Next Article in Journal
Fine Mapping of fw6.3, a Major-Effect Quantitative Trait Locus That Controls Fruit Weight in Tomato
Next Article in Special Issue
Research Progress on the Mechanism of Salt Tolerance in Maize: A Classic Field That Needs New Efforts
Previous Article in Journal
Alpine Viticulture and Climate Change: Environmental Resources and Limitations for Grapevine Ripening in Valtellina, Italy
Previous Article in Special Issue
Macro and Micro-Nutrient Accumulation and Partitioning in Soybean Affected by Water and Nitrogen Supply
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Induced Systemic Resistance in the Bacillus spp.—Capsicum chinense Jacq.—PepGMV Interaction, Elicited by Defense-Related Gene Expression

by
Blancka Yesenia Samaniego-Gámez
1,*,
Raúl Enrique Valle-Gough
1,
René Garruña-Hernández
2,
Arturo Reyes-Ramírez
3,
Luis Latournerie-Moreno
3,
José María Tun-Suárez
3,
Hernán de Jesús Villanueva-Alonzo
4,
Fidel Nuñez-Ramírez
1,
Lourdes Cervantes Diaz
1,
Samuel Uriel Samaniego-Gámez
1,
Yereni Minero-García
5,
Cecilia Hernandez-Zepeda
6 and
Oscar A. Moreno-Valenzuela
5,*
1
Institute of Agricultural Sciences, Autonomous University of Baja California, Delta Highway s/n Ejido Nuevo León, Mexicali P.O. Box 21705, Baja California, Mexico
2
CONACYT—National Technological Institute of Mexico, Technological Institute of Conkal, CONACYT, Tecnológico Ave. s/n, Conkal P.O. Box 97345, Yucatán, Mexico
3
National Technological Institute of Mexico, Conkal Institute of Technology, Division of Graduate Studies and Research, Av. Tecnológico s/n, Conkal P.O. Box 97345, Yucatán, Mexico
4
Regional Research Center “Dr. Hideyo Noguchi”, Cell Biology Laboratory, Autonomous University of Yucatan, Av. Itzáez, Nmbr. 490 by 59 St. Centro, Merida P.O. Box 97000, Yucatán, Mexico
5
Yucatan Center of Scientific Research, Plant Biochemistry and Molecular Biology Unit, 43 St., Nmbr. 130, Chuburna de Hidalgo, Merida P.O. Box 97200, Yucatán, Mexico
6
Yucatan Center of Scientific Research, Water Sciences Unit, 8 St., Nmbr. 39, SM 64, Mz. 29, Cancun P.O. Box 77500, Quintana Roo, Mexico
*
Authors to whom correspondence should be addressed.
Plants 2023, 12(11), 2069; https://doi.org/10.3390/plants12112069
Submission received: 6 March 2023 / Revised: 13 May 2023 / Accepted: 18 May 2023 / Published: 23 May 2023
(This article belongs to the Special Issue Molecular Basis of Crops and Fruit Plants in Response to Stress)

Abstract

:
Induced systemic resistance (ISR) is a mechanism involved in the plant defense response against pathogens. Certain members of the Bacillus genus are able to promote the ISR by maintaining a healthy photosynthetic apparatus, which prepares the plant for future stress situations. The goal of the present study was to analyze the effect of the inoculation of Bacillus on the expression of genes involved in plant responses to pathogens, as a part of the ISR, during the interaction of Capsicum chinense infected with PepGMV. The effects of the inoculation of the Bacillus strains in pepper plants infected with PepGMV were evaluated by observing the accumulation of viral DNA and the visible symptoms of pepper plants during a time-course experiment in greenhouse and in in vitro experiments. The relative expression of the defense genes CcNPR1, CcPR10, and CcCOI1 were also evaluated. The results showed that the plants inoculated with Bacillus subtilis K47, Bacillus cereus K46, and Bacillus sp. M9 had a reduction in the PepGMV viral titer, and the symptoms in these plants were less severe compared to the plants infected with PepGMV and non-inoculated with Bacillus. Additionally, an increase in the transcript levels of CcNPR1, CcPR10, and CcCOI1 was observed in plants inoculated with Bacillus strains. Our results suggest that the inoculation of Bacillus strains interferes with the viral replication, through the increase in the transcription of pathogenesis-related genes, which is reflected in a lowered plant symptomatology and an improved yield in the greenhouse, regardless of PepGMV infection status.

1. Introduction

The disease management caused by viruses represents high costs and generates serious economic losses in agricultural productions worldwide [1]. The begomovirus genera, family Geminiviridae, is the most diverse and widespread member of the family worldwide, and it includes more than 400 reported species, including Pepper golden mosaic virus (PepGMV) [2,3,4]. Since its appearance and further identification, this virus has been studied as it has caused severe economic losses, as well as because it is an excellent model for the elucidation of the plant–begomoviruses interactions [5,6,7]. PepGMV causes adverse effects in crops of the family Solanaceae, such as tobacco, tomato, and several species of pepper (Capsicum sp.) [6,7]. Of these species, C. chinense L. has been widely used as a model for food, biochemical, and phytopathological studies. Due to its economic importance, it has a short crop cycle that allows us to identify, detect, and know the distribution of viruses that affect solanaceous crops [8,9].
In Mexico, several studies have been performed in order to identify the mechanisms of infection and the interaction between vector (Bemisia tabaci Gennadius B biotype), host and PepGMV in order to propose strategies of management and control [8,10,11]. The management of viral pathosystems is based on the prophylaxis that prevents virus dispersion and on the plant tolerance in order to generate plants with resistance to viral infection through different pathways [12]. The main strategy for the virus control depends on the genetic resistance of the host, its interaction with the environment, and the efficiency of the synthetic pesticides in vector control [13]. However, in PepGMV infections, the high multiplication rates of B. tabaci have favored the development of resistant/tolerant populations in this vector to the application of chemical products [14,15].
In recent years, many studies have focused on generating new strategies and approaches during disease management, and currently, commercial products based on microorganisms, such as beneficial fungi and plant growth-promoting rhizobacteria (PGPR), are applied to agricultural crops [16,17,18,19]. Bacillus is a PGPR that promote growth, regulates the plant physiology, and confers protection against pathogens due to many of its properties, such as the biosynthesis of auxins (IAA), production of siderophores, fixation and solubilization of soil nutrients, and induced systemic resistance (ISR) via jasmonic acid (JA), salicylic acid (SA), and ethylene (ET) signaling pathways [17,19,20,21,22,23,24]. The ISR elicited by rhizobacteria is a mechanism that strengthens the plant defense system against attack from pathogens. However, the induction of the ISR as a sustainable choice for viral disease control has been little studied [25,26,27].
During the ISR, the genes and transcriptional factors of the SA and JA signaling pathways, dependent on the non-expressor of pathogenesis-related genes 1 (NPR1), participate and involve the synthesis of pathogenesis-related proteins [24,28,29]. JA and ET transduce extracellular stimuli recognized by cell receptors to a large number of target molecules, which affect a fully coordinated and highly specific intracellular response to external stimuli [30]. Some reports indicate that the Coronatine Insensitive 1 (COI1) gene regulates the JA signaling pathway that induces ISR [28,31]. Within the reported genes in these pathways, the pathogenesis-related protein family 10 (PR10) [32] is included.
Recent studies have shown that the ISR improves photosynthesis and favors plants under biotic stress conditions [33,34]. Specifically, our previous research has shown that Bacillus strains enhance photosystem, and furthermore, promote ISR in C. chinense plants infected with PepGMV, showing an increased CO2 assimilation, a decrease in the transpiration rate, and increased water use efficiency, which caused less severe symptoms in PepGMV-infected plants, as well as an increase in yield and fruit quality [35,36]. In this sense, could Bacillus spp. increase the expression of the plant defense mechanisms at a genetic level? The objective of the present study was to analyze the effect of the inoculation of different strains of Bacillus on the expression of the genes involved in plant responses to pathogens during its interaction with C. chinense infected with PepGMV.

