High-Throughput Sequencing Identified Distinct Bipartite and Monopartite Begomovirus Variants Associated with DNA-Satellites from Tomato and Muskmelon Plants in Saudi Arabia
Abstract
:1. Introduction
2. Results
2.1. Illumina High-Throughput Data Analysis
2.2. Sequence Comparisons and Identification of Begomoviruses and DNA-Satellites
2.3. Identification of Putative Recombination Events
3. Discussion
4. Materials and Methods
4.1. Plant Samples Collection, DNA Extraction and Detection of Begomovirus Genomes
4.2. Rolling Circle Amplification (RCA) and Next Generation Sequencing
4.3. Sequence Analysis of the NGS Data and Virus Genome Assembly
4.4. PCR-Based Confirmation of Begomovirus Genomic Components
4.5. Determination of Pairwise Nucleotide Sequence Identities
4.6. Evolutionary Relatedness through Phylogenetic Dendrograms
4.7. Estimation of Recombination Breakpoints
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zerbini, F.M.; Briddon, R.W.; Idris, A.; Martin, D.P.; Moriones, E.; Navas-Castillo, J.; Rivera-Bustamante, R.; Roumagnac, P.; Varsani, A.; Consortium, I.R. ICTV virus taxonomy profile: Geminiviridae. J. Gen. Virol. 2017, 98, 131. [Google Scholar] [CrossRef] [PubMed]
- Hanley-Bowdoin, L.; Bejarano, E.R.; Robertson, D.; Mansoor, S. Geminiviruses: Masters at redirecting and reprogramming plant processes. Nat. Rev. Microbiol. 2013, 11, 777–788. [Google Scholar] [CrossRef]
- Fiallo-Olivé, E.; Navas-Castillo, J. Molecular and biological characterization of a New World mono-/bipartite begomovirus/deltasatellite complex infecting Corchorus siliquosus. Front. Microbiol. 2020, 11, 1755. [Google Scholar] [CrossRef] [PubMed]
- Briddon, R.W.; Patil, B.L.; Bagewadi, B.; Nawaz-ul-Rehman, M.S.; Fauquet, C.M. Distinct evolutionary histories of the DNA-A and DNA-B components of bipartite begomoviruses. BMC Evol. Biol. 2010, 10, 97. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, X.; Guo, W.; Li, F.; Sunter, G.; Zhou, X. Geminivirus-associated betasatellites: Exploiting chinks in the antiviral arsenal of plants. Trends Plant Sci. 2019, 24, 519–529. [Google Scholar] [CrossRef]
- Briddon, R.W.; Martin, D.P.; Roumagnac, P.; Navas-Castillo, J.; Fiallo-Olive, E.; Moriones, E.; Lett, J.M.; Zerbini, F.M.; Varsani, A. Alphasatellitidae: A new family with two subfamilies for the classification of geminivirus- and nanovirus-associated alphasatellites. Arch. Virol. 2018, 163, 2587–2600. [Google Scholar] [CrossRef] [Green Version]
- Zaidi, S.; Martin, D.P.; Amin, I.; Farooq, M.; Mansoor, S. Tomato leaf curl New Delhi virus: A widespread bipartite begomovirus in the territory of monopartite begomoviruses. Mol. Plant Pathol. 2017, 18, 901–911. [Google Scholar] [CrossRef] [PubMed]
- Romay, G.; Geraud-Pouey, F.; Chirinos, D.T.; Mahillon, M.; Gillis, A.; Mahillon, J.; Bragard, C. Tomato twisted leaf virus: A novel indigenous new world monopartite begomovirus infecting tomato in Venezuela. Viruses 2019, 11, 327. [Google Scholar] [CrossRef] [Green Version]
