.; Huang, Z.; Li, J.; Zeng, C.; Zhang, Q. Green synthesis of silver nanoparticles using seed extract of Alpinia katsumadai, and their antioxidant, cytotoxicity, and antibacterial activities. RSC Adv. 2017, 7, 39842–39851. [Google Scholar] [CrossRef]
- Mousavi, B.; Tafvizi, F.; Zaker Bostanabad, S. Green synthesis of silver nanoparticles using Artemisia turcomanica leaf extract and the study of anti-cancer effect and apoptosis induction on gastric cancer cell line (AGS). Artif. Cells Nanomed. Biotechnol. 2018, 46, 499–510. [Google Scholar] [CrossRef]
- Ashraf, J.M.; Ansari, M.A.; Khan, H.M.; Alzohairy, M.A.; Choi, I. Green synthesis of silver nanoparticles and characterization of their inhibitory effects on AGEs formation using biophysical techniques. Sci. Rep. 2016, 6, 20414. [Google Scholar] [CrossRef]
- Das, G.; Patra, J.K.; Debnath, T.; Ansari, A.; Shin, H.-S. Investigation of antioxidant, antibacterial, antidiabetic, and cytotoxicity potential of silver nanoparticles synthesized using the outer peel extract of Ananas comosus (L.). PLoS ONE 2019, 14, e0220950. [Google Scholar] [CrossRef]
- Ibraheem, D.R.; Hussein, N.N.; Sulaiman, G.M.; Mohammed, H.A.; Khan, R.A.; Al Rugaie, O. Ciprofloxacin-loaded silver nanoparticles as potent nano-antibiotics against resistant pathogenic bacteria. Nanomaterials 2022, 12, 2808. [Google Scholar] [CrossRef]
- Prasannaraj, G.; Venkatachalam, P. Enhanced antibacterial, anti-biofilm and antioxidant (ROS) activities of biomolecules engineered silver nanoparticles against clinically isolated gram positive and gram negative microbial pathogens. J. Clust. Sci. 2017, 28, 645–664. [Google Scholar] [CrossRef]
- Patil, S.; Chaudhari, G.; Paradeshi, J.; Mahajan, R.; Chaudhari, B.L. Instant green synthesis of silver-based herbo-metallic colloidal nanosuspension in Terminalia bellirica fruit aqueous extract for catalytic and antibacterial applications. 3 Biotech 2017, 7, 36. [Google Scholar] [CrossRef]
- Vanaja, M.; Annadurai, G. Coleus aromaticus leaf extract mediated synthesis of silver nanoparticles and its bactericidal activity. Appl. Nanosci. 2013, 3, 217–223. [Google Scholar] [CrossRef]
- Kaushal, J.; Bhatti, J.; Kumar, P. Green synthesis and physico-chemical study of silver nanoparticles extracted from a natural source Luffa acutangula. J. Mol. Liq. 2016, 224, 991–998. [Google Scholar] [CrossRef]
- Magudapathy, P.; Gangopadhyay, P.; Panigrahi, B.K.; Nair, K.G.M.; Dhara, S. Electrical transport studies of Ag nanoclusters embedded in glass matrix. Phys. B Condens. Matter 2001, 299, 142–146. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Al-Askar, A.A. Green Synthesized ZnO Nanoparticles Mediated by Mentha Spicata Extract Induce Plant Systemic Resistance against Tobacco Mosaic Virus. Appl. Sci. 2020, 10, 5054. [Google Scholar] [CrossRef]
- Salem, S.S.; El-Belely, E.F.; Niedbała, G.; Alnoman, M.M.; Hassan, S.E.D.; Eid, A.M.; Shaheen, T.I.; Elkelish, A.; Fouda, A. Bactericidal and in-vitro cytotoxic efficacy of silver nanoparticles (Ag-NPs) fabricated by endophytic actinomycetes and their use as coating for the textile fabrics. Nanomaterials 2020, 10, 2082. [Google Scholar] [CrossRef]