2. Results

2.1. The Severity of the Infection Caused by PepGMV

The severity of the infection caused by PepGMV in pepper plants cultivated in controlled conditions (growth chamber) was evaluated in a temporal course experiment at 0, 7, 14, and 21 dpi. The visible symptoms based on the severity scale (see Section 4.4 in Materials and Methods) appeared as the viral infection progressed; the symptomatology developed as expected (Figure 1A). In addition, it was possible to observe mean differences in the viral titer, which increased in plants with higher severity levels: 1 = 22.90 Relative DNA Accumulation (RDA); 2 = 1558.56 RDA; 3 = 1844.55 RDA; 4 = 2161.02 RDA (Figure 2B).

2.2. Induced Systemic Resistance by Bacillus spp. in Capsicum chinense Jacq. against PepGMV

Symptoms in plants infected with PepGMV were first observed at 7 days post-inoculation (dpi) (Figure 2B). The first symptoms were downward leaf curling and yellow spots. In plants treated with B. subtilis K47, B. cereus K46, and Bacillus spp. M9, the symptoms of yellow spots, leaf curl, and dwarfism, characteristic of a Level 1 PepGMV severity, were observed until 14 dpi (Figure 2H–J). Symptoms were attenuated in the treatment with the B. subtilis K47-PepGMV (Figure 2H). PepGMV-infected plants showed severe golden mosaics, leaf curling, and dwarfing symptoms (Figure 2G), which corresponded to Level 4 on the severity scale. Mock-inoculated plants did not present any symptoms (Figure 2A,F,K).
Viral symptoms were less severe in plants infected with PepGMV at 21 dpi (Level 2 severity, Figure 2L) compared to 14 dpi, with Level 4 severity (Figure 2G). The symptoms in plants inoculated with the Bacillus strains were similar at 14 dpi with Level 1 severity (Figure 2M,O), except for the plants inoculated with the M9 strain, where yellow mosaics and leaf curling were observed, which corresponded to Level 2 severity (Figure 2O). PepGMV was detected in all the plants inoculated with the virus, and was determined by PCR amplification. Taken together, these results indicate that Bacillus spp. induces resistance to PepGMV in pepper plants.

2.3. Accumulation of PepGMV in Capsicum chinense

The relative accumulation of viral DNA was quantified using the PepGMV-AC2 gene as a qPCR target. Viral DNA was detected at 7 dpi in all treatments, with mean differences among them. In PepGMV-infected plants, the viral DNA titer was up to 25 times lower than the viral DNA detected in plants inoculated with the K47 strain, and 9 and 17 times lower than in those treated with the K46 and M9 strains, respectively (Figure 3). In contrast, a significant reduction in the viral accumulation was observed in plants inoculated with the Bacillus spp. K47, K46, and M9 at 14 and 21 dpi. The viral accumulation of PepGMV in plants without the inoculation of Bacillus spp. K47, K46, and M9 increased over time; the highest values were observed at 7 dpi and then decreased at 14 and 21 dpi, with mean differences among treatments (Figure 3). These results strongly suggest that the strains of Bacillus spp. are involved in the reduction in the viral titer in PepGMV-infected plants.

2.4. Effect of Plan Inoculation with Bacillus in Gene Expression of Genes Related with the ISR

After infection with PepGMV, the expression levels of the CcNPR1 gene increased in pepper plants treated with Bacillus. A 3-fold increase was observed in leaves from inoculated plants with B. cereus K46 when compared to the mock treatment at 2 h post inoculaction (hpi). The expression levels of the CcNPR1 gene were significantly higher in plants inoculated with B. subtilis K47 at 24 hpi (Figure 4A), with a 19-fold increase when compared to mock-treated plants. The expression levels of CcNPR1 decreased as the PepGMV infection progressed in Bacillus-treated plants, although in PepGMV-inoculated plants without Bacillus, a 9.5-fold increase in CcNPR1 was observed at 7 dpi when compared to the mock treatment (Figure 4B). The aforementioned results suggest that treatments with B. cereus K46 and B. subtilis K47 sharply increased CcNPR1 gene expression in pepper plants infected with PepGMV, and the increase will depend on the strain used.
Gene expression levels of CcPR10 gradually increased in plants treated with B. subtilis K47, which showed a 10-fold increase and 190-fold increase at 8 and 12 hpi, respectively, when compared to the mock treatments (Figure 4C). The CcPR10 gene expression levels showed a 30-fold increase in plants treated with Bacillus spp. M9 at 21 dpi, when compared to mock treatments (Figure 4D). These results indicate an involvement of the CcPR10 gene during the early stages of the PepGMV infection in plants inoculated with B. subtilis K47.
CcCOI1 gene expression increased significantly at 24 hpi in leaves treated with B. subtilis K47 and Bacillus spp. M9 when compared to mock-treated plants, with a 16- and 57-fold increase (Figure 4E), respectively. CcCOI1 gene expression levels remained significantly higher in pepper plants treated with Bacillus spp. M9, when compared to mock treatments with a 16- and 27-fold increase at 24 hpi and 21 dpi, respectively (Figure 4F,G). The above results indicate that treatment with Bacillus spp. markedly increased the expression of the CcCOI1 gene in pepper plants infected with PepGMV progressively at more advanced stages of the disease.

2.5. Greenhouse Yield of Plants during the Bacillus spp.–C. chinensee–PepGMV Interaction

The agronomic traits evaluated at the greenhouse level were total yield, fruit number, and fruit weight, which were quantified at 200 dpi. Plants without Bacillus inoculation (H2O) and plants treated with the K47 strain had the highest yield across all analyzed treatments (Tukey, α = 0.05) (Table 1). The results showed that the yields obtained in plants treated with three strains of Bacillus and inoculated with the PepGMV had mean differences compared to the plants treated with water and the plants inoculated with the virus and without Bacillus spp.
The plants treated with the K47 and M9 strains produced a total number of fruits and had fruit weights statistically similar to control plants (H2O) (Table 1). All plants pretreated with Bacillus spp. strains produced fruits of higher weight than plants inoculated only with PepGMV (Table 1). Taken together, these results showed that seeds of C. chinense treated with different strains of Bacillus spp. increased the habanero pepper greenhouse production in plants infected with PepGMV (Table 1).