- Gilbertson, R.L.; Batuman, O.; Webster, C.G.; Adkins, S. Role of the insect supervectors Bemisia tabaci and Frankliniella occidentalis in the emergence and global spread of plant viruses. Annu. Rev. Virol. 2015, 2, 67–93. [Google Scholar] [CrossRef]
- Rojas, M.R.; Macedo, M.A.; Maliano, M.R.; Soto-Aguilar, M.; Souza, J.O.; Briddon, R.W.; Kenyon, L.; Rivera Bustamante, R.F.; Zerbini, F.M.; Adkins, S. World management of geminiviruses. Annu. Rev. Phytopathol. 2018, 56, 637–677. [Google Scholar] [CrossRef]
- Zhou, Y.-C.; Noussourou, M.; Kon, T.; Rojas, M.; Jiang, H.; Chen, L.-F.; Gamby, K.; Foster, R.; Gilbertson, R. Evidence of local evolution of tomato-infecting begomovirus species in West Africa: Characterization of tomato leaf curl Mali virus and tomato yellow leaf crumple virus from Mali. Arch. Virol. 2008, 153, 693–706. [Google Scholar] [CrossRef] [PubMed]
- Mabvakure, B.; Martin, D.P.; Kraberger, S.; Cloete, L.; van Brunschot, S.; Geering, A.D.W.; Thomas, J.E.; Bananej, K.; Lett, J.M.; Lefeuvre, P.; et al. Ongoing geographical spread of Tomato yellow leaf curl virus. Virology 2016, 498, 257–264. [Google Scholar] [CrossRef] [PubMed]
- Sobh, H.; Samsatly, J.; Jawhari, M.; Najjar, C.; Haidar, A.; Abou-Jawdah, Y. First report of Squash leaf curl virus in cucurbits in Lebanon. Plant Dis. 2012, 96, 1231. [Google Scholar] [CrossRef] [PubMed]
- Sattar, M.N.; Iqbal, Z.; Tahir, M.N.; Ullah, S. The prediction of a new CLCuD epidemic in the Old World. Front. Microbiol. 2017, 8, 631. [Google Scholar] [CrossRef] [Green Version]
- Fontenele, R.S.; Bhaskara, A.; Cobb, I.N.; Majure, L.C.; Salywon, A.M.; Avalos-Calleros, J.A.; Argüello-Astorga, G.R.; Schmidlin, K.; Roumagnac, P.; Ribeiro, S.G. Identification of the begomoviruses squash leaf curl virus and watermelon chlorotic stunt virus in various plant samples in North America. Viruses 2021, 13, 810. [Google Scholar] [CrossRef]
- Dominguez-Duran, G.; Rodriguez-Negrete, E.A.; Morales-Aguilar, J.J.; Camacho-Beltran, E.; Romero-Romero, J.L.; Rivera-Acosta, M.A.; Leyva-Lopez, N.E.; Arroyo-Becerra, A.; Mendez-Lozano, J. Molecular and biological characterization of Watermelon chlorotic stunt virus (WmCSV): An Eastern Hemisphere begomovirus introduced in the Western Hemisphere. Crop Prot. 2018, 103, 51–55. [Google Scholar] [CrossRef]
- Heydarnejad, J.; Mozaffari, A.; Massumi, H.; Fazeli, R.; Gray, A.J.A.; Meredith, S.; Lakay, F.; Shepherd, D.N.; Martin, D.P.; Varsani, A. Complete sequences of tomato leaf curl Palampur virus isolates infecting cucurbits in Iran. Arch. Virol. 2009, 154, 1015–1018. [Google Scholar] [CrossRef]
- Heydarnejad, J.; Hesari, M.; Massumi, H.; Varsani, A. Incidence and natural hosts of Tomato leaf curl Palampur virus in Iran. Australas. Plant Path. 2013, 42, 195–203. [Google Scholar] [CrossRef]
- Idris, A.; Al-Saleh, M.; Piatek, M.J.; Al-Shahwan, I.; Ali, S.; Brown, J.K. Viral metagenomics: Analysis of begomoviruses by illumina high-throughput sequencing. Viruses 2014, 6, 1219–1236. [Google Scholar] [CrossRef] [Green Version]
- Rezk, A.; Alhudaib, K. Genetic diversity of tomato yellow leaf curl-like viruses in Saudi Arabia. J. Plant Sci. 2017, 12, 5–16. [Google Scholar] [CrossRef]
- Sohrab, S.S. Genetic diversity of begomoviruses infecting tomato plant in Saudi Arabia. Saudi J. Biol. Sci. 2020, 27, 222–228. [Google Scholar] [CrossRef] [PubMed]
- Shahid, M.S.; Sattar, M.N.; Iqbal, Z.; Raza, A.; Al-Sadi, A.M. Next-generation sequencing and the CRISPR-Cas nexus: A molecular plant virology perspective. Front. Microbiol. 2021, 11, 609376. [Google Scholar] [CrossRef]
- Morci, H.; Elmulthum, N.; Hadid, M. The role of greenhouses in filling trade gap of tomato crop in Saudi Arabia. Egypt J. Agron. 2020, 42, 197–207. [Google Scholar] [CrossRef]
- Lefeuvre, P.; Martin, D.P.; Harkins, G.; Lemey, P.; Gray, A.J.; Meredith, S.; Lakay, F.; Monjane, A.; Lett, J.-M.; Varsani, A. The spread of tomato yellow leaf curl virus from the Middle East to the world. PLoS Pathog. 2010, 6, e1001164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Al-Ali, E.; Al-Hashash, H.; Ben Heji, A.; Al-Aqeel, H. First report of tomato yellow leaf curl virus infecting cucumber in Kuwait. Plant Dis. 2016, 100, 656. [Google Scholar] [CrossRef]
- Bananej, K.; Shafiq, M.; Shahid, M.S. Association of cotton leaf curl Gezira virus with tomato leaf curl betasatellite infecting Carica papaya in Iran. Australas. Plant Dis. Notes 2021, 16, 4. [Google Scholar] [CrossRef]
- Tahir, M.N.; Amin, I.; Briddon, R.W.; Mansoor, S. The merging of two dynasties—Identification of an African cotton leaf curl disease-associated begomovirus with cotton in Pakistan. PLoS ONE 2011, 6, e20366. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fiallo-Olive, E.; Hamed, A.; Navas-Castillo, J.; Moriones, E. Cotton leaf curl Gezira alphasatellite associated with tomato leaf curl Sudan virus approaches the expected upper size limit in the evolution of alphasatellites. Virus Res. 2013, 178, 506–510. [Google Scholar] [CrossRef] [PubMed]
- Varsani, A.; Martin, D.P.; Randles, J.W.; Vetten, H.J.; Thomas, J.E.; Fiallo-Olivé, E.; Navas-Castillo, J.; Lett, J.-M.; Zerbini, F.M.; Roumagnac, P. Taxonomy update for the family Alphasatellitidae: New subfamily, genera, and species. Arch. Virol. 2021, 166, 3503–3511. [Google Scholar] [CrossRef]
- Akhtar, S.; Khan, A.J.; Singh, A.S.; Briddon, R.W. Identification of a disease complex involving a novel monopartite begomovirus with beta- and alphasatellites associated with okra leaf curl disease in Oman. Arch. Virol. 2014, 159, 1199–1205. [Google Scholar] [CrossRef]
- Briddon, R.W.; Navas-Castillo, J.; Fiallo-Olive, E. ICTV Taxonomic Proposal 2016.021a-kP.A.v2.Tolecusatellitidae. Create the Tolecusatellitidae, a New Family of Single-Stranded DNA Satellites with Two Genera. Available online: https://ictv.global/proposals-16/2016.021a-kP.A.v2.Tolecusatellitidae.pdf (accessed on 21 June 2022).
