Next Article in Journal
Silencing of MsD14 Resulted in Enhanced Forage Biomass through Increasing Shoot Branching in Alfalfa (Medicago sativa L.)
Previous Article in Journal
Bacteriophage Control of Pseudomonas savastanoi pv. glycinea in Soybean
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 11
Issue 7
10.3390/plants11070936
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of the TCP Gene Family in Chrysanthemum nankingense and the Role of CnTCP4 in Cold Tolerance

by
Chang Tian
1,2,
Lisheng Zhai
1,
Wenjing Zhu
1,
Xiangyu Qi
1,
Zhongyu Yu
1,
Haibin Wang
1,
Fadi Chen
1,
Likai Wang
1,* and
Sumei Chen
1,*
1
State Key Laboratory of Crop Genetics and Germplasm Enhancement, Key Laboratory of Flower Biology and Germplasm Innovation, Ministry of Agriculture and Rural Affairs, Key Laboratory of Biology of Ornamental Plants in East China, National Forestry and Grassland Administration, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, China
2
Shenzhen Branch, Guangdong Laboratory for Lingnan Modern Agriculture, Genome Analysis Laboratory of the Ministry of Agriculture, Agricultural Genomics Institute at Shenzhen, Chinese Academy of Agricultural Sciences, Shenzhen 518120, China
*
Authors to whom correspondence should be addressed.
Plants 2022, 11(7), 936; https://doi.org/10.3390/plants11070936
Submission received: 18 February 2022 / Revised: 24 March 2022 / Accepted: 28 March 2022 / Published: 30 March 2022
(This article belongs to the Section Plant Response to Abiotic Stress and Climate Change)
Browse Figures
Versions Notes

Abstract

:
Plant-specific TCP transcription factors play a key role in plant development and stress responses. Chrysanthemum nankingense shows higher cold tolerance than its ornamental polyploid counterpart. However, whether the TCP gene family plays a role in conferring cold tolerance upon C. nankingense remains unknown. Here, we identified 23 CnTCP genes in C. nankingense, systematically analyzed their phylogenetic relationships and synteny with TCPs from other species, and evaluated their expression profiles at low temperature. Phylogenetic analysis of the protein sequences suggested that CnTCP proteins fall into two classes and three clades, with a typical bHLH domain. However, differences between C. nankingense and Arabidopsis in predicted protein structure and binding sites suggested a unique function of CnTCPs in C. nankingense. Furthermore, expression profiles showed that expression of most CnTCPs were downregulated under cold conditions, suggesting their importance in plant responses to cold stress. Notably, expression of miR319 and of its predicted target genes, CnTCP2/4/14, led to fast responses to cold. Overexpression of Arabidopsis CnTCP4 led to hypersensitivity to cold, suggesting that CnTCP4 might play a negative role in C. nankingense responses to cold stress. Our results provide a foundation for future functional genomic studies on this gene family in chrysanthemum.

1. Introduction

The TCP gene family is a plant-specific group of transcription factors (TFs) that was first described in 1999 [1,2]. The family name is derived from four proteins, namely, TB1 (teosinte branched 1) in maize [3], CYC (CYCLOIDEA) in Antirrhinum [4], and PCF1 and PCF2 (Proliferating cell factors) in rice [2]. Furthermore, TCP genes have been found in various plant species, for instance, model plants such as Arabidopsis [1,5,6,7]; crop plants such as soybeans [8], maize [9] and rice [7]; and pluricellular green algae [10,11] such as cosmarium and chara, moss Physcomitrium patens, ferns and lycophyte selaginella, poplar (Populus) [12], and grapevine [13]. Furthermore, members of this gene family play numerous roles in plant development, including in embryonic growth [14], cell cycle regulation [15,16], pollen development [17], germination [14,18], senescence [19], circadian rhythms [20,21], leaf development [12,22,23,24,25], branching [26,27,28], floral organ morphogenesis and flowering [29,30,31,32,33,34], and hormone signaling [8,14,31,35,36,37].
Class II CIN-type TCPs, as miR319 targets, have been widely analyzed [5,19]. TCPs regulated by miR319 reportedly coordinate plant physiological characteristics such leaf growth and senescence [33], shoot apical meristem development [38], flowering time [33], and cold tolerance [39]. TCP proteins harbor a bHLH motif that allows DNA binding and protein–protein interactions [5,6]. Many studies have shown that TCP transcription factors in Arabidopsis, tomato, and rice [5,6,23,40,41,42,43,44,45] exist as homodimers or heterodimers; furthermore, interaction usually occurs among TCP transcription factors of the same class. Additionally, some studies have reported that TCPs are more likely to form heterodimers than homodimers and that the former bind DNA more efficiently than the latter [2,40,41]. For instance, PCFl and PCF2 bind the rice meristematic tissue-specific expressed PCNA gene through homodimers or heterodimers, but the heterodimeric interaction between PCFl and PCF2 is considerably stronger than between the homodimers [2]. Consistently, AtTCP11 and AtTCP15 form heterodimers that show greater efficiency in binding DNA and have a different sequence preference than their corresponding homodimer counterparts [41]. Furthermore, TCP proteins might interact with other non-TCP proteins, thereby affecting the expression of downstream genes and regulating the plant development. For example, Chrysanthemum CmTCP20 interacts with CmJAZ1 and downregulates CmBPE2 expression, which regulates the petal size [46]. AtTCP5/13/17 directly interact with AtFD to activate AtAP1 expression and promote the photoperiodic flowering response [30]. These results suggest that the specific roles played by TCPs may be partially dependent on the proteins with which they interact.
Cold stress is one of the main abiotic stress conditions that severely reduce crop productivity, quality, and post-harvest longevity [47]. Cold stress induces transcriptional, post-transcriptional, and post-translational regulation of gene expression [39,48,49,50]. Evidence has shown that the inducer of the C-repeat binding factor (CBF) expression 1 (ICE1), CBF/DREB1 transcriptional cascade, and CBF-independent regulons are involved in transcriptional regulation during cold acclimation [50,51]. Furthermore, ICE1 is regulated by an ubiquitin-mediated mechanism of translational control upon cold induction [52]; moreover, pre-mRNA splicing, mRNA export, and small RNA-directed mRNA degradation play important roles in cold stress responses by post-transcriptional regulatory mechanisms [39,53,54,55,56].
In addition to a great worldwide popularity as cut flowers and pot plants, chrysanthemums are highly appreciated as health foods and anti-inflammatory herbs of high commercial value in traditional Chinese medicine. During chrysanthemum growth, extremely low temperatures in early spring and winter, unusual freezing temperatures during late spring, and sudden frost during the fall often lead to growth arrest and flower bud or inflorescence inhibition, ultimately causing substantial yield and economic losses [48,57]. Therefore, improving cold tolerance of chrysanthemum is an important goal. The diploid species Chrysanthemum nankingense is closely related to the high market-value ornamental species, C. morifolium. Due to its simple diploid nature, C. nankingense has been selected as a convenient Asteraceae genomic model for rapid and effective exploration of gene function [22,57,58,59,60,61]. Additionally, C. nankingense shows greater cold tolerance than its ornamental polyploid counterpart [57,62]. Furthermore, a few CnTCPs found in C. nankingense are reportedly related to the plant response to low temperature [57]. However, to date, no attempt has been made to systematically describe the CnTCP-gene family members harbored by the C. nankingense genome. Therefore, this study was designed to systematically analyze and determine the phylogenetic relationships and synteny of CnTCPs present in C. nankingense with TCPs from other species. Here, we aimed to document the transcriptional behavior of CnTCPs under low temperature. Ectopic overexpression of CnTCP4 in Arabidopsis led to reduced cold tolerance, suggesting that CnTCP4 plays a negative role in the response of C. nankingense to cold.

2. Results

2.1. Classification and Phylogenetic Analysis of TCP Proteins

A total of 171 TCP proteins were selected for systematic analysis of evolutionary relationships, including 55 from Glycine max [8], 22 from Oryza sativa [5], 44 from Zea mays [9], 23 from C. nankingense, and 27 from Arabidopsis thaliana [5] (Figure 1). The 171 TCPs were classified into two main classes, i.e., class I and class II, each with three clades. The boundaries of these major clades illustrate the phylogenetic positions of several canonical TCP proteins, such as class I PCF proteins OsPCF1 and OsPCF2, CYC/TB1-like class II protein ZmTB1, and CIN-like class II protein AtTCP2-4. Furthermore, we found that TCP proteins from the three dicot plants used here, namely, Arabidopsis, G. max, and C. nankingense, seemingly clustered separately from those of the two monocots studied, namely, O. sativa and Z. mays (Figure 1). Furthermore, TCPs from G. max and C. nankingense TCPs showed a closer phylogenetic relationship among them than those from maize and rice did.
All CnTCP proteins showed the basic helix loop helix (bHLH) domain (Figure 2). The distance matrix and homology matrix of the full-length and bHLH CnTCP protein sequences from five plant species are shown in Supplementary Tables S2 and S3. High homologies in full length and bHLH domain were noted among proteins (Figure 1). The conserved bHLH domain has a 59-amino acid bHLH structure that allows DNA binding and protein–protein interactions [1,2]. The most significant difference between the two protein classes is the absence of four amino acids in the basic domain of proteins in class I, compared with that of proteins in class II. Additional diagnostic residues for each class were found in the helices and the loop of the TCP bHLH domain (Figure 2). Importantly, our phylogenetic analysis and bHLH domain architecture support the classification of the C. nankingense and Arabidopsis TCP genes family. Our phylogenetic tree and bHLH domain analyses (Figure 1 and Figure 2) showed that CnTCP14 and AtTCP2 clustered together into the same group and were classified into Class II CIN. In turn, CnTCP3 and CnTCP15 clustered with AtTCP18 and were classified into Class II CYC/TB1; meanwhile, CnTCP10 and CnTCP12 clustered with AtTCP16 and were classified into Class I PCF. Lastly, CnTCP18 clustered with AtTCP20 and was classified into Class I PCF.
Compared with that of Arabidopsis, CnTCP proteins number occupies a lower proportion in the PCF subfamily, a higher proportion in the CIN subfamily, and a similar proportion in the CYC/TB1 subfamily. Specifically, among the five species studied herein, members in Class I PCF accounted for the largest proportion, with 47% in G. max (26/55), 39% in Z. mays (17/44), 48% in Arabidopsis (13/27), 45% in O. sativa (10/22), and 39% in C. nankingense (9/23); meanwhile, CYC/TB1 subfamily members accounted for 18% (10/55), 41% (4/22), 19% (5/26), 14% (4/21), and 17% (5/25), respectively. The proportion of CIN members in the five species ranged between 20% and 43% (Figure 1), among which C. nankingense and Z. mays showed the highest and the lowest proportions, respectively.
Furthermore, we constructed an unrooted phylogenetic tree from alignments of the protein sequences of the bHLH domain from C. nankingense, Helianthus annuus, and Arabidopsis (Supplementary Figure S1). The Hidden Markov Model (HMM) profile of the TCP domain (PF03634) was used to identify the TCP proteins from H. annuus, one of the sequenced Asteraceae species [61,63]. A total of 29 TCP family proteins were identified in the sunflower genome, of which 14 clustered in the CYC/TB1 clades of class II, 9 in the CIN clades of class II, and 6 in the PCF clades of class I (Supplementary Figure S1).

2.2. Structural Analysis and Protein–Protein Interactions of CnTCP Genes

Family pair-wise analysis of the full-length CnTCP protein sequences indicated that the identities ranged from 9.40% to 68.10% in non-homologous gene pairs (Table 1). Relatively high identities were observed between CnTCP10 and CnTCP12 (68.10%), CnTCP2 and CnTCP14 (approximately 57.00%), CnTCP1 and CnTCP11 (52.30%), CnTCP5 and CnTCP17 (52.10%), and among CnTCP16, CnTCP10 and CnTCP12 (approximately 50.00%). Additionally, TCP-protein family pair-wise analysis among the sequences of the bHLH domain showed much higher homologies, e.g., 98.20% between CnTCP10 and CnTCP12 (Supplementary Table S4). Such a high degree of homology suggests that these two proteins may have similar structures and function. The structure of each AtTCP and CnTCP proteins are shown in Figure 3. The MEME motif search tool was used to identify the conserved motifs of TCPs domains in C. nankingense and Arabidopsis. Among the four distinct motifs identified, motif 1 was located in the bHLH domain (Figure 4), whereas motifs 2 and 3 were located at the upstream and downstream parts of motif 1, respectively. The amino acids in the front and back of motifs 2 and 3 were relatively conserved and located in the bHLH domain, while the other parts showed larger variation (Figure 3 and Figure 4). The highly divergent, fast-evolving sequences outside the bHLH domain are essential for protein functional specificity. Outside the bHLH domain, an 18–20 amino acid residue, arginine-rich motif is also conserved in Arabidopsis and is specific to a subset of class II proteins (the R domain, motif 4) (Figure 3 and Figure 4); this motif was predicted to form a coil that may mediate protein–protein interactions [5]. For instance, AtAP1 interacts with AtTCP24 but not with the closely related AtTCP3/5/13/17 proteins that also harbor almost identical TCP domains [64]. The R domain in Arabidopsis differed from its counterpart in C. nankingense in the number of amino acid residues and, consequently, related characteristics (Figure 3 and Figure 4). Consistent with phylogenetic analysis and domain architecture, CnTCP3 and CnTCP14 harboring the R domain clustered together into the Class II subfamily (Figure 1 and Figure 2). However, CnTCP18 harboring a predicted R domain clustered into Class I PCFs but lacked four amino acids in the basic bHLH domain. The differences in protein structure and motif prediction between C. nankingense and Arabidopsis might entail a unique function of CnTCP in C. nankingense.
Untranslated regions (UTRs) and introns present in genes may play regulatory roles, such as modulating mRNA stability or localization and translational efficiency [5,65,66,67]. Furthermore, introns can increase transcript levels by affecting the rate of transcription, nuclear export, and transcript stability, and by increasing the efficiency of mRNA translation [68]. Some AtTCP genes such as AtTCP1/8/12/13/18 have introns, while AtTCP12 and AtTCP24 have a long 3′ UTR and 5′ UTR. Although the annotation file of C. nankingense is not complete, several CnTCPs, such as CnTCP14/17/18, harbor long introns (Supplementary Figure S2).
Protein–protein interactions are the basis on which cellular structure and function are built, and interacting partners directly affect biological functions of each other. Here, the STRING online database (accessed on 28 October 2021, https://string-db.org/) and Cytoscape software were used to analyze the interactions between Arabidopsis TCPs and other proteins. A total of 123 proteins were filtered into a PPI network complex containing 835 edges (Supplementary Figure S3A). PPI networks revealed that cold stratification induced TCPs’ interactions with proteins GID1A and GID1B (Supplementary Figure S3A). TCP proteins were interacted with some circadian clock-related genes, such as TCP7/20/21/22 with TOC1, TCP18 and FT, and TCP7/11/22 and CCA1 (Supplementary Figure S3A). In this study, top one protein–protein interaction networks with the highest clustering score were established via MCODE analysis (Supplementary Figure S3B); furthermore, the top module comprised 19 proteins, including SPL/NZZ and most AtTCP proteins (Supplementary Figure S3B), which showed a complex interactive network of the TCP family.

2.3. Expression Profiling of CnTCP Genes in Response to Cold Stress

Some TCP genes are involved in plant abiotic stress responses, such as in cold [39], salt [8], and drought stress [8,9]. At the molecular level, such changes induced by adverse conditions are mainly mediated by transcription factors binding to specific recognition sequences upstream from the specific stress response genes (cis-elements) for transcriptional regulation. In this study, to further elucidate the possible regulatory mechanisms underlying the expression of CnTCP genes during abiotic/biotic stress responses, the corresponding promoter sequences were analyzed using the PlantCARE online database to search cis-elements in the promoter region within 3000 bp upstream from the initiation codons of TCPs. At least 60 cis-regulatory elements were identified in CnTCP and AtTCP promoters (Supplementary Table S5). The upstream regions of most CnTCP and AtTCP genes contained at least one phytohormone-related element, such as abscisic acid-responsive element (ABRE), ethylene-responsive element (ERE), gibberellin-responsive element (P-box), MeJA-responsive element (CGTCA-motif and TGACG-motif), and salicylic acid-responsive element (TCA element) (Supplementary Table S6). Our results showed the same trend previously observed in five legume species [8]. Furthermore, stress-related elements were found in the promoters of CnTCPs and AtTCPs, such as low-temperature responsive (LTR) elements, drought-inducibility (MBS), and defense and stress responsiveness TC-rich repeats (Supplementary Table S6). These results indicate that TCP genes might play critical roles in plant responses to a range of abiotic stress conditions [9,69]. Furthermore, most CnTCPs and AtTCPs promoters seemingly harbor the predicted binding sites of transcription factors such as AP2, ERF, bHLH, MYB, WRKY, and TCP (Table 2). There are several additional binding sites that contribute to cold stress mitigation, such as the ABA-responsive elements (ABRE), the G-box, and the MYC binding sites (Supplementary Table S6).
Gene expression patterns provide important information for gene function analysis. Downregulation of the expression of two TCP genes in rice, OsPCF5, and OsPCF8 results in enhanced cold tolerance [54]. We tested the transcriptional behavior of CnTCPs after a 7 d cold stress in C. nankingense. As shown in Figure 5, the expression level of CnTCP14 under 22 °C room temperature (RT) was comparable to that under 4 °C low temperature (LT); furthermore, when the expression level of CnTCP14 under RT was used as the normalized control, most of the TCP genes’ expression levels were downregulated under 4 °C low temperature, including CnTCP3/4/6/7/8/9/10/11/12/15/16/17/18 (i.e., LT treatment). The results have shown that CnTCP5/13/14 have no expression changed after cold tolerance, while CnTCP2 upregulated (Figure 5). Our phylogenetic tree and bHLH domain analyses (Figure 1 and Figure 2) showed that CnTCP2/4/5/13/14/17 clustered together into the Class II CIN group. Although the CnTCP4/5/13/17 proteins have the same protein structure, as well as CnTCP2/14 (Figure 3), the bHLH motif sequence differences (Figure 2) may lead to differences in their gene functions.
A previous study reported the importance of timing and expression levels of miR319 and its target genes involved in cold tolerance [54,55]. The Arabidopsis miR319a and miR319b precursor sequences were used to search the miR319 sequences in the transcriptome of C. nankingense (Supplementary Table S1). Due to the two members of miR319 precursor in C. nankingense sharing the same mature sequences with the mature sequence of Arabidopsis miR319, 5′ TTGGACTGAAGGGAGCTCCC 3′, this sequence was selected for expression validation and further functional analysis. As shown for other species, mature miR319 was also predicted to target the expression of CnTCP2, CnTCP4, and CnTCP14. The critical miRNA-target pairing region spans the nucleotides 2–13, which were perfect matches (Figure 6A). Stem-loop qPCR analysis showed that the expression level of mature miR319 was rapidly upregulated after 6 h of LT treatment, but decreased to control (0 h) level after 24 h (Figure 6B). Some studies have shown the EF-1α was sufficient for accurate normalization in cold-treated samples, and the EF-1α gene was the frequently-used internal control in the genus chrysanthemum for normalizing transcription data [70,71,72]. When performing microRNA detection, because a better strategy is choosing a constitutively expressed small noncoding RNA as a reference, we often chose the U6 gene [73,74,75]. The U6 gene sequence of C. nankingense was retrieved using the AtU6 gene sequence from Arabidopsis (Supplementary Table S1). Interestingly, the expression levels of CnTCP2, CnTCP4, and CnTCP14 were significantly downregulated at 6 h at 4 °C, concomitantly with a significant upregulation of miR319 expression. Similarly, the expression level of CnTCP4 tended to be upregulated, consistent with the downregulated expression of miR319 observed at 24 h (Figure 6B). As shown in Figure 6B, there is a significant difference between the expression of CnTCP2 or 14 with CnTCP4. Compared with the expression patterns of CnTCP2 and CnTCP14, which were first downregulated and then stabilized, the trend of first downregulation and then upregulation of CnTCP4 was more consistent with the expression pattern of miR319, indicating that CnTCP4 may be more dependent on the regulation of miR319. Moreover, after one week of cold acclimation, CnTCP4 was still downregulated compared with the control (Figure 5B), indicating that CnTCP4 may maintain a continuous function during cold acclimation compared to CnTCP14 and CnTCP2.

2.4. CnTCP4 Transcription Factors Are Involved in Cold Stress Response

Next, we selected CnTCP4 to test its potential role in cold acclimation using CnTCP4 overexpressing Arabidopsis lines previously generated by our group [60]. The expression levels of CnTCP4 in transgenic plants and wildtype are shown in Supplementary Figure S4A, which showed obviously higher expression levels in overexpressing CnTCP4 Arabidopsis plants. In Figure 7B andC, OECnTCP4 Arabidopsis showed more wilting and yellowing leaves than the wildtype (Figure 7A) after freezing treatment. Thus, CnTCP4 overexpressing lines showed higher sensitivity to freezing after cold acclimation. To further determine the mechanism of action of CnTCP4 on cold tolerance in Arabidopsis, we measured chlorophyll, soluble sugar, and malondialdehyde (MDA) contents in CnTCP4 overexpressing Arabidopsis after cold acclimation for two days. Compared to wildtype Arabidopsis thaliana, CnTCP4 overexpression decreased chlorophyll (Figure 7D) and soluble sugar contents (Figure 7E), while MDA content increased compared with that in control plants (Figure 7F). Previous studies have reported that expression of CBF genes was rapidly induced when Arabidopsis plants were exposed to low temperature (4 °C) [76,77]. Conversely, our findings show that CnTCP4 negatively regulated the expression of cold-induced genes AtCBF1/2/3 (Figure 7G) and the CBF-regulated COR genes AtCOR15A and AtKIN1 (Supplementary Figure S4B).

3. Discussion

The plant-specific TCP family comprises a group of transcription factors that influence cell proliferation and differentiation and consequently regulate growth and developmental processes. Furthermore, TCP family members have been identified in a range of plant species. Although plant-specific TCP genes have been thoroughly analyzed in numerous species, systematical analysis of this gene family in C. nankingense had not been reported. In this study, phylogenetic and structural analyses of 23 CnTCP genes were conducted, and our results revealed the existence of fewer TCP genes in C. nankingense than in Arabidopsis [5], maize [9], or soybeans [8], suggesting that these few CnTCPs might perform multiple functions and be part of gene regulatory networks.
Furthermore, at least in some cases, interaction partners might reportedly alter TCP functional specificity [30]. Some interactions with circadian clock-related genes were identified, such as the interactions between TCP7/20/21/22 and TOC1, between TCP18 and FT, and between TCP7/11/22 and CCA1 (Supplementary Figure S3A). These findings indicated that TCPs might play differential roles in flowering regulation. Concomitant binding of some proteins with TCPs to regulate the expression level of target flowering genes has already been reported [30,32,78,79]. Here, we found that CnTCP4 and CnTCP13 delayed bolting time in Arabidopsis (Supplementary Figure S5).
In G. max, some GmTCP genes appeared to respond to multiple stress factors, including heat, drought, and cold. In these cases, GmTCP genes apparently contribute to the plant defense response against stress [80]. A similar stress-response function was reported in other legume species [8]. However, to date, few reports have indicated that TCP transcription factors are involved in the response to cold stress [39,55,57]. Previous work suggested that there might be some specialization of GID1 gene function during seed germination because GID1a and GID1c transcripts are more strongly induced by cold stratification than GID1b transcripts [81]. Additionally, PPI networks revealed GID1A and GID1B interactions with TCPs (Supplementary Figure S3), thus providing new insights into TCP-mediated cold response mechanisms. In rice, expression levels of Osa-MIR319a and Osa-MIR319b are downregulated after 24 h incubation at 4 ℃ [54]. However, miRNA319 expression in sugarcane reportedly increases after 24 h of cold stress and then returns to the baseline level at 48 h after treatment initiation [55]. Similarly, here, miRNA319 expression in C. nankingense increased after 6 h of cold stress and returned to the baseline level after 24 h of treatment initiation (Figure 6B). This finding suggests that the response of miRNA319 to cold stress is a dynamic and complex process. Importantly, the corresponding change in the expression of the predicted miR319-target gene CnTCP4 was observed in response to cold tolerance (Figure 6B), which allowed us to infer that CnTCP4 might be an important gene involved in cold acclimation. Indeed, the overexpression of CnTCP4 in Arabidopsis negatively regulated cold acclimation by downregulating cold-induced genes such as AtCBF1/2/3, AtCOR15A, and AtKIN1 (Figure 7G and Supplementary Figure S4B) and reducing physiological indicators such as chlorophyll and soluble sugar contents, while increasing MDA content (Figure 7). At the same time, we found that higher CnTCP4 expression (Supplementary Figure S4A) caused stronger inhibition of the expression of the CBF genes (Figure 7G) and higher sensitivity phenotype to cold treatment (Figure 7A–C), suggesting that there may be a dose effect of CnTCP4 during plant cold tolerance regulation. Cold stress-related marker genes, such as DREB1/CBF and DREB2A, were induced in Osa-miR319b overexpressing lines to a significantly greater extent than that in the wildtype; moreover, a great increase in transcript levels of DREB1A and DREB2A was observed in the OsPCF6- and OsTCP21-RNAi lines, concomitant with a decrease in overexpressing lines [39]. Therefore, we hypothesized that TCP family genes may be involved in the regulation of plant cold tolerance by directly regulating the expression level of downstream cold response-related target genes. All 18 TCPs form a network and interact with each other (Supplementary Figure S3B), consistent with a previous report according to which TCPs form homo- and heterodimers [1,5]. DNA binding seemingly requires dimer formation [40]. Furthermore, homo- and heterodimer interactions show different DNA-binding efficiencies, or mutually modulate their activity, and possibly bind to slightly different cis-regulatory elements [82]. However, whether CnTCP4 or its interaction complex binds directly to the cold-related marker genes warrants further research.
Meanwhile, the target TCP genes of miRNA319 might also be regulated by other transcription factors, such as AP2, ERF, bHLH, MYB, WRKY, and TCP encoded TFs, which might bind to cis-regulatory elements in CnTCPs and AtTCPs promoters (Supplementary Table S5). Moreover, in Arabidopsis, TCP2 could interact with the cryptochrome 1 (CRY1) protein in yeast and plant cells and be a transcription activator which acts downstream of CRY1 [83]. CRY1 regulates both basal and acquired freezing tolerance in Arabidopsis [84]. The Class I TCP family members with which CnTCP14 was adjacent with CnTCP2 in the evolutionary tree (see Figure 1) also have the same sequence of bHLH domains (see Figure 2) and same protein structures (see Figure 3). Therefore, CnTCP14 may play the same function as CnTCP2. These results suggest that TCP2 and TCP14 are not only regulated by miR319 during cold acclimation, but these members may also be regulated by other transcriptional regulators.

4. Materials and Methods

4.1. Phylogenetic Analysis of the CnTCP Family

To investigate the phylogenetic relationship of the TCP family, the conserved bHLH-domain amino-acid sequences of CnTCPs identified in C. nankingense, H. annuus, Arabidopsis, maize, rice, and soybeans were aligned using the multiple sequence alignment program ClustalX. A neighbor-joining (NJ) phylogenetic tree was constructed using the MEGA 7.0 program with the bootstrap value set at 1000 [85]. The TCP gene sequences from C. nankingense used for analysis were chosen according to previous studies of our group [57,58,59,60,62,86]. The TCP gene sequences from Arabidopsis, maize, rice, and soybean used for analysis were chosen according to previous studies [5,8,9]. To identify all TCP proteins in H. annuus, all proteins were downloaded from the Sunflower Genome Database (https://www.sunflowergenome.org/, accessed on 18 February 2022) [63]. The Hidden Markov Model (HMM) profile of the TCP domain (PF03634) was downloaded from Protein family (Pfam) (http://pfam.sanger.ac.uk/, accessed on 18 February 2022) and used for identifying TCP proteins from the downloaded database of Sunflower Genome using the HMM search of TBtools [87]. The percent identities among full-length CnTCP proteins from C. nankingense or the bHLH motif sequences of TCP proteins from other species were analyzed using the DNAMAN software.

4.2. Structural Analysis of the TCP Genes

Information about the gene structure for Arabidopsis TCP genes was obtained from the gff3 file GCF_000001735.4_TAIR10.1_genomic downloaded from the website (https://www.ncbi.nlm.nih.gov/genome/browse#!/overview/, accessed on 18 February 2022). All 23 C. nankingense CnTCP gene sequences were selected to blast the most homologous genes in the C. nankingense genome scaffolds and protein files (http://www.amwayabrc.com/, accessed on 18 February 2022) for searching the accession numbers. For C. nankingense TCP genes, information about the gene structures was procured from the gff3 file Chrysanthemum_genome_gene_v2.0 using the searched accession numbers. The TBtools software was used to draw the gene structure diagram [87].
Protein sequences were analyzed in the MEME program (http://meme.sdsc.edu/meme/cgi-bin/meme.cgi, accessed on 18 February 2022) to confirm the conserved motifs. The MEME program was used under the following parameters: zero or one occurrence per sequence (zoops), maximum number of motifs—4, and optimum motif width set to >6 and <50. The psRNATarget website was used for miR319 target gene prediction (https://www.zhaolab.org/psRNATarget/, accessed on 18 February 2022). The mature sequences of miR319 and all CnTCPs family sequences were used for target site analyses.

4.3. Protein–Protein Interaction Network Analysis

Protein–protein interaction networks of CnTCPs were analyzed using the search tool for Retrieval of Interacting Genes (STRING; http://stringdb. org/, accessed on 18 February 2022) online. The screened networks were visualized by Cytoscape 3.9.0. The MCODE software was used to establish PPI network modules using parameters of degree cutoff 2, k-core 2, max. depth 100, and node score cutoff 0.2.

4.4. Putative Cis-Elements in the Promoter Regions

The 3000-bp upstream sequences from the translation start codon of all CnTCP family genes were obtained from the C. nankingense Genome scaffolds files (http://www.amwayabrc.com/, accessed on 18 February 2022). The cis-elements of promoters were identified using the PlantRegMap: Binding Site Prediction (http://plantregmap.gao-lab.org/, accessed on 18 February 2022) [88] and PlantCARE: Search for CARE [89].

4.5. Plant Growth Conditions and Cold Treatment

Diploid C. nankingense was obtained from the Chrysanthemum Germplasm Resource Preserving Center at Nanjing Agricultural University, China. Plants were grown under a 22/15 °C day/night temperature conditions, at a relative humidity of 70–75%, and a 16/8 h (day/night) photoperiod. For cold stress, plants were subjected to 4 °C during the day/night and a 16/8 h photoperiod environment. CnTCP4 overexpressing Arabidopsis was previously generated by our group [22,60]. For the freezing test, four-week-old plants were cold-acclimated (at 4 °C) for two days and then subjected to freezing at −20 °C for 20 min; finally, they were observed after a 2 d recovery at 23°C. Chlorophyll, soluble sugar, and malondialdehyde (MDA) contents in OECnTCP4 Arabidopsis were measured after cold stress according to the methods previously described [90,91,92]. Samples were harvested without any additional treatment. For each treatment, aboveground plant biomass was harvested. For cold treatment shown in Figure 6 and Figure S4B, the plant part of two-month old plants of C. nankingense from the apical bud to the third fully expanded leaf were harvested.

4.6. Verification of CnTCP Expression

Total RNA was extracted from each sample. After digestion with RNase-free DNase I (TaKaRa; Tokyo, Japan) and reverse transcription with Reverse Transcription M-MLV (TaKaRa), about 100 ng cDNA product was used for each reaction (10 μL 2× SYBR® Premix Ex TaqTM II and 0.5 μL of 10 μM primer pairs mixed in a 20 μL reaction system). DNA was extracted from the OECnTCP4 and wildtype Arabidopsis seedlings using the CTAB method. The chrysanthemum EF-1α gene (Genbank accession number KF305681) and Arabidopsis ACTIN8 gene were used as reference genes, respectively. Primers used in this study are listed in Supplementary Table S1.

5. Conclusions

Here, we identified 23 CnTCP genes in C. nankingense, systematically analyzed their phylogenetic relationships and synteny with TCPs from other species, and evaluated their expression profiles at low temperature. A total of 23 CnTCP proteins fall into two classes and three clades, with a typical bHLH domain. Predicted protein structure and binding sites analysis suggested a unique function of CnTCPs in C. nankingense. Expression of most CnTCPs were downregulated under cold conditions, suggesting their importance in plant responses to cold stress. Notably, expression of miR319 and of its predicted target genes, CnTCP2/4/14, led to fast responses to cold. Overexpression of CnTCP4 in Arabidopsis led to hypersensitivity to cold, suggesting that CnTCP4 might play a negative role in C. nankingense responses to cold stress. Our results provide a foundation for future functional genomic studies on this gene family in chrysanthemum.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants11070936/s1, Figure S1. Evolutionary tree of TCP proteins; Figure S2. Gene structure of TCPs; Figure S3. Co-expression network analysis of TCP proteins and correlated proteins; Figure S4. Expression of cold-related genes after cold stress and identification of OECnTCP4; Figure S5. Overexpression of CnTCP4 and CnTCP13 delayed bolting in Arabidopsis thaliana; Table S1. Primers and sequences used in this research; Table S2. Distance and homology matrices of 171 sequences were generated with the DNAMAN program using the full-length amino acid sequences from Glycine max, Oryza sativa, Zea mays, Chrysanthemum nankingense, and Arabidopsis thaliana; Table S3. The distance and homology matrix of 171 sequences were generated with the DNAMAN program using the bHLH amino acid sequences from Glycine max, Oryza sativa, Zea mays, Chrysanthemum nankingense, and Arabidopsis thaliana; Table S4. Distance and homology matrices of 23 sequences were generated with the DNAMAN program using the full-length and bHLH amino acid sequences from Chrysanthemum nankingense; Table S5. Binding site prediction results of TCP promoters from Chrysanthemum nankingense and Arabidopsis thaliana using the PlantRegMap website; Table S6. Cis-acting regulatory element prediction results of TCP promoters from Chrysanthemum nankingense and Arabidopsis thaliana using the PlantCARE website.

Author Contributions

Conceptualization, S.C. and L.W.; Data curation, C.T. and H.W.; Formal analysis, S.C., C.T., H.W. and L.W.; Investigation, C.T., L.Z., W.Z., X.Q. and Z.Y.; Methodology, S.C., C.T., H.W., F.C. and L.W.; Validation, L.Z. and W.Z.; Visualization, C.T.; Writing—original draft, C.T.; Writing—review & editing, S.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the National Key Research and Development Program of China (2018YFD1000400) and the National Natural Science Foundation of China (31972451,32030098).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Cubas, P.; Lauter, N.; Doebley, J.; Coen, E. The TCP Domain: A Motif Found in Proteins Regulating Plant Growth and Development. Plant J. 1999, 18, 215–222. [Google Scholar] [CrossRef] [Green Version]
  2. Kosugi, S.; Ohashi, Y. PCF1 and PCF2 Specifically Bind to cis Elements in the Rice Proliferating Cell Nuclear Antigen Gene. Plant Cell 1997, 9, 1607–1619. [Google Scholar] [CrossRef] [Green Version]
  3. Doebley, J.; Stec, A.; Hubbard, L. The Evolution of Apical Dominance in Maize. Nature 1997, 386, 485–488. [Google Scholar] [CrossRef]
  4. Luo, D.; Carpenter, R.; Vincent, C.; Copsey, L.; Coen, E. Origin of Floral Asymmetry in Antirrhinum. Nature 1996, 383, 794–799. [Google Scholar] [CrossRef]
  5. Martín-Trillo, M.; Cubas, P. TCP Genes: A Family Snapshot Ten Years Later. Trends Plant Sci. 2010, 15, 31–39. [Google Scholar] [CrossRef]
  6. Manassero, N.G.U.; Viola, I.L.; Welchen, E.; Gonzalez, D.H. TCP Transcription Factors: Architectures of Plant Form. Biomol. Concepts 2013, 4, 111–127. [Google Scholar] [CrossRef] [PubMed]
  7. Yao, X.; Ma, H.; Wang, J.; Zhang, D. Genome-Wide Comparative Analysis and Expression Pattern of TCP Gene Families in Arabidopsis thaliana and Oryza sativa. J. Integr. Plant Biol. 2007, 49, 885–897. [Google Scholar] [CrossRef]
  8. Ling, L.; Zhang, W.; An, Y.; Du, B.; Wang, D.; Guo, C. Genome-Wide Analysis of the TCP Transcription Factor Genes in Five Legume Genomes and Their Response to Salt and Drought Stresses. Funct. Integr. Genom. 2020, 20, 537–550. [Google Scholar] [CrossRef]
  9. Ding, S.; Cai, Z.; Du, H.; Wang, H. Genome-Wide Analysis of TCP Family Genes in Zea mays L. Identified a Role for ZmTCP42 in Drought Tolerance. Int. J. Mol. Sci. 2019, 20, 2762. [Google Scholar] [CrossRef] [Green Version]
  10. Navaud, O.; Dabos, P.; Carnus, E.; Tremousaygue, D.; Hervé, C. TCP Transcription Factors Predate the Emergence of Land Plants. J. Mol. Evol. 2007, 65, 23–33. [Google Scholar] [CrossRef]
  11. Floyd, S.K.; Bowman, J.L. The Ancestral Developmental Tool Kit of Land Plants. Int. J. Plant Sci. 2007, 168, 1–35. [Google Scholar] [CrossRef]
  12. Ma, X.; Ma, J.; Fan, D.; Li, C.; Jiang, Y.; Luo, K. Genome-Wide Identification of TCP Family Transcription Factors from Populus euphratica and Their Involvement in Leaf Shape Regulation. Sci. Rep. 2016, 6, 32795. [Google Scholar] [CrossRef]
  13. Leng, X.; Wei, H.; Xu, X.; Ghuge, S.A.; Jia, D.; Liu, G.; Wang, Y.; Yuan, Y. Genome-Wide Identification and Transcript Analysis of TCP Transcription Factors in Grapevine. BMC Genom. 2019, 20, 786. [Google Scholar] [CrossRef] [Green Version]
  14. Tatematsu, K.; Nakabayashi, K.; Kamiya, Y.; Nambara, E. Transcription Factor AtTCP14 Regulates Embryonic Growth Potential During Seed Germination in Arabidopsis thaliana. Plant J. 2008, 53, 42–52. [Google Scholar] [CrossRef]
  15. Li, Z.Y.; Li, B.; Dong, A.W. The Arabidopsis Transcription Factor AtTCP15 Regulates Endoreduplication by Modulating Expression of Key Cell-Cycle Genes. Mol. Plant 2012, 5, 270–280. [Google Scholar] [CrossRef]
  16. Li, C.; Potuschak, T.; Colón-Carmona, A.; Gutiérrez, R.A.; Doerner, P. Arabidopsis TCP20 Links Regulation of Growth and Cell Division Control Pathways. Proc. Natl. Acad. Sci. USA 2005, 102, 12978–12983. [Google Scholar] [CrossRef] [Green Version]
  17. Takeda, T.; Amano, K.; Ohto, M.A.; Nakamura, K.; Sato, S.; Kato, T.; Tabata, S.; Ueguchi, C. RNA Interference of the Arabidopsis Putative Transcription Factor TCP16 Gene Results in Abortion of Early Pollen Development. Plant Mol. Biol. 2006, 61, 165–177. [Google Scholar] [CrossRef]
  18. Rueda-Romero, P.; Barrero-Sicilia, C.; Gómez-Cadenas, A.; Carbonero, P.; Oñate-Sánchez, L. Arabidopsis thaliana DOF6 Negatively Affects Germination in non-After-Ripened Seeds and Interacts with TCP14. J. Exp. Bot. 2012, 63, 1937–1949. [Google Scholar] [CrossRef] [Green Version]
  19. Schommer, C.; Palatnik, J.F.; Aggarwal, P.; Chételat, A.; Cubas, P.; Farmer, E.E.; Nath, U.; Weigel, D. Control of Jasmonate Biosynthesis and Senescence by miR319 Targets. PLoS Biol. 2008, 6, e230. [Google Scholar] [CrossRef] [Green Version]
  20. Giraud, E.; Ng, S.; Carrie, C.; Duncan, O.; Low, J.; Lee, C.P.; Van Aken, O.; Millar, A.H.; Murcha, M.; Whelan, J. TCP Transcription Factors Link the Regulation of Genes Encoding Mitochondrial Proteins with the Circadian Clock in Arabidopsis thaliana. Plant Cell 2010, 22, 3921–3934. [Google Scholar] [CrossRef] [Green Version]
  21. Pruneda-Paz, J.L.; Kay, S.A. An Expanding Universe of Circadian Networks in Higher Plants. Trends Plant Sci. 2010, 15, 259–265. [Google Scholar] [CrossRef] [Green Version]
  22. Qi, X.; Qu, Y.; Jiang, J.; Guan, Y.; Song, A.; Cao, P.; Guan, Z.; Fang, W.; Chen, S.; Chen, F.; et al. Heterologous Expression of Chrysanthemum nankingense TCP13 Suppresses Leaf Development in Arabidopsis thaliana. Plant Growth Regul. 2021, 95, 331–341. [Google Scholar] [CrossRef]
  23. Danisman, S.; van der Wal, F.; Dhondt, S.; Waites, R.; de Folter, S.; Bimbo, A.; van Dijk, A.D.; Muino, J.M.; Cutri, L.; Dornelas, M.C.; et al. Arabidopsis Class I and class II TCP Transcription Factors Regulate Jasmonic Acid Metabolism and Leaf Development Antagonistically. Plant Physiol. 2012, 159, 1511–1523. [Google Scholar] [CrossRef] [Green Version]
  24. Aguilar-Martínez, J.A.; Sinha, N. Analysis of the Role of Arabidopsis class I TCP Genes AtTCP7, AtTCP8, AtTCP22, and AtTCP23 in Leaf Development. Front. Plant Sci. 2013, 4, 406. [Google Scholar] [CrossRef] [Green Version]
  25. Ori, N.; Cohen, A.R.; Etzioni, A.; Brand, A.; Yanai, O.; Shleizer, S.; Menda, N.; Amsellem, Z.; Efroni, I.; Pekker, I.; et al. Regulation of LANCEOLATE by miR319 Is Required for Compound-Leaf Development in Tomato. Nat. Genet. 2007, 39, 787–791. [Google Scholar] [CrossRef]
  26. Camoirano, A.; Arce, A.L.; Ariel, F.D.; Alem, A.L.; Gonzalez, D.H.; Viola, I.L. Class I TCP Transcription Factors Regulate Trichome Branching and Cuticle Development in Arabidopsis. J. Exp. Bot. 2020, 71, 5438–5453. [Google Scholar] [CrossRef]
  27. Aguilar-Martínez, J.A.; Poza-Carrión, C.; Cubas, P. Arabidopsis BRANCHED1 Acts as an Integrator of Branching Signals Within Axillary Buds. Plant Cell. 2007, 19, 458–472. [Google Scholar] [CrossRef]
  28. Takeda, T.; Suwa, Y.; Suzuki, M.; Kitano, H.; Ueguchi-Tanaka, M.; Ashikari, M.; Matsuoka, M.; Ueguchi, C. The OsTB1 Gene Negatively Regulates Lateral Branching in Rice. Plant J. 2003, 33, 513–520. [Google Scholar] [CrossRef]
  29. Narumi, T.; Aida, R.; Koyama, T.; Yamaguchi, H.; Sasaki, K.; Shikata, M.; Nakayama, M.; Ohme-Takagi, M.; Ohtsubo, N. Arabidopsis Chimeric TCP3 Repressor Produces Novel Floral Traits in Torenia fournieri and Chrysanthemum morifolium. Plant Biotechnol. 2011, 28, 131–140. [Google Scholar] [CrossRef] [Green Version]
  30. Li, D.B.; Zhang, H.; Mou, M.; Chen, Y.; Xiang, S.; Chen, L.; Yu, D. Arabidopsis class II TCP Transcription Factors Integrate with the FT–FD Module to Control Flowering. Plant Physiol. 2019, 181, 97–111. [Google Scholar] [CrossRef]
  31. Kubota, A.; Ito, S.; Shim, J.S.; Johnson, R.S.; Song, Y.H.; Breton, G.; Goralogia, G.S.; Kwon, M.S.; Laboy Cintrón, D.; Koyama, T.; et al. TCP4-Dependent Induction of CONSTANS Transcription Requires GIGANTEA in Photoperiodic Flowering in Arabidopsis. PLoS Genet. 2017, 13, e1006856. [Google Scholar] [CrossRef] [PubMed]
  32. Lucero, L.E.; Manavella, P.A.; Gras, D.E.; Ariel, F.D.; Gonzalez, D.H. Class Ⅰ and class Ⅱ TCP Transcription Factors Modulate SOC1-Dependent Flowering at Multiple Levels. Mol. Plant 2017, 10, 1571–1574. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Liu, J.; Cheng, X.; Liu, P.; Li, D.; Chen, T.; Gu, X.; Sun, J. MicroRNA319-Regulated TCPs Interact with FBHs and PFT1 to Activate CO Transcription and Control Flowering Time in Arabidopsis. PLoS Genet. 2017, 13, e1006833. [Google Scholar] [CrossRef] [Green Version]
  34. Davière, J.M.; Wild, M.; Regnault, T.; Baumberger, N.; Eisler, H.; Genschik, P.; Achard, P. Class I TCP-DELLA Interactions in Inflorescence Shoot Apex Determine Plant Height. Curr. Biol. 2014, 24, 1923–1928. [Google Scholar] [CrossRef] [Green Version]
  35. Sarvepalli, K.; Nath, U. Hyper-Activation of the TCP4 Transcription Factor in Arabidopsis thaliana Accelerates Multiple Aspects of Plant Maturation. Plant J. 2011, 67, 595–607. [Google Scholar] [CrossRef] [Green Version]
  36. Sarvepalli, K.; Nath, U. Interaction of TCP4-Mediated Growth Module with Phytohormones. Plant Signal. Behav. 2011, 6, 1440–1443. [Google Scholar] [CrossRef] [Green Version]
  37. Hao, J.; Tu, L.; Hu, H.; Tan, J.; Deng, F.; Tang, W.; Nie, Y.; Zhang, X. GbTCP, a Cotton TCP Transcription Factor, Confers Fibre Elongation and Root Hair Development by a Complex Regulating System. J. Exp. Bot. 2012, 63, 6267–6281. [Google Scholar] [CrossRef] [Green Version]
  38. Koyama, T.; Furutani, M.; Tasaka, M.; Ohme-Takagi, M. TCP Transcription Factors Control the Morphology of Shoot Lateral Organs via Negative Regulation of the Expression of Boundary-Specific Genes in Arabidopsis. Plant Cell 2007, 19, 473–484. [Google Scholar] [CrossRef] [Green Version]
  39. Wang, S.T.; Sun, X.L.; Hoshino, Y.; Yu, Y.; Jia, B.; Sun, Z.W.; Sun, M.Z.; Duan, X.B.; Zhu, Y.M. MicroRNA319 Positively Regulates Cold Tolerance by Targeting OsPCF6 and OsTCP21 in Rice (Oryza sativa L.). PLoS ONE 2014, 9, e91357. [Google Scholar] [CrossRef] [Green Version]
  40. Kosugi, S.; Ohashi, Y. DNA Binding and Dimerization Specificity and Potential Targets for the TCP Protein Family. Plant J. 2002, 30, 337–348. [Google Scholar] [CrossRef]
  41. Viola, I.L.; Uberti Manassero, N.; Ripoll, R.; Gonzalez, D. The Arabidopsis class I TCP Transcription Factor AtTCP11 Is a Developmental Regulator with Distinct DNA-Binding Properties due to the Presence of a Threonine Residue at position 15 of the TCP Domain. Biochem. J. 2011, 435, 143–155. [Google Scholar] [CrossRef] [Green Version]
  42. Parapunova, V.; Busscher, M.; Busscher-Lange, J.; Lammers, M.; Karlova, R.; Bovy, A.G.; Angenent, G.C.; de Maagd, R.A. Identification, Cloning and Characterization of the Tomato TCP Transcription Factor Family. BMC Plant Biol. 2014, 14, 157. [Google Scholar] [CrossRef] [Green Version]
  43. Viola, I.L.; Reinheimer, R.; Ripoll, R.; Manassero, N.G.U.; Gonzalez, D.H. Determinants of the DNA Binding Specificity of Class I and class II TCP Transcription Factors. J. Biol. Chem. 2012, 287, 347–356. [Google Scholar] [CrossRef] [Green Version]
  44. Tähtiharju, S.; Rijpkema, A.S.; Vetterli, A.; Albert, V.A.; Teeri, T.H.; Elomaa, P. Evolution and Diversification of the CYC/TB1 Gene Family in Asteraceae—A Comparative Study in Gerbera (Mutisieae) and Sunflower (Heliantheae). Mol. Biol. Evol. 2012, 29, 1155–1166. [Google Scholar] [CrossRef] [Green Version]
  45. Danisman, S.; van Dijk, A.D.; Bimbo, A.; van der Wal, F.; Hennig, L.; de Folter, S.; Angenent, G.C.; Immink, R.G. Analysis of Functional Redundancies Within the Arabidopsis TCP Transcription Factor Family. J. Exp. Bot. 2013, 64, 5673–5685. [Google Scholar] [CrossRef] [Green Version]
  46. Wang, J.; Guan, Y.; Ding, L.; Li, P.; Zhao, W.; Jiang, J.; Chen, S.; Chen, F. The CmTCP20 Gene Regulates Petal Elongation Growth in Chrysanthemum morifolium. Plant Sci. 2019, 280, 248–257. [Google Scholar] [CrossRef]
  47. Gull, A.; Lone, A.A.; Wani, N. Biotic and Abiotic Stresses in Plants. In Abiotic Biotic Stress Plants; InTech Open: London, UK, 2019. [Google Scholar]
  48. Chinnusamy, V.; Zhu, J.; Zhu, J.K. Cold Stress Regulation of Gene Expression in Plants. Trends Plant Sci. 2007, 12, 444–451. [Google Scholar] [CrossRef]
  49. Lissarre, M.; Ohta, M.; Sato, A.; Miura, K. Cold-Responsive Gene Regulation During Cold Acclimation in Plants. Plant Signal. Behav. 2010, 5, 948–952. [Google Scholar] [CrossRef] [Green Version]
  50. Zhao, C.; Lang, Z.; Zhu, J.K. Cold Responsive Gene Transcription Becomes More Complex. Trends Plant Sci. 2015, 20, 466–468. [Google Scholar] [CrossRef] [Green Version]
  51. Shi, Y.; Ding, Y.; Yang, S. Molecular Regulation of CBF Signaling in Cold Acclimation. Trends Plant Sci. 2018, 23, 623–637. [Google Scholar] [CrossRef]
  52. Dong, C.H.; Agarwal, M.; Zhang, Y.; Xie, Q.; Zhu, J.K. The Negative Regulator of Plant Cold Responses, HOS1, is a RING E3 Ligase That Mediates the Ubiquitination and Degradation of ICE1. Proc. Natl. Acad. Sci. USA 2006, 103, 8281–8286. [Google Scholar] [CrossRef] [Green Version]
  53. Bergonzi, S.; Albani, M.C.; Ver Loren van Themaat, E.; Nordström, K.J.; Wang, R.; Schneeberger, K.; Moerland, P.D.; Coupland, G. Mechanisms of Age-Dependent Response to Winter Temperature in Perennial Flowering of Arabis alpina. Science 2013, 340, 1094–1097. [Google Scholar] [CrossRef]
  54. Yang, C.; Li, D.; Mao, D.; Liu, X.; Ji, C.; Li, X.; Zhao, X.; Cheng, Z.; Chen, C.; Zhu, L. Overexpression of microRNA319 Impacts Leaf Morphogenesis and Leads to Enhanced Cold Tolerance in Rice (Oryza sativa L.). Plant Cell Environ. 2013, 36, 2207–2218. [Google Scholar] [CrossRef]
  55. Thiebaut, F.; Rojas, C.A.; Almeida, K.L.; Grativol, C.; Domiciano, G.C.; Lamb, C.R.; Engler, J.A.; Hemerly, A.S.; Ferreira, P.C. Regulation of miR319 During Cold Stress in Sugarcane. Plant Cell Environ. 2012, 35, 502–512. [Google Scholar] [CrossRef]
  56. Capovilla, G.; Pajoro, A.; Immink, R.G.; Schmid, M. Role of Alternative Pre-mRNA Splicing in Temperature Signaling. Curr. Opin. Plant Biol. 2015, 27, 97–103. [Google Scholar] [CrossRef]
  57. Ren, L.; Sun, J.; Chen, S.; Gao, J.; Dong, B.; Liu, Y.; Xia, X.; Wang, Y.; Liao, Y.; Teng, N.; et al. A Transcriptomic Analysis of Chrysanthemum nankingense Provides Insights into the Basis of Low Temperature Tolerance. BMC Genom. 2014, 15, 844. [Google Scholar] [CrossRef] [Green Version]
  58. Dong, B.; Wang, H.; Liu, T.; Cheng, P.; Chen, Y.; Chen, S.; Guan, Z.; Fang, W.; Jiang, J.; Chen, F. Whole Genome Duplication Enhances the Photosynthetic Capacity of Chrysanthemum nankingense. Mol. Genet. Genom. 2017, 292, 1247–1256. [Google Scholar] [CrossRef]
  59. Wang, H.; Jiang, J.; Chen, S.; Fang, W.; Guan, Z.; Liao, Y.; Chen, F. Rapid Genomic and Transcriptomic Alterations Induced by Wide Hybridization: Chrysanthemum nankingense × Tanacetum vulgare and C. crassum × Crossostephium chinense (Asteraceae). BMC Genom. 2013, 14, 902. [Google Scholar] [CrossRef] [Green Version]
  60. Qi, X.; Qu, Y.; Gao, R.; Jiang, J.; Fang, W.; Guan, Z.; Zhang, F.; Zhao, S.; Chen, S.; Chen, F.; et al. The Heterologous Expression of a Chrysanthemum nankingense TCP Transcription Factor Blocks Cell Division in Yeast and Arabidopsis thaliana. Int. J. Mol. Sci. 2019, 20, 4848. [Google Scholar] [CrossRef] [Green Version]
  61. Song, C.; Liu, Y.; Song, A.; Dong, G.; Zhao, H.; Sun, W.; Ramakrishnan, S.; Wang, Y.; Wang, S.; Li, T.; et al. The Chrysanthemum nankingense Genome Provides Insights into the Evolution and Diversification of Chrysanthemum Flowers and Medicinal Traits. Mol. Plant 2018, 11, 1482–1491. [Google Scholar] [CrossRef] [Green Version]
  62. Wang, H.; Jiang, J.; Chen, S.; Qi, X.; Peng, H.; Li, P.; Song, A.; Guan, Z.; Fang, W.; Liao, Y.; et al. Next-Generation Sequencing of the Chrysanthemum nankingense (Asteraceae) Transcriptome Permits Large-Scale Unigene Assembly and SSR Marker Discovery. PLoS ONE 2013, 8, e62293. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Badouin, H.; Gouzy, J.; Grassa, C.J.; Murat, F.; Staton, S.E.; Cottret, L.; Lelandais-Brière, C.; Owens, G.L.; Carrère, S.; Mayjonade, B.; et al. The Sunflower Genome Provides Insights into Oil Metabolism, Flowering and Asterid Evolution. Nature 2017, 546, 148–152. [Google Scholar] [CrossRef] [PubMed]
  64. Masuda, H.P.; Cabral, L.M.; De Veylder, L.; Tanurdzic, M.; de Almeida Engler, J.; Geelen, D.; Inzé, D.; Martienssen, R.A.; Ferreira, P.C.; Hemerly, A.S. ABAP1 Is a Novel Plant Armadillo BTB Protein Involved in DNA Replication and Transcription. EMBO J. 2008, 27, 2746–2756. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Jia, L.; Mao, Y.; Ji, Q.; Dersh, D.; Yewdell, J.W.; Qian, S.B. Decoding mRNA Translatability and Stability from the 5′ UTR. Nat. Struct. Mol. Biol. 2020, 27, 814–821. [Google Scholar] [CrossRef]
  66. Chung, B.Y.W.; Simons, C.; Firth, A.E.; Brown, C.M.; Hellens, R.P. Effect of 5′UTR Introns on Gene Expression in Arabidopsis thaliana. BMC Genom. 2006, 7, 120. [Google Scholar] [CrossRef] [Green Version]
  67. Hogg, J.R.; Goff, S.P. Upf1 Senses 3′UTR Length to Potentiate mRNA Decay. Cell 2010, 143, 379–389. [Google Scholar] [CrossRef] [Green Version]
  68. Shaul, O. How Introns Enhance Gene Expression. Int. J. Biochem. Cell Biol. 2017, 91, 145–155. [Google Scholar] [CrossRef]
  69. Singh, K.B.; Foley, R.C.; Oñate-Sánchez, L. Transcription Factors in Plant Defense and Stress Responses. Curr. Opin. Plant Biol. 2002, 5, 430–436. [Google Scholar] [CrossRef]
  70. Oda, A.; Narumi, T.; Li, T.; Kando, T.; Higuchi, Y.; Sumitomo, K.; Fukai, S.; Hisamatsu, T. CsFTL3, A Chrysanthemum FLOWERING LOCUS T-like Gene, is A Key Regulator of Photoperiodic Flowering in Chrysanthemums. J. Exp. Bot. 2012, 63, 1461–1477. [Google Scholar] [CrossRef] [Green Version]
  71. Chen, M.-D.; Wang, B.; Li, Y.-P.; Zeng, M.-J.; Liu, J.-T.; Ye, X.-R.; Zhu, H.-S.; Wen, Q.-F. Reference Gene Selection for qRT-PCR Analyses of Luffa (Luffa cylindrica) Plants under Abiotic Stress Conditions. Sci. Rep. 2021, 11, 3161. [Google Scholar] [CrossRef]
  72. Cai, J.; Li, P.; Luo, X.; Chang, T.; Li, J.; Zhao, Y.; Xu, Y. Selection of Appropriate Reference Genes for the Detection of Rhythmic Gene Expression via Quantitative Real-time PCR in Tibetan hulless Barley. PLoS ONE 2018, 13, e0190559. [Google Scholar] [CrossRef] [Green Version]
  73. Salone, V.; Rederstorff, M. Stem-Loop RT-PCR Based Quantification of Small Non-Coding RNAs. In Small Non-Coding RNAs; Rederstorff, M., Ed.; Methods in Molecular Biology Series; Springer: Cham, Switzerland, 2015; Volume 1296. [Google Scholar] [CrossRef]
  74. Galiveti, C.R.; Rozhdestvensky, T.S.; Brosius, J.; Lehrach, H.; Konthur, Z. Application of Housekeeping npcRNAs for Quantitative Expression Analysis of Human Transcriptome by Real-time PCR. RNA 2010, 16, 450–461. [Google Scholar] [CrossRef] [Green Version]
  75. Mestdagh, P.; Van Vlierberghe, P.; De Weer, A.; Muth, D.; Westermann, F.; Speleman, F.; Vandesompele, J. A Novel and Universal Method for microRNA RT-qPCR Data Normalization. Genome Biol. 2009, 10, R64. [Google Scholar] [CrossRef] [Green Version]
  76. Novillo, F.; Alonso, J.M.; Ecker, J.R.; Salinas, J. CBF2/DREB1C Is a Negative Regulator of CBF1/DREB1B and CBF3/DREB1A Expression and Plays a Central Role in Stress Tolerance in Arabidopsis. Proc. Natl. Acad. Sci. USA 2004, 101, 3985–3990. [Google Scholar] [CrossRef] [Green Version]
  77. Zhao, C.; Zhang, Z.; Xie, S.; Si, T.; Li, Y.; Zhu, J.K. Mutational Evidence for the Critical Role of CBF Transcription Factors in Cold Acclimation in Arabidopsis. Plant Physiol. 2016, 171, 2744–2759. [Google Scholar] [CrossRef] [Green Version]
  78. Wu, J.F.; Tsai, H.L.; Joanito, I.; Wu, Y.C.; Chang, C.W.; Li, Y.H.; Wang, Y.; Hong, J.C.; Chu, J.W.; Hsu, C.P.; et al. LWD–TCP Complex Activates the Morning Gene CCA1 in Arabidopsis. Nat. Commun. 2016, 7, 13181. [Google Scholar] [CrossRef] [Green Version]
  79. Moon, J.; Suh, S.S.; Lee, H.; Choi, K.R.; Hong, C.B.; Paek, N.C.; Kim, S.G.; Lee, I. The SOC1 MADS-Box Gene Integrates Vernalization and Gibberellin Signals for Flowering in Arabidopsis. Plant J. 2003, 35, 613–623. [Google Scholar] [CrossRef]
  80. Feng, Z.J.; Xu, S.C.; Liu, N.; Zhang, G.W.; Hu, Q.Z.; Gong, Y.M. Soybean TCP Transcription Factors: Evolution, Classification, Protein Interaction and Stress and Hormone Responsiveness. Plant Physiol. Biochem. 2018, 127, 129–142. [Google Scholar] [CrossRef]
  81. Ge, W.; Steber, C.M. Positive and Negative Regulation of Seed Germination by the Arabidopsis GA Hormone Receptors, GID1a, b, and c. Plant Direct. 2018, 2, e00083. [Google Scholar] [CrossRef]
  82. Cubas, P. Role of TCP Genes in the Evolution of Key Morphological Characters in Angiosperms. In Developmental Genetics and Plant Evolution; Taylor & Francis: Abingdon, UK, 2002; pp. 247–266. [Google Scholar]
  83. He, Z.; Zhao, X.; Kong, F.; Zuo, Z.; Liu, X. TCP2 Positively Regulates HY5/HYH and Photomorphogenesis in Arabidopsis. J. Exp. Bot. 2016, 67, 775–785. [Google Scholar] [CrossRef] [Green Version]
  84. Li, Y.; Shi, Y.; Li, M.; Fu, D.; Wu, S.; Li, J.; Gong, Z.; Liu, H.; Yang, S. The CRY2-COP1-HY5-BBX7/8 Module Regulates Blue Light-Dependent Cold Acclimation in Arabidopsis. Plant Cell 2021, 33, 3555–3573. [Google Scholar] [CrossRef] [PubMed]
  85. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  86. Wang, H. Genome Evoultion and Epigenetic of Chrysanthemun and Its Related Species. Ph.D. Thesis, Nanjing Agricultural University, Nanjing, China, 2014. [Google Scholar]
  87. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
  88. Tian, F.; Yang, D.C.; Meng, Y.Q.; Jin, J.; Gao, G. PlantRegMap: Charting Functional Regulatory Maps in Plants. Nucleic Acids Res. 2020, 48, D1104–D1113. [Google Scholar] [CrossRef]
  89. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a Database of Plant cis-Acting Regulatory Elements and a Portal to Tools for In Silico Analysis of Promoter Sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
  90. Ding, R.; Che, X.; Shen, Z.; Zhang, Y. Metabolome and Transcriptome Profiling Provide Insights into Green Apple Peel Reveals Light- and UV-B-Responsive Pathway in Anthocyanins Accumulation. BMC Plant Biol. 2021, 21, 351. [Google Scholar] [CrossRef]
  91. Zheng, Q.; Zuo, J.; Gu, S.; Gao, L.; Hu, W.; Wang, Q.; Jiang, A. Putrescine Treatment Reduces Yellowing During Senescence of Broccoli (Brassica oleracea L. var. italica). Postharvest Biol. Technol. 2019, 152, 29–35. [Google Scholar] [CrossRef]
  92. Li, W.; Huang, D.; Wang, B.; Hou, X.; Zhang, R.; Yan, M.; Liao, W. Changes of Starch and Sucrose Content and Related Gene Expression During the Growth and Development of Lanzhou Lily Bulb. PLoS ONE 2022, 17, e0262506. [Google Scholar] [CrossRef]
Plants 11 00936 g001 550
Figure 1. Phylogenetic relationships of CnTCP proteins. The phylogenetic tree was generated using the MEGA7.0 program; the bHLH domain amino acid sequences of TCP proteins from Glycine max (Gm), Oryza sativa (Os), Zea mays (Zm), Chrysanthemum nankingense (Cn), and Arabidopsis thaliana (At) were used.
Figure 1. Phylogenetic relationships of CnTCP proteins. The phylogenetic tree was generated using the MEGA7.0 program; the bHLH domain amino acid sequences of TCP proteins from Glycine max (Gm), Oryza sativa (Os), Zea mays (Zm), Chrysanthemum nankingense (Cn), and Arabidopsis thaliana (At) were used.
Plants 11 00936 g001
Plants 11 00936 g002 550
Figure 2. Amino acid alignment among TCP proteins. Amino acids alignment using the bHLH domain amino acid sequences of TCP proteins from Chrysanthemum nankingense and Arabidopsis thaliana. The blue line shows PCF subfamily in class I; the yellow line shows CIN subfamily in class II; the green line shows CYC/TB1 subfamily in class II.
Figure 2. Amino acid alignment among TCP proteins. Amino acids alignment using the bHLH domain amino acid sequences of TCP proteins from Chrysanthemum nankingense and Arabidopsis thaliana. The blue line shows PCF subfamily in class I; the yellow line shows CIN subfamily in class II; the green line shows CYC/TB1 subfamily in class II.
Plants 11 00936 g002
Plants 11 00936 g003 550
Figure 3. Predicted protein schematic structures of TCPs. The protein structure based on the TCP proteins from Arabidopsis thaliana (left) and Chrysanthemum nankingense (right); other additional domains are as identified by SMART. The bottom box indicates the motif number, symbol, and the motif consensus sequence of the corresponding domain. Actual motif length and order are presented for each protein.
Figure 3. Predicted protein schematic structures of TCPs. The protein structure based on the TCP proteins from Arabidopsis thaliana (left) and Chrysanthemum nankingense (right); other additional domains are as identified by SMART. The bottom box indicates the motif number, symbol, and the motif consensus sequence of the corresponding domain. Actual motif length and order are presented for each protein.
Plants 11 00936 g003
Plants 11 00936 g004 550
Figure 4. Sequence LOGOs for each motif of TCP domains using the MEME algorithm. The motif consensus of the predicted domain in CnTCP and AtTCP proteins. The height of a single letter in the stack indicates the probability of that letter in that position multiplied by the total information content of the stack.
Figure 4. Sequence LOGOs for each motif of TCP domains using the MEME algorithm. The motif consensus of the predicted domain in CnTCP and AtTCP proteins. The height of a single letter in the stack indicates the probability of that letter in that position multiplied by the total information content of the stack.
Plants 11 00936 g004
Plants 11 00936 g005 550
Figure 5. qRT-PCR analysis of CnTCP gene expression under cold stress. (A,B) Expression pattern of the CnTCP genes after a 7-day low temperature (4 °C, LT) treatment. The expression level of CnTCP14 at 22 °C room temperature (RT) was set at 1.0 due to its medium expression level, which could better show the expression pattern of TCP family genes. The EF-1α gene was used as an internal control. For readability, CnTCPs with lower expression levels are included in panel A, while the ones with higher expression levels are included in panel B. One and two asterisks represent significant difference at p < 0.05 and p < 0.01, respectively, according to the paired-samples t-test.
Figure 5. qRT-PCR analysis of CnTCP gene expression under cold stress. (A,B) Expression pattern of the CnTCP genes after a 7-day low temperature (4 °C, LT) treatment. The expression level of CnTCP14 at 22 °C room temperature (RT) was set at 1.0 due to its medium expression level, which could better show the expression pattern of TCP family genes. The EF-1α gene was used as an internal control. For readability, CnTCPs with lower expression levels are included in panel A, while the ones with higher expression levels are included in panel B. One and two asterisks represent significant difference at p < 0.05 and p < 0.01, respectively, according to the paired-samples t-test.
Plants 11 00936 g005
Plants 11 00936 g006 550
Figure 6. Mature miR319 and predicted target CnTCP expression in response to cold stress. (A) Predicted CnTCP transcript targets of miR319. (B) Expression levels of mature miR319 and its predicted targets CnTCP2/4/14 in two-month-old Chrysanthemum nankingense plants treated at 4 °C for 0, 6, and 24 h. U6 and EF-1α were used as the internal control in miR319 and CnTCP expression detection, respectively. Values are means ± SD. The different capital letters represent significant differences at p < 0.01 according to the Duncan’s test.
Figure 6. Mature miR319 and predicted target CnTCP expression in response to cold stress. (A) Predicted CnTCP transcript targets of miR319. (B) Expression levels of mature miR319 and its predicted targets CnTCP2/4/14 in two-month-old Chrysanthemum nankingense plants treated at 4 °C for 0, 6, and 24 h. U6 and EF-1α were used as the internal control in miR319 and CnTCP expression detection, respectively. Values are means ± SD. The different capital letters represent significant differences at p < 0.01 according to the Duncan’s test.
Plants 11 00936 g006
Plants 11 00936 g007 550
Figure 7. CnTCP4 negatively regulated cold acclimation. Sensitivity of cold acclimated plants to freezing. (A–C) show the wildtype Arabidopsis, CnTCP4-2, and CnTCP4-3 overexpressing seedlings after a 2-day recovery from a 20 min freezing treatment at −20 °C, respectively. The leaves with wilting and yellowing phenotypes were labeled by red arrows. (D–F) show the chlorophyll, soluble sugar, and malondialdehyde (MDA) contents in 4-week-old CnTCP4 overexpressing Arabidopsis seedlings exposed to 4 °C for two days, respectively. (G) 8-day-old seedlings of OECnTCP4 Arabidopsis were treated at 4 °C for 0, 6, and 24 h. Expression of cold-related genes AtCBF1/2/3 were assessed by performing quantitative real-time PCRs. ACTIN8 was used as the internal control. Values are means ± SD. One and two asterisks represent significant differences at p < 0.05 and p < 0.01, respectively, according to the Duncan’s test.
Figure 7. CnTCP4 negatively regulated cold acclimation. Sensitivity of cold acclimated plants to freezing. (A–C) show the wildtype Arabidopsis, CnTCP4-2, and CnTCP4-3 overexpressing seedlings after a 2-day recovery from a 20 min freezing treatment at −20 °C, respectively. The leaves with wilting and yellowing phenotypes were labeled by red arrows. (D–F) show the chlorophyll, soluble sugar, and malondialdehyde (MDA) contents in 4-week-old CnTCP4 overexpressing Arabidopsis seedlings exposed to 4 °C for two days, respectively. (G) 8-day-old seedlings of OECnTCP4 Arabidopsis were treated at 4 °C for 0, 6, and 24 h. Expression of cold-related genes AtCBF1/2/3 were assessed by performing quantitative real-time PCRs. ACTIN8 was used as the internal control. Values are means ± SD. One and two asterisks represent significant differences at p < 0.05 and p < 0.01, respectively, according to the Duncan’s test.
Plants 11 00936 g007
Table
Table 1. Percentage homology among full-length CnTCPs proteins.
Table 1. Percentage homology among full-length CnTCPs proteins.
CnTCPSCnTCP4-1CnTCP4-3CnTCP4-2CnTCP14CnTCP2-3CnTCP2-2CnTCP2-1CnTCP13CnTCP5CnTCP17CnTCP3CnTCP15
CnTCP1010.70%11.40%11.00%11.60%11.80%12.10%12.10%10.30%12.90%16.30%12.30%11.20%
CnTCP1211.20%11.90%11.20%12.40%11.30%11.40%11.30%10.60%14.20%15.50%12.00%11.20%
CnTCP1614.10%14.20%14.10%13.10%15.50%15.50%15.50%12.90%13.80%16.10%15.50%15.20%
CnTCP915.80%15.70%15.70%11.80%12.60%12.70%12.70%13.20%18.80%17.60%15.10%14.40%
CnTCP715.30%14.80%14.80%14.70%14.80%15.00%14.80%12.00%14.20%13.80%15.50%16.80%
CnTCP814.00%13.40%13.70%9.40%11.00%11.10%11.00%12.20%12.90%12.80%17.40%14.10%
CnTCP18-111.80%11.90%11.80%13.40%13.60%13.60%13.80%14.20%15.50%18.10%16.40%16.10%
CnTCP18-212.30%12.40%12.30%14.00%13.70%13.70%14.00%14.70%16.00%17.80%16.50%16.20%
CnTCP616.40%16.10%16.40%15.70%14.90%14.70%14.60%15.80%17.60%17.40%14.80%15.80%
CnTCP119.80%20.60%20.60%19.10%17.60%17.60%17.50%17.50%19.70%22.50%31.10%29.20%
CnTCP1120.70%21.50%20.80%15.70%17.40%17.40%17.30%17.30%14.90%19.10%27.00%25.90%
CnTCP1516.00%16.50%16.00%17.60%18.80%18.80%18.70%16.00%16.20%19.90%46.20%100%
CnTCP316.50%15.70%16.10%15.40%17.00%17.00%16.90%16.70%17.80%17.90%100%
CnTCP1720.10%20.30%20.40%25.30%26.20%26.10%26.00%37.20%52.10%100%
CnTCP519.50%20.10%19.50%23.90%23.70%23.70%23.60%34.70%100%
CnTCP1319.90%21.00%21.00%26.60%24.60%24.60%24.80%100%
CnTCP2-120.20%19.40%20.00%57.40%99.50%99.80%100%
CnTCP2-220.30%19.50%20.10%57.10%99.80%100%
CnTCP2-320.40%19.60%20.10%57.10%100%
CnTCP1422.50%21.90%22.40%100%
CnTCP4-293.80%96.00%100%
CnTCP4-390.10%100%
CnTCP4-1100%
CnTCPSCnTCP11CnTCP1CnTCP6CnTCP18-2CnTCP18-1CnTCP8CnTCP7CnTCP9CnTCP16CnTCP12CnTCP10
CnTCP1012.40%11.90%26.80%28.00%28.30%34.20%28.70%36.00%50.00%68.10%100%
CnTCP1211.60%13.30%26.40%28.40%28.60%34.00%29.10%34.00%50.60%100%
CnTCP1611.50%13.80%27.40%31.30%31.70%38.10%35.70%39.30%100%
CnTCP914.80%18.20%28.70%31.50%31.50%28.90%33.10%100%
CnTCP716.20%16.20%28.80%30.20%29.20%38.50%100%
CnTCP813.00%14.50%28.80%29.70%29.20%100%
CnTCP18-114.10%16.20%41.70%97.30%100%
CnTCP18-214.20%16.20%41.30%100%
CnTCP616.30%13.90%100%
CnTCP152.30%100%
CnTCP11100%
Relatively high identities >50% were displayed in red font.
Table
Table 2. Statistical analysis of TFs identified from CnTCP promoter sequences.
Table 2. Statistical analysis of TFs identified from CnTCP promoter sequences.
FamilyAtTCPCnTCPFamilyAtTCPCnTCP
AP22418TCP2217
B32418ARF2416
bHLH2418BBR-BPC2416
bZIP2418WRKY2416
C2H22418ZF-HD2216
Dof2418LBD2116
ERF2418SBP2116
G2-like2418C3H2016
GATA2418WOX2215
HD-ZIP2418CPP2115
MIKC_MADS2418EIL1815
MYB2418NF-YB1615
MYB_related2418E2F/DP2314
NAC2418Nin-like2214
Trihelix2318RAV2214
GRAS2317SRS2113
ARR-B207
Data indicate the number of TCP genes with predicted TFs.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Tian, C.; Zhai, L.; Zhu, W.; Qi, X.; Yu, Z.; Wang, H.; Chen, F.; Wang, L.; Chen, S. Characterization of the TCP Gene Family in Chrysanthemum nankingense and the Role of CnTCP4 in Cold Tolerance. Plants 2022, 11, 936. https://doi.org/10.3390/plants11070936

AMA Style

Tian C, Zhai L, Zhu W, Qi X, Yu Z, Wang H, Chen F, Wang L, Chen S. Characterization of the TCP Gene Family in Chrysanthemum nankingense and the Role of CnTCP4 in Cold Tolerance. Plants. 2022; 11(7):936. https://doi.org/10.3390/plants11070936

Chicago/Turabian Style

Tian, Chang, Lisheng Zhai, Wenjing Zhu, Xiangyu Qi, Zhongyu Yu, Haibin Wang, Fadi Chen, Likai Wang, and Sumei Chen. 2022. "Characterization of the TCP Gene Family in Chrysanthemum nankingense and the Role of CnTCP4 in Cold Tolerance" Plants 11, no. 7: 936. https://doi.org/10.3390/plants11070936

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop