Induced Systemic Resistance in the Bacillus spp.—Capsicum chinense Jacq.—PepGMV Interaction, Elicited by Defense-Related Gene Expression
Abstract
1. Introduction
2. Results
2.1. The Severity of the Infection Caused by PepGMV
2.2. Induced Systemic Resistance by Bacillus spp. in Capsicum chinense Jacq. against PepGMV
2.3. Accumulation of PepGMV in Capsicum chinense
2.4. Effect of Plan Inoculation with Bacillus in Gene Expression of Genes Related with the ISR
2.5. Greenhouse Yield of Plants during the Bacillus spp.–C. chinensee–PepGMV Interaction
3. Discussion
4. Materials and Methods
4.1. Selection of Plant Material, Germination, and Growth Conditions
4.2. Bacillus sp. Inoculation
4.3. PepGMV Infection by Bioballistics
4.4. Severity Scale in C. chinense Plants under Controlled Conditions
4.5. Viral Titer Determination in C. chinense
4.6. Relative Expression of CcNPR1, CcPR10, and CcCOI1 by Real-Time PCR
4.7. Evaluation of Agronomic Parameters
4.8. Experimental Design
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Beris, D.; Theologidis, I.; Skandalis, N.; Vassilakos, N. Bacillus amyloliquefaciens strain MBI600 induces salicylic acid dependent resistance in tomato plants against Tomato spotted wilt virus and Potato virus Y. Sci. Rep. 2018, 8, 10320. [Google Scholar] [CrossRef] [PubMed]
- International Committee of Taxonomy of Virus (ICTV). Available online: https://talk.ictvonline.org/ictv-reports/ictv_online_report/ssdna-viruses/w/geminiviridae/479/member-species-begomovirus (accessed on 15 May 2020).
- Guevara-Olvera, L.; Ruíz-Nito, M.L.; Rangel-Cano, R.M.; Torres-Pacheco, I.; Rivera-Bustamante, R.F.; Muñoz-Sánchez, C.I.; González-Chavira, M.M.; Cruz-Hernandez, A.; Guevara-Gonzalez, R.G. Expression of a germin-like protein gene (CchGLP) from a geminivirus-resistant pepper (Capsicum chinense Jacq.) enhances tolerance to geminivirus infection in transgenic tobacco. Physiol. Mol. Plant Pathol. 2012, 78, 45–50. [Google Scholar] [CrossRef]
- Mejía-Teniente, L.M.; Joaquin-Ramos, A.J.; Torres-Pacheco, I.; Rivera-Bustamante, R.F.; Guevara-Olvera, L.; Rico-García, E.; Guevara-Gonzalez, R.G. Silencing of a Germin-Like Protein Gene (CchGLP) in Geminivirus-Resistant Pepper (Capsicum chinense Jacq.) BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV. Viruses 2015, 7, 6141–6151. [Google Scholar] [CrossRef]
- Brown, J.K.; Campodionico, O.P.; Nelson, M.R. A whitefly-transmitted geminivirus from peppers with tiger disease. Plant Dis. 1989, 73, 610. [Google Scholar] [CrossRef]
- Brown, J.K.; Idris, A.M.; Ostrow, K.M.; Goldberg, N.; French, R.; Stenger, D.C. Genetic and phenotypic variation of the Pepper golden mosaic virus complex. Phytopathology 2005, 95, 1217–1224. [Google Scholar] [CrossRef][Green Version]
- Ceniceros-Ojeda, E.A.; Rodríguez-Negrete, E.A.; Rivera-Bustamante, R.F. Two populations of viral minichromosomes are present in a geminivirus-infected plant showing symptom remission (recovery). J. Virol. 2016, 90, 3828–3838. [Google Scholar] [CrossRef]