3. Discussion

In this study, our results indicate that the accumulation of PepGMV DNA increased over time in plants without Bacillus. These results have been reported previously in symptomatic pepper leaves infected with PepGMV, which showed a high accumulation of viral DNA and RNA, due to high rates of replication and transcription [7]. In contrast, in this study, we observed that in plants treated with Bacillus spp., the PepGMV viral titer and the symptoms decreased over time. Different reports demonstrate that inoculation with Bacillus spp. can reduce viral replication in infected plants [26,37]. Viral replication and movement are fundamental processes in the cycle of the disease; if both are affected, the result is a low viral concentration, and as a consequence, a decrease in symptoms [38]. Given that the PepGMV infection is associated with mechanical wounding, a mock treatment was prepared; during the early phases of the experiments, increases in the CcNPR1, CcPR10, and CcCOI1 was observed when compared to plants without mechanical damage. The observed up-regulations of these genes suggest that they are responsive, to some extent, to mechanical damage; this type of damage is caused by insect vectors (B. tabaci) during viral transmission [10,15].
Some studies indicate that NPR1 is a plant gene, and it has been observed that its expression is at low levels in healthy plants [32]. Moreover, the evidence demonstrates that NPR1 is a fundamental component of the pathway of the SA-mediated signal transduction pathway, inducing defense genes [16,39]. We observed that in plants inoculated with B. cereus K46, CcNPR1 levels sharply increase at 2 hpi, and these increases are statistically higher than in plants infected with PepGMV and not inoculated with Bacillus strains. It was suggested that during ISR by Bacillus spp. in C. chinense, CcNPR1 is involved in the defense response to PepGMV immediately after infection, and their behavior is specific to each Bacillus strain. Although most strains of B. cereus are recognized as pathogenic microbes for humans, there are some strains used in the bio-fertilization and biological control of plant viruses [40,41,42]. In contrast, in plants infected with PepGMV and without Bacillus inoculation, the highest expression of CcNPR1 was observed at 7 dpi. Similar studies report that in C. annuum plants infected with Euphorbia mosaic virus-Yucatan Peninsula (EuMV-YP), the expression of NPR1 increased at 7 dpi [32]. After the accumulation of SA in response to a pathogen attack, NPR1 oligomer disassociates in the cytoplasm, and after this, the monomer is translocated into the nucleus, and together with TGA transcription factors, they induce the pathogenesis-related gene (PR’s) expression [38,39].
The PR protein family has a complex pattern of expression, and many members of this family of genes are differentially expressed under conditions of environmental stress and in response to pathogen attacks within the signaling pathway systemic acquired resistance (SAR) [24,39]. In this study, the transcript levels of CcPR10 were highest at 8 hpi in plants inoculated with B. subtilis K47, and its expression was statistically higher than in plants without rhizobacteria. In this way, several studies have shown that the Tobacco mosaic virus (TMV), Cucumber mosaic virus (CMV), Tobacco etch virus (TEV), and Tobacco vein mottling virus (TVMV) trigger the activation of PR10, and this protein functions as a ribonuclease [43,44]. Furthermore, it was demonstrated that the inoculation of leaves in C. annuum L. ‘Bukwang’ with B. amyloliquefaciens 5B6 caused an increased in the expression of PR10 during CMV infection [45]. Therefore, PR10 could not only be activated during the SAR, but it also participates in the ISR in viral diseases.
It has been known that the COI1 gene is the central regulatory component of the signaling pathway of SA/JA, and it is required for the defense responses of plants [28,39]. Recently, studies have reported that the C2 protein of geminivirus suppresses the defense response signaling pathway mediated by jasmonates because this protein affects the functioning of complex SCFCOI1 [46,47]. However, our data indicate that the CcCOI1 levels of C. chinense plants treated with Bacillus spp. increased consistently for 7 dpi during the disease caused by PepGMV. Similarly, in tobacco plants infected with TMV and inoculated with Bacillus spp., the activation of the genes NtPR1, NtCOI1, and NtNPR1 has been observed, generating a modulated ISR by Bacillus spp. [28]. These results suggest that despite the disease caused by PepGMV, Bacillus spp. promotes ISR through increased levels of transcripts of CcCOI1.
Multiple investigations on plant–rhizobacteria–pathogen interactions have demonstrated the benefits in disease resistance and increased crop yield [48,49]. In this study, we consistently observed that plants treated with B. subtilis K47 had less severity of symptoms and better fruit quality (larger fruits) despite viral infection than healthy plants. In this sense, in tomato plants treated with the B. amyloliquefaciens strain MBI600, resistance to Tomato spotted wilt virus and Potato virus Y was increased through the salicylic acid pathway [1]. Similarly, the application of B. velezensis CE 100 on strawberry plants controls fungal diseases and improves yield [50].
Previously, our studies showed that B. subtilis K47 increased the photosynthetic parameters of the plant and prepared it for stress situations, such as viral diseases. Furthermore, this study reveals that inoculation with B. subtilis K47 increases the defense gene expression of CcNPR1, CcPR10, and CcCOI1, decreases the viral titer and severity of symptoms, and increases yield. It is evident that Bacillus activates ISR through a complex network of mechanisms, not only defending the plant from pathogen attacks, but also allow it to continue producing fruit. These results could be interesting in evaluating their effect as complex bacteria on the response to biotic and abiotic stresses during agricultural sustainable production.

4. Materials and Methods

4.1. Selection of Plant Material, Germination, and Growth Conditions

Seeds of C. chinense, accession H-224, were used [51]. The disinfection procedure consisted of the immersion of C. chinense seeds in a solution of commercial bleach (sodium hypoclorite, 2% v/v) for 15 min; the seeds were then rinsed three times with sterile distilled water and air-dried in absorbent paper. The seed germination was performed in trays with 200 cavities filled with sterile substrate (peat moss). The substrate was moistened up to field capacity with distilled sterile water. The trays were placed in a growth room (25 ± 2 °C, photoperiod of 16/8 light/dark), and they were watered every two days and leaf-fertilized weekly at a dose of 1 gL−1 (UltraFol, Biochem systems, Querétaro, México. After 18 days of germination, the seedlings were transferred into 500 mL Styrofoam cups, filled with sterile substrate, and maintained in the same controlled conditions [36].

4.2. Bacillus sp. Inoculation

The strains of B. cereus K46, Bacillus spp. M9 (a mixture of B. subtilis and B. amyloliquefaciens), and B. subtilis K47 were used [35,36]. All the Bacillus strains were gown in Luria-Bertoni Broth (37 °C, 24 h) under agitation. The cell density was adjusted to 1 × 108 cells mL−1, 10 mL saline solution (0.8% v/v), and the inoculation of seeds was performed as described previously [35].

4.3. PepGMV Infection by Bioballistics

Seedlings obtained from C. chinense seeds inoculated with the previously described Bacillus strains were infected with PepGMV by bioballistics, when they had 3 to 4 true leaves. A total of 1 µm gold particles (BioRad, Hercules, CA, USA) was mixed with 5 µg of DNA from each hemidimer (A and B), as described by Carrillo-Tripp et al. [52]. The treatments consisted of: (1) H2O (control); (2) Mock (control); (3) PepGMV; (4) B. subtilis K47 + PepGMV; (5) B. cereus K46 + PepGMV; (6) Bacillus spp. M9 + PepGMV. The mock treatment consisted of bombarding the seedlings with 1 µm gold particles without viral DNA [52,53]. The treated plants were grown under controlled conditions (25 ± 2 °C, photoperiod of 16/8 light/dark) for 28 days post-inoculation (dpi) with PepGMV [36].