- Cumberland, S.A.; Lead, J.R. Particle size distributions of silver nanoparticles at environmentally relevant conditions. J. Chromatogr. A 2009, 1216, 9099–9105. [Google Scholar] [CrossRef]
- Wan Mat Khalir, W.K.A.; Shameli, K.; Jazayeri, S.D.; Othman, N.A.; Che Jusoh, N.W.; Hassan, N.M. Biosynthesized Silver Nanoparticles by Aqueous Stem Extract of Entada spiralis and Screening of Their Biomedical Activity. Front. Chem. 2020, 8, 620. [Google Scholar] [CrossRef]
- Wypij, M.; Jędrzejewski, T.; Trzcińska-Wencel, J.; Ostrowski, M.; Rai, M.; Golińska, P. Green Synthesized Silver Nanoparticles: Antibacterial and Anticancer Activities, Biocompatibility, and Analyses of Surface-Attached Proteins. Front. Microbiol. 2021, 12, 632505. [Google Scholar] [CrossRef]
- Elkobrosy, D.; Al-Askar, A.A.; El-Gendi, H.; Su, Y.; Nabil, R.; Abdelkhalek, A.; Behiry, S. Nematocidal and Bactericidal Activities of Green Synthesized Silver Nanoparticles Mediated by Ficus sycomorus Leaf Extract. Life 2023, 13, 1083. [Google Scholar] [CrossRef]
- Dua, T.K.; Giri, S.; Nandi, G.; Sahu, R.; Shaw, T.K.; Paul, P. Green synthesis of silver nanoparticles using Eupatorium adenophorum leaf extract: Characterizations, antioxidant, antibacterial and photocatalytic activities. Chem. Pap. 2023, 77, 2947–2956. [Google Scholar] [CrossRef] [PubMed]
- Urnukhsaikhan, E.; Bold, B.-E.; Gunbileg, A.; Sukhbaatar, N.; Mishig-Ochir, T. Antibacterial activity and characteristics of silver nanoparticles biosynthesized from Carduus crispus. Sci. Rep. 2021, 11, 21047. [Google Scholar] [CrossRef] [PubMed]
- Zhu, F.; Zhu, P.; Xu, F.; Che, Y.; Ma, Y.; Ji, Z. Alpha-momorcharin enhances Nicotiana benthamiana resistance to tobacco mosaic virus infection through modulation of reactive oxygen species. Mol. Plant Pathol. 2020, 21, 1212–1226. [Google Scholar] [CrossRef]
- Del Rio, D.; Stewart, A.J.; Pellegrini, N. A review of recent studies on malondialdehyde as toxic molecule and biological marker of oxidative stress. Nutr. Metab. Cardiovasc. Dis. 2005, 15, 316–328. [Google Scholar] [CrossRef]
- Zhou, S.; Hong, Q.; Li, Y.; Li, Q.; Wang, M. Autophagy contributes to regulate the ROS levels and PCD progress in TMV-infected tomatoes. Plant Sci. 2018, 269, 12–19. [Google Scholar] [CrossRef] [PubMed]
- Tripathi, D.; Singh, M.; Pandey-Rai, S. Crosstalk of nanoparticles and phytohormones regulate plant growth and metabolism under abiotic and biotic stress. Plant Stress 2022, 6, 100107. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; El-Gendi, H.; Al-Askar, A.A.; Maresca, V.; Moawad, H.; Elsharkawy, M.M.; Younes, H.A.; Behiry, S.I. Enhancing systemic resistance in faba bean (Vicia faba L.) to Bean yellow mosaic virus via soil application and foliar spray of nitrogen-fixing Rhizobium leguminosarum bv. viciae strain 33504-Alex1. Front. Plant Sci. 2022, 13, 933498. [Google Scholar] [CrossRef]
- Cheng, Y.; Li, X.; Fang, M.-Y.; Ye, Q.-J.; Li, Z.-M.; Ahammed, G.J. Systemic H2O2 signaling mediates epigallocatechin-3-gallate-induced cadmium tolerance in tomato. J. Hazard. Mater. 2022, 438, 129511. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Al-Askar, A.A.; Elbeaino, T.; Moawad, H.; El-Gendi, H. Protective and Curative Activities of Paenibacillus polymyxa against Zucchini yellow mosaic virus Infestation in Squash Plants. Biology 2022, 11, 1150. [Google Scholar] [CrossRef]