- Rezk, A.A.; Sattar, M.N.; Alhudaib, K.A.; Soliman, A.M. Identification of watermelon chlorotic stunt virus from watermelon and zucchini in Saudi Arabia. Can. J. Plant Pathol. 2019, 41, 285–290. [Google Scholar] [CrossRef]
- Yazdani-Khameneh, S.; Golnaraghi, A. The status of Begomoviruses in Iran. In Begomoviruses: Occurrence and Management in Asia and Africa; Springer: Singapore, 2017; pp. 229–253. [Google Scholar]
- Idris, A.; Al-Saleh, M.; Amer, M.; Abdalla, O.; Brown, J. Introduction of Cotton leaf curl Gezira virus into the United Arab Emirates. Plant Dis. 2014, 98, 1593. [Google Scholar] [CrossRef] [PubMed]
- Al Shihi, A.A.; Al Sadi, A.M.; Deadman, M.; Briddon, R.W.; Shahid, M.S. Identification of a distinct strain of Cotton leaf curl Gezira virus infecting tomato in Oman. J. Phytopathol. 2018, 166, 199–205. [Google Scholar] [CrossRef]
- Villegas, C.; Ramos-Sobrinho, R.; Jifon, J.L.; Keith, C.; Al Rwahnih, M.; Sétamou, M.; Brown, J.K.; Alabi, O.J. First report of cotton leaf curl Gezira virus and its associated alphasatellite and betasatellite from disease affected okra plants in the united states. Plant Dis. 2019, 103, 3291. [Google Scholar] [CrossRef]
- Namrata, J.; Saritha, R.; Datta, D.; Singh, M.; Dubey, R.; Rai, A.; Rai, M. Molecular characterization of tomato leaf curl Palampur virus and pepper leaf curl betasatellite naturally infecting pumpkin (Cucurbita moschata) in India. Indian J. Virol. 2010, 21, 128–132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ali, I.; Malik, A.; Mansoor, S. First report of Tomato leaf curl Palampur virus on bitter gourd in Pakistan. Plant Dis. 2010, 94, 276. [Google Scholar] [CrossRef]
- Malik, A.H.; Briddon, R.W.; Mansoor, S. Infectious clones of Tomato leaf curl Palampur virus with a defective DNA B and their pseudo-recombination with Tomato leaf curl New Delhi virus. Virol. J. 2011, 8, 173. [Google Scholar] [CrossRef] [Green Version]
- Shafiq, M.; Ahmad, M.; Nisar, A.; Manzoor, M.T.; Abid, A.; Mushtaq, S.; Riaz, A.; Ilyas, M.; Sarwar, W.; Nawaz-ul-Rehman, M.S. Molecular characterization and phylogenetic analysis of tomato leaf curl Palampur virus, a bipartite begomovirus, associated with Cucumis sativus L. in Pakistan. 3 Biotech 2019, 9, 204. [Google Scholar] [CrossRef] [PubMed]
- Hanamasagar, Y.; Naganur, P.; Shankarappa, K.; Venkataravanappa, V.; Reddy, C.L. Characterization of Tomato leaf curl Palampur virus associated with leaf curl and yellowing disease of watermelon from India. Indian Phytopathol. 2021, 74, 1075–1088. [Google Scholar] [CrossRef]
- Sattar, M.N.; Khurshid, M.; El-Beltagi, H.S.; Iqbal, Z. Identification and estimation of sequence variation dynamics of Tomato Leaf curl Palampur virus and betasatellite complex infecting a new weed host. Biotechnol. Biotec. Eq. 2022, 36, 609–619. [Google Scholar] [CrossRef]
- Fazeli, R.; Heydarnejad, J.; Massumi, H.; Shaabanian, M.; Varsani, A. Genetic diversity and distribution of tomato-infecting begomoviruses in Iran. Virus Genes 2009, 38, 311–319. [Google Scholar] [CrossRef] [PubMed]
- Esmaeili, M.; Heydarnejad, J.; Massumi, H.; Varsani, A. Analysis of watermelon chlorotic stunt virus and tomato leaf curl Palampur virus mixed and pseudo-recombination infections. Virus Genes 2015, 51, 408–416. [Google Scholar] [CrossRef] [PubMed]
- Sangeetha, B.; Malathi, V.G.; Alice, D.; Suganthy, M.; Renukadevi, P. A distinct seed-transmissible strain of tomato leaf curl New Delhi virus infecting Chayote in India. Virus Res. 2018, 258, 81–91. [Google Scholar] [CrossRef] [PubMed]
- Kil, E.J.; Park, J.; Choi, E.Y.; Byun, H.S.; Lee, K.Y.; An, C.G.; Lee, J.H.; Lee, G.S.; Choi, H.S.; Kim, C.S.; et al. Seed transmission of Tomato yellow leaf curl virus in sweet pepper (Capsicum annuum). Eur. J. Plant Pathol. 2018, 150, 759–764. [Google Scholar] [CrossRef]
- Riehl, S.; Asouti, E.; Karakaya, D.; Starkovich, B.; Zeidi, M.; Conard, N. Resilience at the transition to agriculture: The long-term landscape and resource development at the aceramic Neolithic tell site of Chogha Golan (Iran). BioMed Res. Int. 2015, 2015, 532481. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maghrebi, M.; Noori, R.; Bhattarai, R.; Mundher Yaseen, Z.; Tang, Q.; Al-Ansari, N.; Danandeh Mehr, A.; Karbassi, A.; Omidvar, J.; Farnoush, H. Iran’s Agriculture in the Anthropocene. Earths Future 2020, 8, e2020EF001547. [Google Scholar] [CrossRef]
- Hosseinzadeh, M.R.; Shams-Bakhsh, M.; Osaloo, S.K.; Brown, J.K. Phylogenetic relationships, recombination analysis, and genetic variability among diverse variants of tomato yellow leaf curl virus in Iran and the Arabian Peninsula: Further support for a TYLCV center of diversity. Arch. Virol. 2014, 159, 485–497. [Google Scholar] [CrossRef]
- Maliano, M.R.; Rojas, M.R.; Macedo, M.A.; Barboza, N.; Gilbertson, R.L. The invasion biology of tomato begomoviruses in Costa Rica reveals neutral synergism that may lead to increased disease pressure and economic loss. Virus Res. 2022, 317, 198793. [Google Scholar] [CrossRef]
- Macedo, M.; Albuquerque, L.; Maliano, M.; Souza, J.; Rojas, M.; Inoue-Nagata, A.; Gilbertson, R. Characterization of tomato leaf curl purple vein virus, a new monopartite New World begomovirus infecting tomato in Northeast Brazil. Arch. Virol. 2018, 163, 737–743. [Google Scholar] [CrossRef]
- Basu, S.; Singh, A.K.; Singh, D.; Sahu, S.K.; Chakraborty, S. Role of viral suppressors governing asymmetric synergism between tomato-infecting begomoviruses. Appl. Microbiol. Biotechnol. 2021, 105, 1107–1121. [Google Scholar] [CrossRef]
- Li, J.; Wang, J.-C.; Ding, T.-B.; Chu, D. Synergistic Effects of a Tomato chlorosis virus and Tomato yellow leaf curl virus Mixed Infection on Host Tomato Plants and the Whitefly Vector. Front. Plant Sci. 2021, 12, 672400. [Google Scholar] [CrossRef] [PubMed]
- Ontiveros, I.; López-Moya, J.J.; Díaz-Pendón, J.A. Coinfection of Tomato Plants with Tomato yellow leaf curl virus and Tomato chlorosis virus Affects the Interaction with Host and Whiteflies. Phytopathology 2022, 112, 944–952. [Google Scholar] [CrossRef] [PubMed]
- Sattar, M.N.; Kvarnheden, A.; Saeed, M.; Briddon, R.W. Cotton leaf curl disease—An emerging threat to cotton production worldwide. J. Gen. Virol. 2013, 94, 695–710. [Google Scholar] [CrossRef] [PubMed]
- Leke, W.N.; Sattar, M.N.; Ngane, E.B.; Ngeve, J.M.; Kvarnheden, A.; Brown, J.K. Molecular characterization of begomoviruses and DNA satellites associated with okra leaf curl disease in Cameroon. Virus. Res. 2013, 174, 116–125. [Google Scholar] [CrossRef] [PubMed]
- Batista, J.G.; Nery, F.; Melo, F.F.S.; Malheiros, M.F.; Rezende, D.V.; Boiteux, L.S.; Fonseca, M.E.N.; de Miranda, B.E.C.; Pereira-Carvalho, R.C. Complete genome sequence of a novel bipartite begomovirus infecting the legume weed Macroptilium erythroloma. Arch. Virol. 2022, 167, 1597–1602. [Google Scholar] [CrossRef]
- Charoenvilaisiri, S.; Seepiban, C.; Phironrit, N.; Phuangrat, B.; Yoohat, K.; Deeto, R.; Chatchawankanphanich, O.; Gajanandana, O. Occurrence and distribution of begomoviruses infecting tomatoes, peppers and cucurbits in Thailand. Crop Prot. 2020, 127, 104948. [Google Scholar] [CrossRef]
- Ouattara, A.; Tiendrébéogo, F.; Becker, N.; Urbino, C.; Thébaud, G.; Hoareau, M.; Allibert, A.; Chiroleu, F.; Vernerey, M.-S.; Traoré, E.V. Synergy between an emerging monopartite begomovirus and a DNA-B component. Sci. Rep. 2022, 12, 695. [Google Scholar] [CrossRef]
- Fondong, V.N. Geminivirus protein structure and function. Mol. Plant Pathol. 2013, 14, 635–649. [Google Scholar] [CrossRef]
- Sattar, M.N.; Ligthart, M.; Kvarnheden, A. Compatibility and interaction of begomoviruses and DNA-satellites causing leaf curl disease in Asia, Africa and Mediterranean Region. Eur. J. Plant Pathol. 2019, 155, 111–124. [Google Scholar] [CrossRef]
- Shafiq, M.; Sattar, M.N.; Shahid, M.S.; Al-Sadi, A.M.; Briddon, R.W. Interaction of watermelon chlorotic stunt virus with satellites. Australas. Plant Path. 2021, 50, 117–128. [Google Scholar] [CrossRef]
- Ferro, C.G.; Zerbini, F.M.; Navas-Castillo, J.; Fiallo-Olivé, E. Revealing the Complexity of Sweepovirus-Deltasatellite–Plant Host Interactions: Expanded Natural and Experimental Helper Virus Range and Effect Dependence on Virus-Host Combination. Microorganisms 2021, 9, 1018. [Google Scholar] [CrossRef] [PubMed]
- Wyatt, S.; Brown, J.K. Detection of subgroup III geminivirus isolates in leaf extracts by degenerate primers and polymerase chain reaction. Phytopathology 1996, 86, 1288–1293. [Google Scholar] [CrossRef]
- Babraham, B. FastQC A Quality Control Tool for High Throughput Sequence Data. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 21 September 2022).
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vasimuddin, M.; Misra, S.; Li, H.; Aluru, S. Efficient architecture-aware acceleration of BWA-MEM for multicore systems. In Proceedings of the 2019 IEEE International Parallel and Distributed Processing Symposium (IPDPS), Rio de Janeiro, Brazil, 20–24 May 2019; pp. 314–324. [Google Scholar]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Umair, M.; Ikram, A.; Salman, M.; Khurshid, A.; Alam, M.; Badar, N.; Suleman, R.; Tahir, F.; Sharif, S.; Montgomery, J. Whole-genome sequencing of SARS-CoV-2 reveals the detection of G614 variant in Pakistan. PLoS ONE 2021, 16, e0248371. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Muhire, B.; Martin, D.P.; Brown, J.K.; Navas-Castillo, J.; Moriones, E.; Zerbini, F.M.; Rivera-Bustamante, R.; Malathi, V.G.; Briddon, R.W.; Varsani, A. A genome-wide pairwise-identity-based proposal for the classification of viruses in the genus Mastrevirus (family Geminiviridae). Arch. Virol. 2013, 158, 1411–1424. [Google Scholar] [CrossRef] [Green Version]
- Martin, D.P.; Varsani, A.; Roumagnac, P.; Botha, G.; Maslamoney, S.; Schwab, T.; Kelz, Z.; Kumar, V.; Murrell, B. RDP5: A computer program for analyzing recombination in, and removing signals of recombination from, nucleotide sequence datasets. Virus Evol. 2021, 7, veaa087. [Google Scholar] [CrossRef]
Plant | Sample | Place | TYLCV | CLCuGeV | OLCuOMB | OYCrCMA | ToLCPalV DNA-A | ToLCPalV DNA-B |
---|---|---|---|---|---|---|---|---|
Tomato | 5ToH-N | Al-Hufuf | 5THT_N (ON756218) (95.3) | - | - | - | - | - |
5ToH-S | 5THT_S (ON756219) (96.4) | - | - | - | - | - | ||
1ToQ-N | Qateef | 1TQT_N (ON756220) (96.7) | 1TQG_N (ON756222) (98.7) | 1TQb_N (ON756226) (95.9) | 1TQa_N (ON756230) (99.5) | - | - | |
1ToQ-S | 1TQT_S (ON756221) (97.2) | 1TQG_S (ON756223) (98.7) | 1TQb_S (ON756227) (96.8) | 1TQa_S (ON756231) (99.5) | - | - | ||
Melon | 18MeQ-N | - | 18MQG_N (ON756224) (100) | 18MQb_N (ON756228) (99.7) | 18MQa_N (ON756232) (100) | 18MQP_N (ON843661) (99.6) | 18MQB_N (ON843663) (100) | |
18MeQ-S | - | 18MQG_S (ON756225) (98.6) | 18MQb_S (ON756229) (95.6) | 18MQa_S (ON756233) (99.5) | 18MQP_S (ON843662) (99.0) | 18MQB_S (ON843664) (97.9) |
Event No. | Recombinant | Breakpoints * | Parents ** | Methods *** | p-Value | ||
---|---|---|---|---|---|---|---|
Begin | End | Major | Minor | ||||
1. | TYLCV_1TQT_N (ON756218) | 2081 | 2691 | TYLCV_KR108214 (93.4) | CLCuGeV_FJ868828 (79.0) | R,G,B,M,C,S,3S | 4.56 × 10−41 |
2. | TYLCV_1TQT_S (ON756219) | 2087 | 2416 | TYLCV_1TQT_N (95.8) | Unknown (CLCuGeV_18MGQ_S) (74.4) | R,G,B,M,C,S,3S | 5.63 × 10−53 |
3. | TYLCV_5THT_N (ON756220) | 2129 | 2408 | TYLCV_KR108214 (95.3) | CLCuGeV_FJ868828 (78.6) | R,G,B,M,C,S,3S | 4.56 × 10−41 |
4. | TYLCV_5THT_S (ON756221) | 2129 | 2408 | TYLCV_KR108214 (96.4) | CLCuGeV_FJ868828 (77.1) | R,G,B,M,C,S,3S | 4.56 × 10−41 |
5. | OLCuOMB_1TQb_N (ON756226) | 1234 | 36 | OLCuOMB_KM279620 (95.5) | CLCuGeB_AY044141 (89.6) | R,G,M,S,3S | 6.75 × 10−29 |
6. | OLCuOMB_1TQb_S (ON756227) | 1178 | 30 | OLCuOMB_KM279620 (96.1) | CLCuGeB_AY044141 (90.7) | R,G,M,S,3S | 6.75 × 10−29 |
7. | OLCuOMB_18MQb_N (ON756228) | 1150 | 36 | OLCuOMB_KM279620 (94.8) | CLCuGeB_AY044141 (90.3) | R,G,M,S,3S | 6.75 × 10−29 |
8. | OLCuOMB_18MQb_S (ON756229) | 250 | 395 | OLCuOMB_KY785329 (87.3) | Unknown (CLCuGeB_AY044141) (88.1) | R,G,B,M,C,S,3S | 1.66 × 10−10 |
1149 | 1314 | OLCuOMB_KM279620 (93.7) | CLCuGeB_AY044142 (87.8) | G,M,C,S,3S | 9.27 × 10−13 |
Primers | Primer Sequence | Nucleotide Position | PCR Product |
---|---|---|---|
AC1048 | GGRTTDGARGCATGHGTACATG | Core coat protein [64] | |
AV494 | GCCYATRTAYAGRAAGCCMAG | ||
TY-Cp_F | TGAAGGCCCATGTAAAGTCCAG | 495–516 | TYLCV |
TY-Cp_R | CATAGAAATAGATACGTATTTTC | 1026–1048 | |
CG-Cp_F | GTGTGAAGGTCCATGTAAGGTCC | 525–547 | CLCuGeV |
CG-Cp_R | GTAGCATACACAGGATTAGAAG | 1034–1055 | |
PA-Cp_F | AGCTCTGACGTGCCCAGGGGCT | 460–481 | ToLCPalV DNA-A |
PA-Cp_R | CACCGAATCGTAAAAATAGATC | 1020–1041 | |
PB-C1C_F | CGTTTGTGAGCGCGTACTCAATAC | 2062–2085 | ToLCPalV DNA-B |
PB-C1C_R | AATATTATATACGAAAGGCCCCTT | 2697–2720 | |
OY-RC_F | GTAATTGTAATGGCTAATTTCCTC | 873–896 | OYCrCMA |
OY-RC_R | GGTAATACTGGAGCCGGCCTCAG | 1448–03 | |
Ob-BC1_F | ACACTGATGATTTATTTAGTATGC | 246–269 | OLCuOMB |
Ob-BC1_R | ATGACTATCACATTCAGGAACACC | 574–597 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
AlHudaib, K.A.; Almaghasla, M.I.; El-Ganainy, S.M.; Arshad, M.; Drou, N.; Sattar, M.N. High-Throughput Sequencing Identified Distinct Bipartite and Monopartite Begomovirus Variants Associated with DNA-Satellites from Tomato and Muskmelon Plants in Saudi Arabia. Plants 2023, 12, 6. https://doi.org/10.3390/plants12010006
AlHudaib KA, Almaghasla MI, El-Ganainy SM, Arshad M, Drou N, Sattar MN. High-Throughput Sequencing Identified Distinct Bipartite and Monopartite Begomovirus Variants Associated with DNA-Satellites from Tomato and Muskmelon Plants in Saudi Arabia. Plants. 2023; 12(1):6. https://doi.org/10.3390/plants12010006
Chicago/Turabian StyleAlHudaib, Khalid A., Mostafa I. Almaghasla, Sherif M. El-Ganainy, Muhammad Arshad, Nizar Drou, and Muhammad N. Sattar. 2023. "High-Throughput Sequencing Identified Distinct Bipartite and Monopartite Begomovirus Variants Associated with DNA-Satellites from Tomato and Muskmelon Plants in Saudi Arabia" Plants 12, no. 1: 6. https://doi.org/10.3390/plants12010006