4.4. Severity Scale in C. chinense Plants under Controlled Conditions

The symptoms caused in C. chinense seedlings bioballistically infected with PepGMV were evaluated at 9 and 15 dpi in a growth room under controlled conditions, the scale of the severity of the symptoms was modified from Samaniego-Gámez et al. [36], with the following values: 1. Golden mosaics; 2. Golden mosaics and leave distortion; 3. Golden mosaics, leave distortion, and chlorosis; 4. Golden mosaics, leave distortion, chlorosis, and leaf curling. The severity analyses were assessed from ten observations per treatment [54].

4.5. Viral Titer Determination in C. chinense

Leaves of C. chinense from systemically infected plants with PepGMV were sampled (1 g), and the total DNA was isolated with CTAB, as described by Doyle and Doyle [55] without modifications. The detection reactions for the virus were performed within a thermalcycler (TC-412, Techne, Bibby Scientific Ltd., Chicago, IL, USA), using a 100 ng of total DNA and primers that targeted the AC2 gene (Table 2). The amplification conditions consisted of: 1 cycle at 94 °C (5 min), 35 cycles at 94 °C (30 s), 58 °C (30 s), and 72 °C (30 s), with an extension of 72 °C (10 min). The viral quantification was performed by quantitative PCR (qPCR) in a StepOne Real-Time PCR system (Applied Biosystems, Life Technologies, San Francisco, CA, USA), using SYBRGreen qPCR kit Platinum SuperMix-UDG (11733046, Invitrogen, Carlsbad, CA, USA). The real-time thermalcycler conditions were: 1 cycle at 94 °C (5 min), followed by 35 cycles at 94 °C (30 s), 58 °C (30 s), and 72 °C (30 s).
A gene normalization analysis was performed in order to determine the most stable housekeeping genes, such as Actin, 18S, Gliceraldehyde-3-phosphate-dehydrogensae, Ubiquitin, and β-Tubulin, with the geNorm software (v.3.0, qBASE, Beavercreek, OH, USA) The normalization showed that β-Tubulin was the most stable gene among the samples, which agrees with previous reports in Capsicum [56,57]. The viral titter was determined with the 2−ΔΔCt method [56,58], normalized with β-tubulin (Table 2), and expressed as RDA.

4.6. Relative Expression of CcNPR1, CcPR10, and CcCOI1 by Real-Time PCR

To determine the transcript levels of CcNPR1, CcPR10, and CcCOI1 genes, leaf tissue was collected during the time course of the disease, 0 h before infecting with the virus, 2, 4, 8, 12, and 24 h after infection with PepGMV, and 7, 14, and 21 days after infection with PepGMV. Total RNA was isolated from leaves with the TRIZOL reagent, as described by Chomczynski and Sacchi [44]. The isolated RNA was treated with TURBO DNase (2238, Ambion, Life Technologies, Sunnyvale, CA, USA), and 2.5 µg was used for the cDNA synthesis with the SuperScript III Reverse Transcriptase (18080-044, Invitrogen, Carlsbad, CA, USA) and oligodT18 (18418-012, Invitrogen, Carlsbad, CA, USA). The transcript quantification was performed in a StepOne Applied Biosystems Real-Time PCR system (Applied Biosystems, Life Technologies, Carlsbad, CA, USA), using SYBRGreen qPCR kit Platinum SuperMix-UDG (11733046, Invitrogen, Carlsbad, CA, USA) with 100 ng of total cDNA. Transcript quantification conditions for CcNPR1: 1 cycle of 94 °C (5 min), 35 cycles of 95 °C (30 s), 55 °C (30 s), and 72 °C (30 s). Transcript quantification conditions for CcPR10: 1 cycle of 94 °C (5 min), 35 cycles of 95 °C (30 s), 58 °C (30 s), and 72 °C (30 s). Transcript quantification conditions for CcCOI1: 1 cycle of 94 °C (5 min), 35 cycles of 95 °C (30 s), 58 °C (30 s), 72 °C (30 s). The results were normalized with β-tubulin (Table 2) and expressed as relative transcript levels with the 2−ΔΔCt method [56,57,58].

4.7. Evaluation of Agronomic Parameters

Plants at 28 dpi were transferred into black polyethylene bags (400 gauge) of 5 kg capacity (35 cm diameter, 40 cm height) filled with sterile substrate, and maintained in a greenhouse under controlled conditions (30 ± 2 °C, 65 ± 3% HR and 1100 mmol luminous intensity). The agronomic parameters were performed as previously described [36].

4.8. Experimental Design

A complete randomized design was used with 30 plants per treatment. For qPCR experiments, three biological replicates per treatment were analyzed. PCR products were cloned, sequenced, and compared via nucleotide BLAST in the NCBI. The detection of mean differences in each treatment was examined by an ANOVA with the Tukey’s HSD test at p ≤ 0.05 (Statistica, v.7.0.0, StatSoft Hamburg, Germany).

5. Conclusions

The seed inoculation with Bacillus promotes the ISR in C. chinense plants, which is reflected in the reduction in the viral accumulation and the symptom severity, which suggests that Bacillus could participate in the ISR through various mechanisms, such as the inhibition of the viral replication and an increase in the transcription rate of defense genes. Therefore, the ISR is a mechanism that could be implemented in disease management programs in sustainable agriculture. Future research should be focused on the study of the viral movement in Bacillus-treated plants and the transcriptional profile of the Bacillus–plant–geminivirus interaction in order to elucidate the mechanisms involved at transcript and the protein profile of this type of interaction.

Author Contributions

Conceptualization, B.Y.S.-G., R.G.-H., O.A.M.-V. and J.M.T.-S.; methodology, R.E.V.-G., B.Y.S.-G., O.A.M.-V., H.d.J.V.-A., L.C.D. and C.H.-Z.; formal analysis, B.Y.S.-G., L.L.-M., F.N.-R., Y.M.-G. and A.R.-R.; investigation, B.Y.S.-G., R.G.-H. and R.E.V.-G.; resources, J.M.T.-S. and O.A.M.-V.; writing—original draft preparation, B.Y.S.-G., O.A.M.-V., F.N.-R., C.H.-Z. and R.G.-H.; writing—review and editing, B.Y.S.-G., R.E.V.-G. and H.d.J.V.-A.; software, S.U.S.-G.; funding acquisition, J.M.T.-S.; experimental procedures, B.Y.S.-G., Y.M.-G. and R.E.V.-G. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Mexico National Council of Science and Technology (CONACYT) (CVU 386492).

Data Availability Statement

Not applicable.