- Kaur, S.; Samota, M.K.; Choudhary, M.; Choudhary, M.; Pandey, A.K.; Sharma, A.; Thakur, J. How do plants defend themselves against pathogens-Biochemical mechanisms and genetic interventions. Physiol. Mol. Biol. Plants 2022, 28, 485–504. [Google Scholar] [CrossRef] [PubMed]
- Almagro, L.; Gómez Ros, L.V.; Belchi-Navarro, S.; Bru, R.; Ros Barceló, A.; Pedreño, M.A. Class III peroxidases in plant defence reactions. J. Exp. Bot. 2009, 60, 377–390. [Google Scholar] [CrossRef] [PubMed]
- Fan, J.Q.; Li, B.; Hong, Q.M.; Yan, Z.Y.; Yang, X.J.; Lu, K.C.; Chen, G.L.; Wang, L.; Chen, Y.H. A Glutathione Peroxidase Gene from Litopenaeus vannamei Is Involved in Oxidative Stress Responses and Pathogen Infection Resistance. Int. J. Mol. Sci. 2022, 23, 567. [Google Scholar] [CrossRef] [PubMed]
- Holub, P.; Nezval, J.; Štroch, M.; Špunda, V.; Urban, O.; Jansen, M.A.K.; Klem, K. Induction of phenolic compounds by UV and PAR is modulated by leaf ontogeny and barley genotype. Plant Physiol. Biochem. 2019, 134, 81–93. [Google Scholar] [CrossRef]
- Wang, T.; Li, Q.; Bi, K. Bioactive flavonoids in medicinal plants: Structure, activity and biological fate. Asian J. Pharm. Sci. 2018, 13, 12–23. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Király, L.; Al-Mansori, A.N.A.; Younes, H.A.; Zeid, A.; Elsharkawy, M.M.; Behiry, S.I. Defense Responses and Metabolic Changes Involving Phenylpropanoid Pathway and PR Genes in Squash (Cucurbita pepo L.) following Cucumber mosaic virus Infection. Plants 2022, 11, 1908. [Google Scholar] [CrossRef]
- Noha, K.; Bondok, A.M.; El-Dougdoug, K.A. Evaluation of silver nanoparticles as antiviral agent against ToMV and PVY in tomato plants. Sciences 2018, 8, 100–111. [Google Scholar]
- Mahfouze, H.A.; El-Dougdoug, N.K.; Mahfouze, S.A. Virucidal activity of silver nanoparticles against Banana bunchy top virus (BBTV) in banana plants. Bull. Natl. Res. Cent. 2020, 44, 199. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Yassin, Y.; Abdel-Megeed, A.; Abd-Elsalam, K.A.; Moawad, H.; Behiry, S.I. Rhizobium leguminosarum bv. viciae-Mediated Silver Nanoparticles for Controlling Bean Yellow Mosaic Virus (BYMV) Infection in Faba Bean Plants. Plants 2023, 12, 45. [Google Scholar] [CrossRef]
- Khandelwal, N.; Kaur, G.; Kumar, N.; Tiwari, A. Application of Silver Nanoparticles in Viral Inhibition: A New Hope for Antivirals. Dig. J. Nanomater. Biostruct. 2014, 9, 175–186. [Google Scholar]
- Galdiero, S.; Falanga, A.; Vitiello, M.; Cantisani, M.; Marra, V.; Galdiero, M. Silver nanoparticles as potential antiviral agents. Molecules 2011, 16, 8894–8918. [Google Scholar] [CrossRef] [PubMed]
- Asija, S.; Seth, T.; Umar, S.; Gupta, R. Polyamines and Their Crosstalk with Phytohormones in the Regulation of Plant Defense Responses. J. Plant Growth Regul. 2022, 1–23. [Google Scholar] [CrossRef]
- Otulak-Kozieł, K.; Kozieł, E.; Lockhart, B. Plant cell wall dynamics in compatible and incompatible potato response to infection caused by Potato virus Y (PVYNTN). Int. J. Mol. Sci. 2018, 19, 862. [Google Scholar] [CrossRef] [PubMed]
- Abdelkhalek, A.; Al-Askar, A.A.; Hafez, E. Differential induction and suppression of the potato innate immune system in response to Alfalfa mosaic virus infection. Physiol. Mol. Plant Pathol. 2020, 110, 101485. [Google Scholar] [CrossRef]