- Saavedra, D.L.T.; Bustamante, R.F.R.; Neria, M.A.G. Veinte años de investigación con Geminivirus en vegetales en Guanajuato. Acta Univ. 2010, 3, 84–92. [Google Scholar]
- Meneses-Lazo, R.E.M.; Garruña, R. The habanero pepper (Capsicum chinense Jacq.) As a study plant model in Mexico. Trop. Subtrop. Agroecosystems 2020, 23, 1. [Google Scholar]
- Góngora-Castillo, E.; Ibarra-Laclette, E.; Trejo-Saavedra, D.L.; Rivera-Bustamante, R.F. Transcriptome analysis of symptomatic and recovered leaves of geminivirus-infected pepper (Capsicum annuum). Virol. J. 2012, 9, 295. [Google Scholar] [CrossRef]
- Trejo-Saavedra, D.L.; García-Neria, M.A.; Rivera-Bustamante, R.F. Benzothiadiazole (BTH) induces resistance to Pepper golden mosaic virus (PepGMV) in pepper (Capsicum annuum L.). Biol. Res. 2013, 46, 333–340. [Google Scholar] [CrossRef]
- Rubio, L.; Galipienso, L.; Ferriol, I. Detection of Plant Viruses and Disease Management: Relevance of Genetic Diversity and Evolution. Front. Plant Sci. 2020, 11, 1092. [Google Scholar] [CrossRef]
- Hernández, J.A.; Díaz-Vivancos, P.; Rubio, M.; Olmos, E.; Ros-Barceló, A.; Martínez-Gómez, P. Long-term Plum pox virus infection produces an oxidative stress in a susceptible apricot, Prunus americana, cultivar but not in a resistant cultivar. Physiol. Plant 2006, 126, 140–152. [Google Scholar] [CrossRef]
- Faria, M.; Wraight, S.P. Biological control of Bemisia tabaci with fungi. Crop Prot. 2001, 20, 767–778. [Google Scholar] [CrossRef]
- Musser, R.O.; Hum-Musser, S.M.; Gallucci, M.; DesRochers, B.; Brown, J.K. Microarray Analysis of Tomat Plants Exposed to the Nonviruliferous or Viruliferous Whitefly Vector Harboring Pepper golden mosaic virus. J. Insect Sci. 2014, 14, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Choudhary, D.K.; Johri, B.N. Interactions of Bacillus spp. and plants—With special reference to induced systemic resistance (ISR). Microbiol. Res. 2009, 164, 493–513. [Google Scholar] [CrossRef] [PubMed]
- Beneduzi, A.; Ambrosini, A.; Passaglia, L.M.P. Plant growth-promoting rhizobacteria (PGPR): Their potential as antagonists and biocontrol agents. Genet. Mol. Biol. 2012, 35, 1044–1051. [Google Scholar] [CrossRef]
- Domenech, J.; Ramos, S.B.; Probanza, A.; Lucas, G.J.A.; Gutierrez, M.F.J. Elicitation of systemic resistance and growth promotion of Arabidopsis thaliana by PGPRs from Nicotiana glauca: A study of the putative induction pathway. Plant Soil 2007, 290, 43–50. [Google Scholar] [CrossRef]
- Mehta, P.; Walia, A.; Kulshrestha, S.; Chauhan, A.; Shirkot, C.K. Efficiency of plant growth-promoting P-solubilizing Bacillus circulans CB7 for enhancement of tomato growth under net house conditions. J. Basic Microb. 2015, 55, 33–44. [Google Scholar] [CrossRef]
- Kang, S.M.; Radhakrishnan, R.; You, Y.H.; Joo, G.J.; Lee, I.J.; Lee, K.E.; Kim, J.H. Phosphate Solubilizing Bacillus megaterium mj1212 Regulates Endogenous Plant Carbohydrates and Amino Acids Contents to Promote Mustard Plant Growth. Indian J. Microbiol. 2014, 54, 427–433. [Google Scholar] [CrossRef]
- Talboys, P.J.; Owen, D.W.; Healey, J.R.; Withers, P.J.A.; Jones, D.L. Auxin secretion by Bacillus amyloliquefaciens FZB42 both stimulates root exudation and limits phosphorus uptake in Triticum aestivum. BMC Plant Biol. 2014, 14, 51. [Google Scholar] [CrossRef]
- Hanif, M.K.; Hameed, S.; Imran, A.; Naqqash, T.; Shahid, M.; Van Elsas, J.D. Isolation and characterization of a β-propeller gene containing phosphobacterium Bacillus subtilis strain KPS-11 for growth promotion of potato (Solanum tuberosum L.). Front. Microbiol. 2015, 6, 583. [Google Scholar] [CrossRef] [PubMed]
- Shao, J.; Xu, Z.; Zhang, N.; Shen, Q.; Zhang, R. Contribution of indole-3-acetic acid in the plant growth promotion by the rhizospheric strain Bacillus amyloliquefaciens SQR9. Biol. Fertil. Soils 2015, 51, 321–330. [Google Scholar] [CrossRef]
- Yu, Y.; Gui, Y.; Li, Z.; Jiang, C.; Guo, J.; Niu, D. Induced Systemic Resistance for Improving Plant Immunity by Beneficial Microbes. Plants 2022, 11, 386. [Google Scholar] [CrossRef] [PubMed]
- Murphy, J.F.; Reddy, M.S.; Ryu, C.M.; Kloepper, J.W.; Li, R. Rhizobacteria-mediated growth promotion of tomato leads to protection against Cucumber mosaic virus. Phytopathology 2003, 93, 1301–1307. [Google Scholar] [CrossRef] [PubMed]
- Choi, H.K.; Song, G.C.; Yi, H.S.; Ryu, C.M. Field Evaluation of the Bacterial Volatile Derivative 3-Pentanol in Priming for Induced Resistance in Pepper. J. Chem. Ecol. 2014, 40, 882–892. [Google Scholar] [CrossRef]
- Zehnder, G.W.; Yao, C.; Murphy, J.F.; Sikora, E.R.; Kloepper, J.W. Induction of resistance in tomato against cucumber mosaic cucumovirus by plant growth-promoting rhizobacteria. Biocontrol 2000, 45, 127–137. [Google Scholar] [CrossRef]
- Wang, S.; Wu, H.; Qiao, J.; Ma, L.; Liu, J.; Xia, Y.; Gao, X. Molecular Mechanism of Plant Growth Promotion and Induced Systemic Resistance to Tobacco Mosaic Virus by Bacillus spp. J. Microbiol. Biotechnol. 2009, 19, 1250–1258. [Google Scholar] [CrossRef]
- Derksen, H.; Rampitschb, C.; Daayf, F. Signaling cross-talk in plant disease resistance. Plant Sci. 2013, 207, 79–87. [Google Scholar] [CrossRef]
- Jankiewicz, U.; Koltonowicz, M. The Involvement of Pseudomonas Bacteria in Induced Systemic Resistance in Plants (Review). Appl. Biochem. Microbiol. 2012, 48, 244–249. [Google Scholar] [CrossRef]
- Samaniego-Gámez, B.Y.; Reyes-Ramírez, A.; Moreno-Valenzuela, O.A.; Tun-Suárez, J.M. Induced systemic resistance against plant viruses elicited by inoculation with rhizobacteria Bacillus spp. Rev. Protección Veg. 2017, 32, 10–22. [Google Scholar]
- Luna-Rivero, M.S.; Hernández-Zepeda, C.; Villanueva-Alonzo, H.; Minero-García, Y.; Castell-González, S.E.; Moreno-Valenzuela, O.A. Expression of genes involved in the salicylic acid pathway in type h1 thioredoxin transiently silenced pepper plants during a begomovirus compatible interaction. Mol. Genet. Genom. 2015, 291, 819–830. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Chauhan, P.S.; Agrawal, L.; Raj, R.; Srivastava, A.; Gupta, S.; Mishra, S.K.; Yadav, S.; Singh, P.C.; Raj, S.K.; et al. Paenibacillus lentimorbus Inoculation Enhances Tobacco Growth and Extenuates the Virulence of Cucumber mosaic virus. PLoS ONE 2016, 11, e0149980. [Google Scholar] [CrossRef] [PubMed]