Acknowledgments

Jorge Kantún-Can for his support in the field experiments. Esaú Ruiz-Sanchez and Jairo Cristóbal Alejo for his support during the elaboration of the severity scale. Francisco Javier Garcia-Villalobos for his support in the standardization procedures during the qPCR experiments.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Beris, D.; Theologidis, I.; Skandalis, N.; Vassilakos, N. Bacillus amyloliquefaciens strain MBI600 induces salicylic acid dependent resistance in tomato plants against Tomato spotted wilt virus and Potato virus Y. Sci. Rep. 2018, 8, 10320. [Google Scholar] [CrossRef] [PubMed]
  2. International Committee of Taxonomy of Virus (ICTV). Available online: https://talk.ictvonline.org/ictv-reports/ictv_online_report/ssdna-viruses/w/geminiviridae/479/member-species-begomovirus (accessed on 15 May 2020).
  3. Guevara-Olvera, L.; Ruíz-Nito, M.L.; Rangel-Cano, R.M.; Torres-Pacheco, I.; Rivera-Bustamante, R.F.; Muñoz-Sánchez, C.I.; González-Chavira, M.M.; Cruz-Hernandez, A.; Guevara-Gonzalez, R.G. Expression of a germin-like protein gene (CchGLP) from a geminivirus-resistant pepper (Capsicum chinense Jacq.) enhances tolerance to geminivirus infection in transgenic tobacco. Physiol. Mol. Plant Pathol. 2012, 78, 45–50. [Google Scholar] [CrossRef]
  4. Mejía-Teniente, L.M.; Joaquin-Ramos, A.J.; Torres-Pacheco, I.; Rivera-Bustamante, R.F.; Guevara-Olvera, L.; Rico-García, E.; Guevara-Gonzalez, R.G. Silencing of a Germin-Like Protein Gene (CchGLP) in Geminivirus-Resistant Pepper (Capsicum chinense Jacq.) BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV. Viruses 2015, 7, 6141–6151. [Google Scholar] [CrossRef]
  5. Brown, J.K.; Campodionico, O.P.; Nelson, M.R. A whitefly-transmitted geminivirus from peppers with tiger disease. Plant Dis. 1989, 73, 610. [Google Scholar] [CrossRef]
  6. Brown, J.K.; Idris, A.M.; Ostrow, K.M.; Goldberg, N.; French, R.; Stenger, D.C. Genetic and phenotypic variation of the Pepper golden mosaic virus complex. Phytopathology 2005, 95, 1217–1224. [Google Scholar] [CrossRef]
  7. Ceniceros-Ojeda, E.A.; Rodríguez-Negrete, E.A.; Rivera-Bustamante, R.F. Two populations of viral minichromosomes are present in a geminivirus-infected plant showing symptom remission (recovery). J. Virol. 2016, 90, 3828–3838. [Google Scholar] [CrossRef]
  8. Saavedra, D.L.T.; Bustamante, R.F.R.; Neria, M.A.G. Veinte años de investigación con Geminivirus en vegetales en Guanajuato. Acta Univ. 2010, 3, 84–92. [Google Scholar]
  9. Meneses-Lazo, R.E.M.; Garruña, R. The habanero pepper (Capsicum chinense Jacq.) As a study plant model in Mexico. Trop. Subtrop. Agroecosystems 2020, 23, 1. [Google Scholar]
  10. Góngora-Castillo, E.; Ibarra-Laclette, E.; Trejo-Saavedra, D.L.; Rivera-Bustamante, R.F. Transcriptome analysis of symptomatic and recovered leaves of geminivirus-infected pepper (Capsicum annuum). Virol. J. 2012, 9, 295. [Google Scholar] [CrossRef]
  11. Trejo-Saavedra, D.L.; García-Neria, M.A.; Rivera-Bustamante, R.F. Benzothiadiazole (BTH) induces resistance to Pepper golden mosaic virus (PepGMV) in pepper (Capsicum annuum L.). Biol. Res. 2013, 46, 333–340. [Google Scholar] [CrossRef]
  12. Rubio, L.; Galipienso, L.; Ferriol, I. Detection of Plant Viruses and Disease Management: Relevance of Genetic Diversity and Evolution. Front. Plant Sci. 2020, 11, 1092. [Google Scholar] [CrossRef]
  13. Hernández, J.A.; Díaz-Vivancos, P.; Rubio, M.; Olmos, E.; Ros-Barceló, A.; Martínez-Gómez, P. Long-term Plum pox virus infection produces an oxidative stress in a susceptible apricot, Prunus americana, cultivar but not in a resistant cultivar. Physiol. Plant 2006, 126, 140–152. [Google Scholar] [CrossRef]
  14. Faria, M.; Wraight, S.P. Biological control of Bemisia tabaci with fungi. Crop Prot. 2001, 20, 767–778. [Google Scholar] [CrossRef]
  15. Musser, R.O.; Hum-Musser, S.M.; Gallucci, M.; DesRochers, B.; Brown, J.K. Microarray Analysis of Tomat Plants Exposed to the Nonviruliferous or Viruliferous Whitefly Vector Harboring Pepper golden mosaic virus. J. Insect Sci. 2014, 14, 1–10. [Google Scholar] [CrossRef] [PubMed]
  16. Choudhary, D.K.; Johri, B.N. Interactions of Bacillus spp. and plants—With special reference to induced systemic resistance (ISR). Microbiol. Res. 2009, 164, 493–513. [Google Scholar] [CrossRef] [PubMed]
  17. Beneduzi, A.; Ambrosini, A.; Passaglia, L.M.P. Plant growth-promoting rhizobacteria (PGPR): Their potential as antagonists and biocontrol agents. Genet. Mol. Biol. 2012, 35, 1044–1051. [Google Scholar] [CrossRef]
  18. Domenech, J.; Ramos, S.B.; Probanza, A.; Lucas, G.J.A.; Gutierrez, M.F.J. Elicitation of systemic resistance and growth promotion of Arabidopsis thaliana by PGPRs from Nicotiana glauca: A study of the putative induction pathway. Plant Soil 2007, 290, 43–50. [Google Scholar] [CrossRef]
  19. Mehta, P.; Walia, A.; Kulshrestha, S.; Chauhan, A.; Shirkot, C.K. Efficiency of plant growth-promoting P-solubilizing Bacillus circulans CB7 for enhancement of tomato growth under net house conditions. J. Basic Microb. 2015, 55, 33–44. [Google Scholar] [CrossRef]
  20. Kang, S.M.; Radhakrishnan, R.; You, Y.H.; Joo, G.J.; Lee, I.J.; Lee, K.E.; Kim, J.H. Phosphate Solubilizing Bacillus megaterium mj1212 Regulates Endogenous Plant Carbohydrates and Amino Acids Contents to Promote Mustard Plant Growth. Indian J. Microbiol. 2014, 54, 427–433. [Google Scholar] [CrossRef]
  21. Talboys, P.J.; Owen, D.W.; Healey, J.R.; Withers, P.J.A.; Jones, D.L. Auxin secretion by Bacillus amyloliquefaciens FZB42 both stimulates root exudation and limits phosphorus uptake in Triticum aestivum. BMC Plant Biol. 2014, 14, 51. [Google Scholar] [CrossRef]
  22. Hanif, M.K.; Hameed, S.; Imran, A.; Naqqash, T.; Shahid, M.; Van Elsas, J.D. Isolation and characterization of a β-propeller gene containing phosphobacterium Bacillus subtilis strain KPS-11 for growth promotion of potato (Solanum tuberosum L.). Front. Microbiol. 2015, 6, 583. [Google Scholar] [CrossRef] [PubMed]
  23. Shao, J.; Xu, Z.; Zhang, N.; Shen, Q.; Zhang, R. Contribution of indole-3-acetic acid in the plant growth promotion by the rhizospheric strain Bacillus amyloliquefaciens SQR9. Biol. Fertil. Soils 2015, 51, 321–330. [Google Scholar] [CrossRef]
  24. Yu, Y.; Gui, Y.; Li, Z.; Jiang, C.; Guo, J.; Niu, D. Induced Systemic Resistance for Improving Plant Immunity by Beneficial Microbes. Plants 2022, 11, 386. [Google Scholar] [CrossRef] [PubMed]
  25. Murphy, J.F.; Reddy, M.S.; Ryu, C.M.; Kloepper, J.W.; Li, R. Rhizobacteria-mediated growth promotion of tomato leads to protection against Cucumber mosaic virus. Phytopathology 2003, 93, 1301–1307. [Google Scholar] [CrossRef] [PubMed]
  26. Choi, H.K.; Song, G.C.; Yi, H.S.; Ryu, C.M. Field Evaluation of the Bacterial Volatile Derivative 3-Pentanol in Priming for Induced Resistance in Pepper. J. Chem. Ecol. 2014, 40, 882–892. [Google Scholar] [CrossRef]
  27. Zehnder, G.W.; Yao, C.; Murphy, J.F.; Sikora, E.R.; Kloepper, J.W. Induction of resistance in tomato against cucumber mosaic cucumovirus by plant growth-promoting rhizobacteria. Biocontrol 2000, 45, 127–137. [Google Scholar] [CrossRef]
  28. Wang, S.; Wu, H.; Qiao, J.; Ma, L.; Liu, J.; Xia, Y.; Gao, X. Molecular Mechanism of Plant Growth Promotion and Induced Systemic Resistance to Tobacco Mosaic Virus by Bacillus spp. J. Microbiol. Biotechnol. 2009, 19, 1250–1258. [Google Scholar] [CrossRef]
  29. Derksen, H.; Rampitschb, C.; Daayf, F. Signaling cross-talk in plant disease resistance. Plant Sci. 2013, 207, 79–87. [Google Scholar] [CrossRef]
  30. Jankiewicz, U.; Koltonowicz, M. The Involvement of Pseudomonas Bacteria in Induced Systemic Resistance in Plants (Review). Appl. Biochem. Microbiol. 2012, 48, 244–249. [Google Scholar] [CrossRef]
  31. Samaniego-Gámez, B.Y.; Reyes-Ramírez, A.; Moreno-Valenzuela, O.A.; Tun-Suárez, J.M. Induced systemic resistance against plant viruses elicited by inoculation with rhizobacteria Bacillus spp. Rev. Protección Veg. 2017, 32, 10–22. [Google Scholar]
  32. Luna-Rivero, M.S.; Hernández-Zepeda, C.; Villanueva-Alonzo, H.; Minero-García, Y.; Castell-González, S.E.; Moreno-Valenzuela, O.A. Expression of genes involved in the salicylic acid pathway in type h1 thioredoxin transiently silenced pepper plants during a begomovirus compatible interaction. Mol. Genet. Genom. 2015, 291, 819–830. [Google Scholar] [CrossRef] [PubMed]
  33. Kumar, S.; Chauhan, P.S.; Agrawal, L.; Raj, R.; Srivastava, A.; Gupta, S.; Mishra, S.K.; Yadav, S.; Singh, P.C.; Raj, S.K.; et al. Paenibacillus lentimorbus Inoculation Enhances Tobacco Growth and Extenuates the Virulence of Cucumber mosaic virus. PLoS ONE 2016, 11, e0149980. [Google Scholar] [CrossRef] [PubMed]
  34. Kanchana, D.; Jayanthi, M.; Usharani, G.; Saranraj, P.; Sujitha, D. Interaction effect of combined inoculation of PGPR on growth and yield parameters of Chilli Var K1 (Capsicum annuum L.). Int. J. Microbiol. Res. 2014, 5, 144–151. [Google Scholar]
  35. Samaniego-Gámez, B.Y.; Garruña, R.; Tun-Suárez, J.M.; Kantun-Can, J.; Reyes-Ramírez, A.; Cervantes-Díaz, L. Bacillus spp. inoculation improves photosystem II efficiency and enhances photosynthesis in pepper plants. Chil. J. Agric. Res. 2016, 76, 409–416. [Google Scholar] [CrossRef]
  36. Samaniego-Gámez, B.Y.; Garruña, R.; Tun-Suarez, J.M.; Moreno-Valenzuela, O.A.; Reyes-Ramirez, A.; Valle-Gough, R.E.; Ail-Catzim, C.E.; Toscano-Palomar, L. Healthy Photosynthetic Mechanism Suggests ISR Elicited by Bacillus spp. in capsicum chinense Plants Infected with PepGMV. Pathogens 2021, 10, 455. [Google Scholar] [CrossRef] [PubMed]
  37. Elbeshehy, E.K.F.; Youssef, S.A.; Elazzazy, A.M. Resistance induction in pumpkin Cucurbita maxima L. against Watermelon mosaic potyvirus by plant growth-promoting rhizobacteria. Biocont. Sci. Technol. 2015, 25, 525–542. [Google Scholar] [CrossRef]
  38. García-Neria, M.A.; Rivera-Bustamante, R.F. Characterization of Geminivirus resistance in an accession of Capsicum chinense Jacq. Mol. Plant Microbe Interact. 2011, 24, 172–182. [Google Scholar] [CrossRef]
  39. Chen, H.; Li, M.; Qi, G.; Zhao, M.; Liu, L.; Zhang, J.; Fu, Z.Q. Two interacting transcriptional coactivators cooperatively control plant immune responses. Sci. Adv. 2021, 7, eabl7173. [Google Scholar] [CrossRef]
  40. Kumar, P.; Pahal, V.; Gupta, A.; Vadhan, R.; Chandra, H.; Dubey, R.C. Effect of silver nanoparticles and Bacillus cereus LPR2 on the growth of Zea mays. Sci. Rep. 2020, 10, 20409. [Google Scholar] [CrossRef]
  41. Damayanti, T.A.; Katerina, T. Protection of hot pepper against multiple infection of viruses by utilizing root colonizing bacteria. J. ISSAAS 2008, 14, 92–100. [Google Scholar]
  42. Zeng, Q.; Xie, J.; Li, Y.; Gao, T.; Xu, C.; Wang, Q. Comparative genomic and functional analyses of four sequenced Bacillus cereus genomes reveal conservation of genes relevant to plant-growth-promoting traits. Sci. Rep. 2018, 8, 17009. [Google Scholar] [CrossRef] [PubMed]
  43. Xu, P.; Blancaflor, E.B.; Roossinck, M.J. In spite of induced multiple defense responses, tomato plants infected with Cucumber mosaic virus and D satellite RNA succumb to systemic necrosis. Mol. Plant Microbe Interact. 2003, 16, 467–476. [Google Scholar] [CrossRef] [PubMed]
  44. Park, C.J.; Kim, K.J.; Shin, R.; Park, J.M.; Shin, Y.C.; Paek, K.H. Pathogenesis-related protein 10 isolated from hot pepper functions as a ribonuclease in an antiviral pathway. Plant J. 2004, 37, 186–198. [Google Scholar] [CrossRef] [PubMed]
  45. Lee, G.H.; Ryu, C.M. Spraying of leaf-colonizing Bacillus amyloliquefaciens protects pepper from Cucumber mosaic virus. Plant Dis. 2016, 100, 2099–2105. [Google Scholar] [CrossRef]
  46. Lozano-Duran, R.; Rosas-Diaz, T.; Gusmaroli, G.; Luna, A.P.; Taconnat, L.; Deng, X.W.; Bejarano, E.R. Geminiviruses subvert ubiquitination by altering CSN-mediated derubylation of SCF E3 ligase complexes and inhibit jasmonate signaling in Arabidopsis thaliana. Plant Cell 2011, 23, 1014–1032. [Google Scholar] [CrossRef]
  47. Rosas-Díaz, T.; Macho, A.P.; Beuzón, C.R.; Lozano-Durán, R.; Bejarano, E.R. The C2 Protein from the Geminivirus Tomato Yellow Leaf Curl Sardinia Virus Decreases Sensitivity to Jasmonates and Suppresses Jasmonate-Mediated Defences. Plants 2016, 5, 8. [Google Scholar] [CrossRef]
  48. Dadrasnia, A.; Usman, M.M.; Omar, R.; Ismail, S.; Abdullah, R. Potential use of Bacillus genus to control of bananas diseases: Approaches toward high yield production and sustainable management. J. King Saud Univ.-Sci. 2020, 32, 2336–2342. [Google Scholar] [CrossRef]
  49. Miljaković, D.; Marinković, J.; Balešević-Tubić, S. The Significance of Bacillus spp. in Disease Suppression and Growth Promotion of Field and Vegetable Crops. Microorganisms 2020, 8, 1037. [Google Scholar] [CrossRef]
  50. Hong, S.; Kim, T.Y.; Won, S.-J.; Moon, J.-H.; Ajuna, H.B.; Kim, K.Y.; Ahn, Y.S. Control of Fungal Diseases and Fruit Yield Improvement of Strawberry Using Bacillus velezensis CE 100. Microorganisms 2022, 10, 365. [Google Scholar] [CrossRef]
  51. Latournerie-Moreno, L.; Lopez-Vázquez, J.S.; Castañón-Nájera, G.; Mijangos-Cortéz, J.O.; Espadas-Villamil, G.; Pérez-Gutiérrez, A.; Ruiz-Sánchez, E. Agronomic evaluation of germplasm of habanero pepper (Capsicum chinense Jacq.). Agroproductividad 2015, 1, 24–29. [Google Scholar]
  52. Carrillo-Tripp, J.; Lozoya-Gloria, E.; Rivera-Bustamante, R.F. Symptom remission and specific resistance of pepper plants after infection by Pepper golden mosaic virus. Phytopathology 2007, 97, 51–59. [Google Scholar] [CrossRef]
  53. Villanueva-Alonzo, H.J.; Us-Camas, R.Y.; López-Ochoa, L.A.; Robertson, D.; Guerra-Peraza, O.; Minero-García, Y.; Moreno-Valenzuela, O.A. A new virus-induced gene silencing vector based on Euphorbia mosaic virus-Yucatan peninsula for NPR1 silencing in Nicotiana benthamiana and Capsicum annuum var. Anaheim. Biotechnol. Lett. 2013, 35, 811–823. [Google Scholar] [CrossRef]
  54. Anaya-López, J.L.; Torres-Pacheco, I.; González-Chavira, M.; Garzon-Tiznado, J.A.; Pons-Hernandez, J.L.; Guevara-González, R.G.; Muñoz-Sánchez, C.I.; Guevara-Olvera, L.; Rivera-Bustamante, R.F.; Hernández-Verdugo, S. Resistance to Geminivirus Mixed Infections in Mexican Wild Peppers. HortScience 2003, 38, 251–255. [Google Scholar] [CrossRef]
  55. Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
  56. Wan, H.; Yuan, W.; Ruan, M.; Ye, Q.; Wang, R.; Li, Z.; Zhou, G.; Yao, Z.; Zhao, J.; Liu, S.; et al. Identification of reference genes for reverse transcription quantitative real-time PCR normalization in pepper (Capsicum annuum L.). Biochem. Biophys. Res. Commun. 2011, 416, 24–30. [Google Scholar] [CrossRef] [PubMed]
  57. Valle-Gough, R.E.; Avilés-Viñas, S.A.; López-Erosa, S.; Canto-Flick, A.; Gómez-Uc, E.; Sáenz-Carbonell, L.A.; Ochoa-Alejo, N.; Santana-Buzzy, N. Polyamines and WOX genes in the recalcitrance to plant conversion on of somatic embryos of Habanero pepper (Capsicum chinense Jacq.). Afr. J. Biotech. 2015, 14, 569–581. [Google Scholar]
  58. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 4, 402–408. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Symptom severity scale observed during infection caused by PepGMV in Capsicum chinense Jacq. (A) Pepper plants showing symptoms associated with each severity level from a scale from 1 to 4, and (B) relative DNA-PepGMV accumulation detected in pepper plants from each severity level of the scale. Different letters represent mean differences (Tukey, α = 0.05). Error bars represent the mean ± standard error, N = 3 with 3 technical replicates.
Figure 1. Symptom severity scale observed during infection caused by PepGMV in Capsicum chinense Jacq. (A) Pepper plants showing symptoms associated with each severity level from a scale from 1 to 4, and (B) relative DNA-PepGMV accumulation detected in pepper plants from each severity level of the scale. Different letters represent mean differences (Tukey, α = 0.05). Error bars represent the mean ± standard error, N = 3 with 3 technical replicates.
Plants 12 02069 g001
Figure 2. Induced systemic resistance by Bacillus spp. in plants of C. chinense infected with PepGMV. (A) Mock at 7 dpi; (B) Plant infected with PepGMV at 7 dpi; (C) B. subtilis K47-inoculated plant at 7 dpi infected with PepGMV; (D) B. cereus K46-inoculated plant at 7 dpi infected with PepGMV; (E) Bacillus spp. M9-inoculated plant at 7 dpi infected with PepGMV; (F) Mock at 14 dpi; (G) Plant infected with PepGMV at 14 dpi; (H) B. subtilis K47-inoculated plant at 14 dpi infected with PepGMV; (I) B. cereus K46-inoculated plant at 14 dpi infected with PepGMV; (J) Bacillus spp. M9-inoculated plant at 14 dpi infected with PepGMV; (K) Mock at 21 dpi; (L) Plant infected with PepGMV at 21 dpi; (M) B. subtilis K47-inoculated plant at 21 dpi infected with PepGMV; (N) B. cereus K46-inoculated at 21 dpi infected with PepGMV; (O) Bacillus spp. M9-inoculated plant at 21 dpi infected with PepGMV.
Figure 2. Induced systemic resistance by Bacillus spp. in plants of C. chinense infected with PepGMV. (A) Mock at 7 dpi; (B) Plant infected with PepGMV at 7 dpi; (C) B. subtilis K47-inoculated plant at 7 dpi infected with PepGMV; (D) B. cereus K46-inoculated plant at 7 dpi infected with PepGMV; (E) Bacillus spp. M9-inoculated plant at 7 dpi infected with PepGMV; (F) Mock at 14 dpi; (G) Plant infected with PepGMV at 14 dpi; (H) B. subtilis K47-inoculated plant at 14 dpi infected with PepGMV; (I) B. cereus K46-inoculated plant at 14 dpi infected with PepGMV; (J) Bacillus spp. M9-inoculated plant at 14 dpi infected with PepGMV; (K) Mock at 21 dpi; (L) Plant infected with PepGMV at 21 dpi; (M) B. subtilis K47-inoculated plant at 21 dpi infected with PepGMV; (N) B. cereus K46-inoculated at 21 dpi infected with PepGMV; (O) Bacillus spp. M9-inoculated plant at 21 dpi infected with PepGMV.
Plants 12 02069 g002
Figure 3. Viral DNA accumulation in pepper leaves inoculated with M9-PepGMV, K47-PepGMV, K46-PepGMV, and PepGMV. Different letters represent mean differences (Tukey, α = 0.05). Error bars represent the mean ± standard error; N = 3 with 3 technical replicates.
Figure 3. Viral DNA accumulation in pepper leaves inoculated with M9-PepGMV, K47-PepGMV, K46-PepGMV, and PepGMV. Different letters represent mean differences (Tukey, α = 0.05). Error bars represent the mean ± standard error; N = 3 with 3 technical replicates.
Plants 12 02069 g003
Figure 4. Levels of transcripts of CcNPR1 (A,B), CcPR10 (C,D) and CcCOI1 (E,F) in Capsicum chinense Jacq plants inoculated with PepGMV, B. subtilis K47-PepGMV, B. cereus K46-PepGMV, Bacillus spp. M9-PepGMV. Different letters represent mean differences (Tukey, α = 0.05). Error bars represent the mean ± standard error; N = 3 with 3 technical replicates.
Figure 4. Levels of transcripts of CcNPR1 (A,B), CcPR10 (C,D) and CcCOI1 (E,F) in Capsicum chinense Jacq plants inoculated with PepGMV, B. subtilis K47-PepGMV, B. cereus K46-PepGMV, Bacillus spp. M9-PepGMV. Different letters represent mean differences (Tukey, α = 0.05). Error bars represent the mean ± standard error; N = 3 with 3 technical replicates.
Plants 12 02069 g004
Table 1. Average fruit weight (g), yield (g), and number of fruits in three harvests of habanero pepper plants inoculated with different bacterial strains, B. subtilis K47, B. cereus K46, Bacillus spp. M9, and infected with PepGMV. H2O = plants without viral infection and bacterial inoculation. Different letters represent mean differences (Tukey-HSD, α = 0.05).
Table 1. Average fruit weight (g), yield (g), and number of fruits in three harvests of habanero pepper plants inoculated with different bacterial strains, B. subtilis K47, B. cereus K46, Bacillus spp. M9, and infected with PepGMV. H2O = plants without viral infection and bacterial inoculation. Different letters represent mean differences (Tukey-HSD, α = 0.05).
TreatmentMean Fruit Weight (g)Fruits per PlantYield per Plant (g)
H2O6.1 ± 0.05 b52 ± 1.8 c320.75 ± 6.51 c
PepGMV5.3 ± 0.06 b52 ± 1.4 d274 ± 4.263 d
K47-PepGMV7.9 ± 0.05 a57 ± 1.5 a451.75 ± 9.47 a
K46-PepGMV7.6 ± 0.04 c47 ± 1.3 b358.75 ± 8.2 b
M9-PepGMV7.7 ± 0.04 d41 ± 1.1 b314 ± 9.2 c,d
Table 2. Primers used for real-time PCR.
Table 2. Primers used for real-time PCR.
Gene NamePrimer Sequences (5′-3′)Fragment (bp)
PepGMV AC2 [36]GCCTTGTGGAGAGCTAATGC213
TTAGCGCAGTTGATGTGGAG
β-tubulin [56]TGTCCATCTGCTCTCTGTTG204
CACCCCAAGCACAATAAGAC
CcNPR1GAGGTGAGTTATGATGCTCTGG141
AACCAAGAAAGCCACTGCTG
CcPR10GCAGATGGAGGATGTGTTGG147
AGAAGGATTGGTGAGGAGGTAG
CcCOI1TGAAGAAGGTGCGGTTACAC153
ACCAGCCGAAAATCAGACAG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Samaniego-Gámez, B.Y.; Valle-Gough, R.E.; Garruña-Hernández, R.; Reyes-Ramírez, A.; Latournerie-Moreno, L.; Tun-Suárez, J.M.; Villanueva-Alonzo, H.d.J.; Nuñez-Ramírez, F.; Diaz, L.C.; Samaniego-Gámez, S.U.; et al. Induced Systemic Resistance in the Bacillus spp.—Capsicum chinense Jacq.—PepGMV Interaction, Elicited by Defense-Related Gene Expression. Plants 2023, 12, 2069. https://doi.org/10.3390/plants12112069