- Oide, S.; Bejai, S.; Staal, J.; Guan, N.; Kaliff, M.; Dixelius, C. A novel role of PR 2 in abscisic acid (ABA) mediated, pathogen-induced callose deposition in Arabidopsis thaliana. New Phytol. 2013, 200, 1187–1199. [Google Scholar] [CrossRef]
- Akyol, H.; Riciputi, Y.; Capanoglu, E.; Caboni, M.; Verardo, V. Phenolic compounds in the potato and its byproducts: An overview. Int. J. Mol. Sci. 2016, 17, 835. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Dessoky, E.S.E.S.; Hafez, E. Polyphenolic genes expression pattern and their role in viral resistance in tomato plant infected with Tobacco mosaic virus. Biosci. Res. 2018, 15, 3349–3356. [Google Scholar]
- Kong, D.; Li, Y.; Bai, M.; Deng, Y.; Liang, G.; Wu, H. A comparative study of the dynamic accumulation of polyphenol components and the changes in their antioxidant activities in diploid and tetraploid Lonicera japonica. Plant Physiol. Biochem. 2017, 112, 87–96. [Google Scholar] [CrossRef]
- Kang, J.-H.; McRoberts, J.; Shi, F.; Moreno, J.E.; Jones, A.D.; Howe, G.A. The flavonoid biosynthetic enzyme chalcone isomerase modulates terpenoid production in glandular trichomes of tomato. Plant Physiol. 2014, 164, 1161–1174. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Qari, S.H.; Abu-Saied, M.A.A.-R.; Khalil, A.M.; Younes, H.A.; Nehela, Y.; Behiry, S.I. Chitosan Nanoparticles Inactivate Alfalfa Mosaic Virus Replication and Boost Innate Immunity in Nicotiana glutinosa Plants. Plants 2021, 10, 2701. [Google Scholar] [CrossRef]
- Zhang, J.; Wu, M.; Li, W.; Bai, G. Regulation of chlorogenic acid biosynthesis by hydroxycinnamoyl CoA quinate hydroxycinnamoyl transferase in Lonicera japonica. Plant Physiol. Biochem. 2017, 121, 74–79. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Kong, D.; Bai, M.; He, H.; Wang, H.; Wu, H. Correlation of the temporal and spatial expression patterns of HQT with the biosynthesis and accumulation of chlorogenic acid in Lonicera japonica flowers. Hortic. Res. 2019, 6, 73. [Google Scholar] [CrossRef] [PubMed]
- Abdelkhalek, A.; Al-Askar, A.A.; Behiry, S.I. Bacillus licheniformis strain POT1 mediated polyphenol biosynthetic pathways genes activation and systemic resistance in potato plants against Alfalfa mosaic virus. Sci. Rep. 2020, 10, 16120. [Google Scholar] [CrossRef]
- Ren, T.; Zheng, P.; Zhang, K.; Liao, J.; Xiong, F.; Shen, Q.; Ma, Y.; Fang, W.; Zhu, X. Effects of GABA on the polyphenol accumulation and antioxidant activities in tea plants (Camellia sinensis L.) under heat-stress conditions. Plant Physiol. Biochem. 2021, 159, 363–371. [Google Scholar] [CrossRef] [PubMed]
- Yan, Q.; Si, J.; Cui, X.; Peng, H.; Chen, X.; Xing, H.; Dou, D. The soybean cinnamate 4-hydroxylase gene GmC4H1 contributes positively to plant defense via increasing lignin content. Plant Growth Regul. 2019, 88, 139–149. [Google Scholar] [CrossRef]
- Schilmiller, A.L.; Stout, J.; Weng, J.; Humphreys, J.; Ruegger, M.O.; Chapple, C. Mutations in the cinnamate 4-hydroxylase gene impact metabolism, growth and development in Arabidopsis. Plant J. 2009, 60, 771–782. [Google Scholar] [CrossRef] [PubMed]
- Abdelkhalek, A. Expression of tomato pathogenesis related genes in response to Tobacco mosaic virus. JAPS, J. Anim. Plant Sci. 2019, 29, 1596–1602. [Google Scholar]
- Hafez, E.E.; El-Morsi, A.A.; El-Shahaby, O.A.; Abdelkhalek, A.A. Occurrence of iris yellow spot virus from onion crops in Egypt. VirusDisease 2014, 25, 455–459. [Google Scholar] [CrossRef] [PubMed]
- Abdelkhalek, A.; Aseel, D.G.; Király, L.; Künstler, A.; Moawad, H.; Al-Askar, A.A. Induction of Systemic Resistance to Tobacco mosaic virus in Tomato through Foliar Application of Bacillus amyloliquefaciens Strain TBorg1 Culture Filtrate. Viruses 2022, 14, 1830. [Google Scholar] [CrossRef]
- Heath, R.L.; Packer, L. Photoperoxidation in isolated chloroplasts: I. Kinetics and stoichiometry of fatty acid peroxidation. Arch. Biochem. Biophys. 1968, 125, 189–198. [Google Scholar] [CrossRef]
- Junglee, S.; Urban, L.; Sallanon, H.; Lopez-Lauri, F. Optimized Assay for Hydrogen Peroxide Determination in Plant Tissue Using Potassium Iodide. Am. J. Anal. Chem. 2014, 05, 730–736. [Google Scholar] [CrossRef]
- CHO, Y.K.; AHN, H.Y.E.K. Purification and characterization of polyphenol oxidase from potato: II. Inhibition and catalytic mechanism. J. Food Biochem. 1999, 23, 593–605. [Google Scholar] [CrossRef]
- Beauchamp, C.; Fridovich, I. Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Anal. Biochem. 1971, 44, 276–287. [Google Scholar] [CrossRef] [PubMed]
- Angelini, R.; Manes, F.; Federico, R. Spatial and functional correlation between diamine-oxidase and peroxidase activities and their dependence upon de-etiolation and wounding in chick-pea stems. Planta 1990, 182, 89–96. [Google Scholar] [CrossRef]
- Singleton, V.L.; Orthofer, R.; Lamuela-Raventós, R.M. Analysis of total phenols and other oxidation substrates and antioxidants by means of folin-ciocalteu reagent. In Oxidants and Antioxidants Part A; Academic Press: Cambridge, MA, USA, 1999; Volume 299, pp. 152–178. ISBN 0076-6879. [Google Scholar]
- Ghosh, S.; Derle, A.; Ahire, M.; More, P.; Jagtap, S.; Phadatare, S.D.; Patil, A.B.; Jabgunde, A.M.; Sharma, G.K.; Shinde, V.S.; et al. Phytochemical analysis and free radical scavenging activity of medicinal plants Gnidia glauca and Dioscorea bulbifera. PLoS ONE 2013, 8, e82529. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Ismail, I.A.I.A.; Dessoky, E.S.E.S.; El-Hallous, E.I.E.I.; Hafez, E. A tomato kinesin-like protein is associated with Tobacco mosaic virus infection. Biotechnol. Biotechnol. Equip. 2019, 33, 1424–1433. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zhao, L.; Dong, J.; Hu, Z.; Li, S.; Su, X.; Zhang, J.; Yin, Y.; Xu, T.; Zhang, Z.; Chen, H. Anti-TMV activity and functional mechanisms of two sesquiterpenoids isolated from Tithonia diversifolia. Pestic. Biochem. Physiol. 2017, 140, 24–29. [Google Scholar] [CrossRef]
- Kavroulakis, N.; Ehaliotis, C.; Ntougias, S.; Zervakis, G.I.; Papadopoulou, K.K. Local and systemic resistance against fungal pathogens of tomato plants elicited by a compost derived from agricultural residues. Physiol. Mol. Plant Pathol. 2005, 66, 163–174. [Google Scholar] [CrossRef]
- André, C.M.; Schafleitner, R.; Legay, S.; Lefèvre, I.; Aliaga, C.A.A.; Nomberto, G.; Hoffmann, L.; Hausman, J.-F.; Larondelle, Y.; Evers, D. Gene expression changes related to the production of phenolic compounds in potato tubers grown under drought stress. Phytochemistry 2009, 70, 1107–1116. [Google Scholar] [CrossRef]
- Sagi, M.; Davydov, O.; Orazova, S.; Yesbergenova, Z.; Ophir, R.; Stratmann, J.W.; Fluhr, R. Plant respiratory burst oxidase homologs impinge on wound responsiveness and development in Lycopersicon esculentum. Plant Cell 2004, 16, 616–628. [Google Scholar] [CrossRef] [PubMed]
Treatment | Fresh Weight (g) | Dry Weight (g) | Shoot Length (cm) | Root Length (cm) |
---|---|---|---|---|
Control | 8.49 ± 0.55 c | 2.31 ± 0.42 d | 33.00 ± 2.94 d | 11.50 ± 3.00 c |
TMV | 7.97 ± 1.05 d | 2.21 ± 0.22 e | 30.00 ± 3.55 e | 8.00 ± 3.61 d |
TB | 8.64 ± 1.77 b | 2.38 ± 0.30 b | 35.60 ± 3.64 b | 13.20 ± 2.02 a |
TA | 8.71 ± 1.12 b | 2.33 ± 0.24 c | 33.50 ± 2.65 c | 12.00 ± 2.97 b |
TD | 10.33 ± 1.19 a | 2.50 ± 0.59 a | 36.60 ± 3.51 a | 13.20 ± 2.68 a |
Primers | Abbreviation | Nucleotide Sequence (5′ to 3′) | References |
---|---|---|---|
Tobacco mosaic virus-coat protein | TMV-CP | Forward: CGACTGCCGAAACGTTAGA | [101] |
Reverse: AAGTTGCAGGACCAGAGGT | |||
Pathogenesis related protein-1 | PR-1 | Forward: GTTCCTCCTTGCCACCTTC | [102] |
Reverse: TATGCACCCCCAGCATAGTT | |||
Endoglucanase | PR-2 | Forward: ATAGCCGTTGGAAACGAAG | |
Reverse: CAACTTGCCATCACATTCTG | |||
Chalcone Synthase | CHS | Forward: CACCGTGGAGGAGTATCGTAAGGC | [103] |
Reverse: TGATCAACACAGTTGGAAGGCG | |||
Hydroxycinnamoyl Co A: quinatehydroxycinnamoyl transferase | HQT | Forward: CCCAATGGCTGGAAGATTAGCTA | |
Reverse: ATGAATCACTTTCAGCCTCAACAA | |||
Cinnamic acid 4-hydroxylase | C4H | Forward: CCCAGTTTTTGGAAATTGGCTTCA | [85] |
Reverse: GCCCCATTCTAAGCAAGAGAACATC | |||
β-actin | β-actin | Forward: GGCATACAAAGACAGGACAGCCT | [104] |
Reverse: CTCAATCCCAAGGCCAACAGAGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al-Askar, A.A.; Aseel, D.G.; El-Gendi, H.; Sobhy, S.; Samy, M.A.; Hamdy, E.; El-Messeiry, S.; Behiry, S.I.; Elbeaino, T.; Abdelkhalek, A. Antiviral Activity of Biosynthesized Silver Nanoparticles from Pomegranate (Punica granatum L.) Peel Extract against Tobacco Mosaic Virus. Plants 2023, 12, 2103. https://doi.org/10.3390/plants12112103
Al-Askar AA, Aseel DG, El-Gendi H, Sobhy S, Samy MA, Hamdy E, El-Messeiry S, Behiry SI, Elbeaino T, Abdelkhalek A. Antiviral Activity of Biosynthesized Silver Nanoparticles from Pomegranate (Punica granatum L.) Peel Extract against Tobacco Mosaic Virus. Plants. 2023; 12(11):2103. https://doi.org/10.3390/plants12112103
Chicago/Turabian StyleAl-Askar, Abdulaziz A., Dalia G. Aseel, Hamada El-Gendi, Sherien Sobhy, Marwa A. Samy, Esraa Hamdy, Sarah El-Messeiry, Said I. Behiry, Toufic Elbeaino, and Ahmed Abdelkhalek. 2023. "Antiviral Activity of Biosynthesized Silver Nanoparticles from Pomegranate (Punica granatum L.) Peel Extract against Tobacco Mosaic Virus" Plants 12, no. 11: 2103. https://doi.org/10.3390/plants12112103
APA StyleAl-Askar, A. A., Aseel, D. G., El-Gendi, H., Sobhy, S., Samy, M. A., Hamdy, E., El-Messeiry, S., Behiry, S. I., Elbeaino, T., & Abdelkhalek, A. (2023). Antiviral Activity of Biosynthesized Silver Nanoparticles from Pomegranate (Punica granatum L.) Peel Extract against Tobacco Mosaic Virus. Plants, 12(11), 2103. https://doi.org/10.3390/plants12112103