- Kanchana, D.; Jayanthi, M.; Usharani, G.; Saranraj, P.; Sujitha, D. Interaction effect of combined inoculation of PGPR on growth and yield parameters of Chilli Var K1 (Capsicum annuum L.). Int. J. Microbiol. Res. 2014, 5, 144–151. [Google Scholar]
- Samaniego-Gámez, B.Y.; Garruña, R.; Tun-Suárez, J.M.; Kantun-Can, J.; Reyes-Ramírez, A.; Cervantes-Díaz, L. Bacillus spp. inoculation improves photosystem II efficiency and enhances photosynthesis in pepper plants. Chil. J. Agric. Res. 2016, 76, 409–416. [Google Scholar] [CrossRef]
- Samaniego-Gámez, B.Y.; Garruña, R.; Tun-Suarez, J.M.; Moreno-Valenzuela, O.A.; Reyes-Ramirez, A.; Valle-Gough, R.E.; Ail-Catzim, C.E.; Toscano-Palomar, L. Healthy Photosynthetic Mechanism Suggests ISR Elicited by Bacillus spp. in capsicum chinense Plants Infected with PepGMV. Pathogens 2021, 10, 455. [Google Scholar] [CrossRef] [PubMed]
- Elbeshehy, E.K.F.; Youssef, S.A.; Elazzazy, A.M. Resistance induction in pumpkin Cucurbita maxima L. against Watermelon mosaic potyvirus by plant growth-promoting rhizobacteria. Biocont. Sci. Technol. 2015, 25, 525–542. [Google Scholar] [CrossRef]
- García-Neria, M.A.; Rivera-Bustamante, R.F. Characterization of Geminivirus resistance in an accession of Capsicum chinense Jacq. Mol. Plant Microbe Interact. 2011, 24, 172–182. [Google Scholar] [CrossRef]
- Chen, H.; Li, M.; Qi, G.; Zhao, M.; Liu, L.; Zhang, J.; Fu, Z.Q. Two interacting transcriptional coactivators cooperatively control plant immune responses. Sci. Adv. 2021, 7, eabl7173. [Google Scholar] [CrossRef]
- Kumar, P.; Pahal, V.; Gupta, A.; Vadhan, R.; Chandra, H.; Dubey, R.C. Effect of silver nanoparticles and Bacillus cereus LPR2 on the growth of Zea mays. Sci. Rep. 2020, 10, 20409. [Google Scholar] [CrossRef]
- Damayanti, T.A.; Katerina, T. Protection of hot pepper against multiple infection of viruses by utilizing root colonizing bacteria. J. ISSAAS 2008, 14, 92–100. [Google Scholar]
- Zeng, Q.; Xie, J.; Li, Y.; Gao, T.; Xu, C.; Wang, Q. Comparative genomic and functional analyses of four sequenced Bacillus cereus genomes reveal conservation of genes relevant to plant-growth-promoting traits. Sci. Rep. 2018, 8, 17009. [Google Scholar] [CrossRef] [PubMed]
- Xu, P.; Blancaflor, E.B.; Roossinck, M.J. In spite of induced multiple defense responses, tomato plants infected with Cucumber mosaic virus and D satellite RNA succumb to systemic necrosis. Mol. Plant Microbe Interact. 2003, 16, 467–476. [Google Scholar] [CrossRef] [PubMed]
- Park, C.J.; Kim, K.J.; Shin, R.; Park, J.M.; Shin, Y.C.; Paek, K.H. Pathogenesis-related protein 10 isolated from hot pepper functions as a ribonuclease in an antiviral pathway. Plant J. 2004, 37, 186–198. [Google Scholar] [CrossRef] [PubMed]
- Lee, G.H.; Ryu, C.M. Spraying of leaf-colonizing Bacillus amyloliquefaciens protects pepper from Cucumber mosaic virus. Plant Dis. 2016, 100, 2099–2105. [Google Scholar] [CrossRef]
- Lozano-Duran, R.; Rosas-Diaz, T.; Gusmaroli, G.; Luna, A.P.; Taconnat, L.; Deng, X.W.; Bejarano, E.R. Geminiviruses subvert ubiquitination by altering CSN-mediated derubylation of SCF E3 ligase complexes and inhibit jasmonate signaling in Arabidopsis thaliana. Plant Cell 2011, 23, 1014–1032. [Google Scholar] [CrossRef]
- Rosas-Díaz, T.; Macho, A.P.; Beuzón, C.R.; Lozano-Durán, R.; Bejarano, E.R. The C2 Protein from the Geminivirus Tomato Yellow Leaf Curl Sardinia Virus Decreases Sensitivity to Jasmonates and Suppresses Jasmonate-Mediated Defences. Plants 2016, 5, 8. [Google Scholar] [CrossRef]
- Dadrasnia, A.; Usman, M.M.; Omar, R.; Ismail, S.; Abdullah, R. Potential use of Bacillus genus to control of bananas diseases: Approaches toward high yield production and sustainable management. J. King Saud Univ.-Sci. 2020, 32, 2336–2342. [Google Scholar] [CrossRef]
- Miljaković, D.; Marinković, J.; Balešević-Tubić, S. The Significance of Bacillus spp. in Disease Suppression and Growth Promotion of Field and Vegetable Crops. Microorganisms 2020, 8, 1037. [Google Scholar] [CrossRef]
- Hong, S.; Kim, T.Y.; Won, S.-J.; Moon, J.-H.; Ajuna, H.B.; Kim, K.Y.; Ahn, Y.S. Control of Fungal Diseases and Fruit Yield Improvement of Strawberry Using Bacillus velezensis CE 100. Microorganisms 2022, 10, 365. [Google Scholar] [CrossRef]
- Latournerie-Moreno, L.; Lopez-Vázquez, J.S.; Castañón-Nájera, G.; Mijangos-Cortéz, J.O.; Espadas-Villamil, G.; Pérez-Gutiérrez, A.; Ruiz-Sánchez, E. Agronomic evaluation of germplasm of habanero pepper (Capsicum chinense Jacq.). Agroproductividad 2015, 1, 24–29. [Google Scholar]
- Carrillo-Tripp, J.; Lozoya-Gloria, E.; Rivera-Bustamante, R.F. Symptom remission and specific resistance of pepper plants after infection by Pepper golden mosaic virus. Phytopathology 2007, 97, 51–59. [Google Scholar] [CrossRef]
- Villanueva-Alonzo, H.J.; Us-Camas, R.Y.; López-Ochoa, L.A.; Robertson, D.; Guerra-Peraza, O.; Minero-García, Y.; Moreno-Valenzuela, O.A. A new virus-induced gene silencing vector based on Euphorbia mosaic virus-Yucatan peninsula for NPR1 silencing in Nicotiana benthamiana and Capsicum annuum var. Anaheim. Biotechnol. Lett. 2013, 35, 811–823. [Google Scholar] [CrossRef]
- Anaya-López, J.L.; Torres-Pacheco, I.; González-Chavira, M.; Garzon-Tiznado, J.A.; Pons-Hernandez, J.L.; Guevara-González, R.G.; Muñoz-Sánchez, C.I.; Guevara-Olvera, L.; Rivera-Bustamante, R.F.; Hernández-Verdugo, S. Resistance to Geminivirus Mixed Infections in Mexican Wild Peppers. HortScience 2003, 38, 251–255. [Google Scholar] [CrossRef]
- Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
- Wan, H.; Yuan, W.; Ruan, M.; Ye, Q.; Wang, R.; Li, Z.; Zhou, G.; Yao, Z.; Zhao, J.; Liu, S.; et al. Identification of reference genes for reverse transcription quantitative real-time PCR normalization in pepper (Capsicum annuum L.). Biochem. Biophys. Res. Commun. 2011, 416, 24–30. [Google Scholar] [CrossRef] [PubMed]
- Valle-Gough, R.E.; Avilés-Viñas, S.A.; López-Erosa, S.; Canto-Flick, A.; Gómez-Uc, E.; Sáenz-Carbonell, L.A.; Ochoa-Alejo, N.; Santana-Buzzy, N. Polyamines and WOX genes in the recalcitrance to plant conversion on of somatic embryos of Habanero pepper (Capsicum chinense Jacq.). Afr. J. Biotech. 2015, 14, 569–581. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 4, 402–408. [Google Scholar] [CrossRef] [PubMed]
Treatment | Mean Fruit Weight (g) | Fruits per Plant | Yield per Plant (g) |
---|---|---|---|
H2O | 6.1 ± 0.05 b | 52 ± 1.8 c | 320.75 ± 6.51 c |
PepGMV | 5.3 ± 0.06 b | 52 ± 1.4 d | 274 ± 4.263 d |
K47-PepGMV | 7.9 ± 0.05 a | 57 ± 1.5 a | 451.75 ± 9.47 a |
K46-PepGMV | 7.6 ± 0.04 c | 47 ± 1.3 b | 358.75 ± 8.2 b |
M9-PepGMV | 7.7 ± 0.04 d | 41 ± 1.1 b | 314 ± 9.2 c,d |
Gene Name | Primer Sequences (5′-3′) | Fragment (bp) |
---|---|---|
PepGMV AC2 [36] | GCCTTGTGGAGAGCTAATGC | 213 |
TTAGCGCAGTTGATGTGGAG | ||
β-tubulin [56] | TGTCCATCTGCTCTCTGTTG | 204 |
CACCCCAAGCACAATAAGAC | ||
CcNPR1 | GAGGTGAGTTATGATGCTCTGG | 141 |
AACCAAGAAAGCCACTGCTG | ||
CcPR10 | GCAGATGGAGGATGTGTTGG | 147 |
AGAAGGATTGGTGAGGAGGTAG | ||
CcCOI1 | TGAAGAAGGTGCGGTTACAC | 153 |
ACCAGCCGAAAATCAGACAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Samaniego-Gámez, B.Y.; Valle-Gough, R.E.; Garruña-Hernández, R.; Reyes-Ramírez, A.; Latournerie-Moreno, L.; Tun-Suárez, J.M.; Villanueva-Alonzo, H.d.J.; Nuñez-Ramírez, F.; Diaz, L.C.; Samaniego-Gámez, S.U.; et al. Induced Systemic Resistance in the Bacillus spp.—Capsicum chinense Jacq.—PepGMV Interaction, Elicited by Defense-Related Gene Expression. Plants 2023, 12, 2069. https://doi.org/10.3390/plants12112069
Samaniego-Gámez BY, Valle-Gough RE, Garruña-Hernández R, Reyes-Ramírez A, Latournerie-Moreno L, Tun-Suárez JM, Villanueva-Alonzo HdJ, Nuñez-Ramírez F, Diaz LC, Samaniego-Gámez SU, et al. Induced Systemic Resistance in the Bacillus spp.—Capsicum chinense Jacq.—PepGMV Interaction, Elicited by Defense-Related Gene Expression. Plants. 2023; 12(11):2069. https://doi.org/10.3390/plants12112069
Chicago/Turabian StyleSamaniego-Gámez, Blancka Yesenia, Raúl Enrique Valle-Gough, René Garruña-Hernández, Arturo Reyes-Ramírez, Luis Latournerie-Moreno, José María Tun-Suárez, Hernán de Jesús Villanueva-Alonzo, Fidel Nuñez-Ramírez, Lourdes Cervantes Diaz, Samuel Uriel Samaniego-Gámez, and et al. 2023. "Induced Systemic Resistance in the Bacillus spp.—Capsicum chinense Jacq.—PepGMV Interaction, Elicited by Defense-Related Gene Expression" Plants 12, no. 11: 2069. https://doi.org/10.3390/plants12112069
APA StyleSamaniego-Gámez, B. Y., Valle-Gough, R. E., Garruña-Hernández, R., Reyes-Ramírez, A., Latournerie-Moreno, L., Tun-Suárez, J. M., Villanueva-Alonzo, H. d. J., Nuñez-Ramírez, F., Diaz, L. C., Samaniego-Gámez, S. U., Minero-García, Y., Hernandez-Zepeda, C., & Moreno-Valenzuela, O. A. (2023). Induced Systemic Resistance in the Bacillus spp.—Capsicum chinense Jacq.—PepGMV Interaction, Elicited by Defense-Related Gene Expression. Plants, 12(11), 2069. https://doi.org/10.3390/plants12112069