AMA Style

Samaniego-Gámez BY, Valle-Gough RE, Garruña-Hernández R, Reyes-Ramírez A, Latournerie-Moreno L, Tun-Suárez JM, Villanueva-Alonzo HdJ, Nuñez-Ramírez F, Diaz LC, Samaniego-Gámez SU, et al. Induced Systemic Resistance in the Bacillus spp.—Capsicum chinense Jacq.—PepGMV Interaction, Elicited by Defense-Related Gene Expression. Plants. 2023; 12(11):2069. https://doi.org/10.3390/plants12112069

Chicago/Turabian Style

Samaniego-Gámez, Blancka Yesenia, Raúl Enrique Valle-Gough, René Garruña-Hernández, Arturo Reyes-Ramírez, Luis Latournerie-Moreno, José María Tun-Suárez, Hernán de Jesús Villanueva-Alonzo, Fidel Nuñez-Ramírez, Lourdes Cervantes Diaz, Samuel Uriel Samaniego-Gámez, and et al. 2023. "Induced Systemic Resistance in the Bacillus spp.—Capsicum chinense Jacq.—PepGMV Interaction, Elicited by Defense-Related Gene Expression" Plants 12, no. 11: 2069. https://doi.org/10.3390/plants12112069

APA Style

Samaniego-Gámez, B. Y., Valle-Gough, R. E., Garruña-Hernández, R., Reyes-Ramírez, A., Latournerie-Moreno, L., Tun-Suárez, J. M., Villanueva-Alonzo, H. d. J., Nuñez-Ramírez, F., Diaz, L. C., Samaniego-Gámez, S. U., Minero-García, Y., Hernandez-Zepeda, C., & Moreno-Valenzuela, O. A. (2023). Induced Systemic Resistance in the Bacillus spp.—Capsicum chinense Jacq.—PepGMV Interaction, Elicited by Defense-Related Gene Expression. Plants, 12(11), 2069. https://doi.org/10.3390/plants12112069

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop