CAD Genes: Genome-Wide Identification, Evolution, and Their Contribution to Lignin Biosynthesis in Pear (Pyrus bretschneideri)
Abstract
1. Introduction
2. Results
2.1. Identification of the CAD Gene Family in Rosaceae
2.2. Phylogenetic Analysis of the CAD Genes
2.3. Expansion and Evolution of the CAD Gene Family
2.4. Chromosome Distribution and Synteny Events
2.5. CAD Gene Structure and CAD Protein Motif Analyses in Pear
2.6. Histochemical Test and the Content of Stone Cells during Fruit Development
2.7. Expression Patterns of the PbrCAD Genes
3. Discussion
4. Materials and Methods
4.1. Collection and Identification of the CAD Genes
4.2. Phylogenetic Analysis
4.3. Chromosomal Locations and Duplication Analysis
4.4. Calculation of Non-Synonymous (Ks) and Synonymous (Ka) Substitutions
4.5. Gene Structure and Motif Analyses in Pear
4.6. Plant Materials
4.7. Measurement of Stone Cell Number
4.8. Histochemical Staining
4.9. Expression Analysis Based on Transcriptomic Data
4.10. Quantitative Real-Time PCR (qRT-PCR)
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bhuiyan, N.H.; Selvaraj, G.; Wei, Y.D.; King, J. Role of lignification in plant defense. Plant Signal. Behav. 2009, 4, 158–159. [Google Scholar] [CrossRef] [Scilit]
- Deng, W.W.; Zhang, M.; Wu, J.Q.; Jiang, Z.Z.; Tang, L.; Li, Y.Y.; Wei, C.L.; Jiang, C.J.; Wan, X.C. Molecular cloning, functional analysis of three cinnamyl alcohol dehydrogenase (CAD) genes in the leaves of tea plant, Camellia sinensis. J. Plant Physiol. 2013, 170, 272–282. [Google Scholar] [CrossRef] [Scilit]
- Frost, C.J.; Mescher, M.C.; Carlson, J.E.; De Moraes, C.M. Plant defense priming against herbivores: Getting ready for a different battle. Plant Physiol. 2008, 146, 818–824. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cai, C.; Xu, C.J.; Li, X.; Ferguson, I.; Chen, K.S. Accumulation of lignin in relation to change in activities of lignification enzymes in loquat fruit flesh after harvest. Postharvest Biol. Technol. 2006, 40, 163–169. [Google Scholar] [CrossRef] [Scilit]
- Tao, S.T.; Khanizadeh, S.; Zhang, H.; Zhang, S.L. Anatomy, ultrastructure and lignin distribution of stone cells in two Pyrus species. Plant Sci. 2009, 176, 413–419. [Google Scholar] [CrossRef] [Scilit]
- Anterola, A.M.; Lewis, N.G. Trends in lignin modification: A comprehensive analysis of the effects of genetic manipulations/mutations on lignification and vascular integrity. Phytochemistry 2002, 61, 221–294. [Google Scholar] [CrossRef] [Scilit]
- Whetten, R.; Sederoff, R. Lignin biosynthesis. Plant Cell 1995, 7, 1001–1013. [Google Scholar] [CrossRef] [Scilit]
- Chabannes, M.; Barakate, A.; Lapierre, C.; Marita, J.M.; Ralph, J.; Pean, M.; Danoun, S.; Halpin, C.; Grima-Pettenati, J.; Boudet, A.M. Strong decrease in lignin content without significant alteration of plant development is induced by simultaneous down-regulation of cinnamoyl CoA reductase (CCR) and cinnamyl alcohol dehydrogenase (CAD) in tobacco plants. Plant J. 2001, 28, 257–270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pilate, G.; Guiney, E.; Holt, K.; Petit-Conil, M.; Lapierre, C.; Leplé, J.C.; Pollet, B.; Mila, I.; Webster, E.A.; Marstorp, H.G.; et al. Field and pulping performances of transgenic trees with altered lignification. Nat. Biotechnol. 2002, 20, 607–612. [Google Scholar] [CrossRef] [Scilit]
- Kaur, H.; Shaker, K.; Heinzel, N.; Ralph, J.; Gális, I.; Baldwin, I.T. Environmental Stresses of Field Growth Allow Cinnamyl Alcohol Dehydrogenase-Deficient Nicotiana attenuata Plants to Compensate for their Structural Deficiencies1. Plant Physiol. 2012, 159, 1545–1570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.; Ralph, J.; Lu, F.; Pilate, G.; Leple’, J.C.; Pollet, B.; Lapierre, C. Identification of the structure and origin of thioacidolysis marker compounds for cinnamyl alcohol dehydrogenase deficiency in angiosperms. J. Biol. Chem. 2002, 277, 47412–47419. [Google Scholar] [CrossRef] [Scilit]
- Saballos, A.; Ejeta, G.; Sanchez, E.; Kang, C.H.; Vermerris, W. A genomewide analysis of the cinnamyl alcohol dehydrogenase family in sorghum [Sorghum bicolor (L.) Moench] identifies SbCAD2 as the Brown midrib6 gene. Genetics 2009, 181, 783–795. [Google Scholar] [CrossRef] [Scilit]
- Van Acker, R.; Dejardin, A.; Desmet, S.; Hoengenaert, L.; Vanholme, R.; Morreel, K.; Laurans, F.; Kim, H.; Santoro, N.; Foster, C.; et al. Different Routes for Conifer- and Sinapaldehyde and Higher Saccharification upon Deficiency in the Dehydrogenase CAD1. Plant Physiol. 2017, 175, 1018–1039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barakat, A.; Bagniewska-Zadworna, A.; Choi, A.; Plakkat, U.; DiLoreto, D.S.; Yellanki, P.; Carlson, J.E. The cinnamyl alcohol dehydrogenase gene family in Populus: Phylogeny, organization, and expression. BMC Plant. Biol. 2009, 9, 26. [Google Scholar] [CrossRef] [Scilit]
- Gross, G.G.; Stöckigt, J.; Mansell, R.L.; ZENK, M.H. Three novel enzymes involved in the reduction of ferulic acid to coniferyl alcohol in higher plants: Ferulate: Co a ligase, feruloyl-Co a reductase and coniferyl alcohol oxidoreductase. FEBS Lett. 1973, 31, 283–286. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.J.; Kim, M.R.; Bedgar, D.L.; Moinuddin, S.G.A.; Cardenas, C.L.; Davin, L.B.; Kang, C.H.; Lewis, N.G. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 2004, 101, 1455–1460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tobias, C.M.; Chowk, E.K. Structure of the cinnamylalcohol dehydrogenase gene family in rice and promoter activity of a member associated with lignification. Planta 2005, 220, 678–688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.B.; Li, B.; Yang, Y.; Hu, W.R.; Chen, F.Y.; Xie, L.X.; Fan, L. Genomi-wide Investigation and Expression Analysis of CAD Gene Family in Gossypium hirsutum. Xinjiang Agric. Sci. 2016, 53, 1177–1187. [Google Scholar]
- Wu, J.; Wang, Z.W.; Shi, Z.B.; Zhang, S.; Ming, R.; Zhu, S.L.; Khan, M.A.; Tao, S.T.; Korban, S.S.; Wang, H.; et al. The genome of the pear (Pyrus bretschneideri Rehd.). Genome Res. 2013, 23, 396–408. [Google Scholar] [CrossRef] [Scilit]
- Cai, Y.P.; Li, G.Q.; Nie, J.Q.; Lin, Y.; Nie, F.; Zhang, J.Y.; Xu, Y.L. Study of the structure and biosynthetic pathway of lignin in stone cells of pear. Sci. Hortic. 2010, 125, 374–379. [Google Scholar] [CrossRef] [Scilit]
- Ganko, E.W.; Meyers, B.C.; Vision, T.J. Divergence in Expression between Duplicated Genes in Arabidopsis. Mol. Biol. Evol. 2007, 24, 2298–2309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tao, S.T.; Wang, D.Y.; Jin, C.; Sun, W.; Liu, X.; Zhang, S.L. Cinnamate-4-Hydroxylase Gene Is Involved in the Step of Lignin Biosynthesis in Chinese White Pear. J. Am. Soc. Hortic. 2015, 140, 573–579. [Google Scholar] [CrossRef] [Scilit]
- Freeling, M. Bias in plant gene content following different sorts of duplication: Tandem, whole-genome, segmental, or by transposition. Annu. Rev. Plant Biol. 2009, 60, 433–453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, H.; Li, L.L.; Xu, F.; Cheng, S.Y.; Cao, F.L.; Wang, Y.; Yuan, H.H.; Jiang, D.Z.; Wu, C.H. Expression patterns of a cinnamyl alcohol dehydrogenase gene involved in lignin biosynthesis and environmental stress in Ginkgo biloba. Mol. Biol. Rep. 2013, 40, 707–721. [Google Scholar] [CrossRef] [Scilit]
- Ma, C.; Zhang, H.P.; Li, J.M.; Tao, S.T.; Qiao, X.; Korban, S.S.; Zhang, S.L.; Wu, J. Genome-wide analysis and characterization of molecular evolution of the HCT gene family in pear (Pyrus bretschneideri). Plant Syst. Evol. 2017, 303, 71–90. [Google Scholar] [CrossRef] [Scilit]
- Gong, X.; Xie, Z.; Qi, K.; Zhao, L.; Yuan, Y.; Xu, J.; Rui, W.; Shiratake, K.; Bao, J.; Khanizadeh, S.; et al. PbMC1a/1b regulates lignification during stone cell development in pear (Pyrus bretschneideri) fruit. Hortic. Res.-Engl. 2020, 7, 59. [Google Scholar] [CrossRef] [Scilit]
- Jin, Y.Z.; Zhang, C.; Liu, W.; Qi, H.Y.; Chen, H.; Cao, S.X. The Cinnamyl Alcohol Dehydrogenase Gene Family in Melon (Cucumis melo L.): Bioinformatic Analysis and Expression Patterns. PLoS ONE 2014, 9, e101730. [Google Scholar]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit]
- Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef] [Scilit]
- Lee, T.H.; Tang, H.B.; Wang, X.Y.; Paterson, A.H. PGDD: A database of gene and genome duplication in plants. Nucleic Acids Res. 2013, 41, D1152–D1158. [Google Scholar] [CrossRef] [Scilit]
- Qiao, X.; Li, M.; Li, L.T.; Yin, H.; Wu, J.Y.; Zhang, S.L. Genome-wide identification and comparative analysis of the heat shock transcription factor family in Chinese white pear (Pyrus bretschneideri) and five other Rosaceae species. BMC Plant. Biol. 2015, 15, 12. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.S.; Li, K.Q.; Xu, X.Y.; Yao, Z.H.; Jin, C.; Zhang, S.L. Genome-wide analysis of WRKY transcription factors in white pear (Pyrus bretschneideri) reveals evolution and patterns under drought stress. BMC Genom. 2015, 16, 1104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.P.; Tang, H.B.; DeBarry, J.D.; Tan, X.; Li, J.P.; Wang, X.Y.; Lee, T.H.; Jin, H.Z.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucl. Acids Res. 2012, 40, 49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, D.P.; Zhang, Y.B.; Zhang, Z.; Zhu, J.; Yu, J. KaKs_Calculator 2.0: A Toolkit Incorporating Gamma-Series Methods and Sliding Window Strategies. Genom. Proteom. Bioinform. 2010, 8, 77–80. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Li, J.; Zhao, X.Q.; Wang, J.; Wong, G.K.S.; Yu, J. Kaks_calculator: Calculating ka and ks through model selection and model averaging. Genom. Proteom. Bioinform. 2006, 4, 259–263. [Google Scholar] [CrossRef] [Scilit]
- Hu, B.; Jin, J.P.; Guo, A.Y.; Zhang, H.; Luo, J.G.; Gao, G. GSDS 2.0: An upgraded gene features visualization server. Bioinformatics 2015, 31, 1296–1297. [Google Scholar] [CrossRef] [Scilit]
- Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef] [Scilit]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Li, L.T.; Dunwell, J.M.; Qiao, X.; Liu, X.; Zhang, S.L. Characterization of the lipoxygenase (LOX) gene family in the Chinese white pear (Pyrus bretschneideri) and comparison with other members of the Rosaceae. BMC Genom. 2013, 15, 444. [Google Scholar] [CrossRef] [Scilit]







| Common Name | Species Name | ChromoSome Number | Release Version | Genome Gene Number | Identified CAD Genes | Gene Name Prefix |
|---|---|---|---|---|---|---|
| Pear | Pyrus bretschneideri | 34 | NJAU, v1.0 | 42341 | 57 | Pbr |
| Apple | Malus domestica | 34 | GDR, v1.0 | 63541 | 42 | MDP |
| Chinese plum | Prunus mume | 16 | BFU, v1.0 | 31390 | 34 | Pm |
| Strawberry | Fragaria vesca | 14 | GDR, v1.0 | 32831 | 16 | mrna |
| Scheme | Number of CAD Genes | Number of CAD Genes of Different Origins (Percentage) | ||||
|---|---|---|---|---|---|---|
| Singleton | WGD | Tandem | Proximal | Dispersed | ||
| Pear | 57 | 8 (14.0) | 24 (42.1) | 0 | 0 | 25 (43.9) |
| Apple | 42 | 0 | 2 (4.8) | 0 | 0 | 40 (95.2) |
| Chinese Plum | 34 | 0 | 13 (38.2) | 0 | 0 | 20 (58.8) |
| Strawberry | 16 | 0 | 9 (56.2) | 0 | 0 | 7 (43.8) |
| Common Name | Method | Ka | Ks | Ka/Ks | p Value (Fisher’s Test) |
|---|---|---|---|---|---|
| PbrCAD19- PbrCAD22 | NG | 0.030518 | 0.0331618 | 0.920278 | 0.822196 |
| PbrCAD24- PbrCAD35 | NG | 0.03653 | 0.294749 | 0.123935 | 1.02 × 10−21 |
| PbrCAD25- PbrCAD27 | NG | 0.014796 | 0.186026 | 0.0795362 | 8.38 × 10−18 |
| PbrCAD26- PbrCAD29 | NG | 0.019842 | 0.249629 | 0.0794857 | 8.57 × 10−24 |
| PbrCAD39- PbrCAD50 | NG | 0.036999 | 0.235759 | 0.156936 | 1.28 × 10−16 |
| Gene Name | Forward Primer Sequence (5′ → 3′) | Reverse Primer Sequence (5′ → 3′) | Amplicon Length (bp) |
|---|---|---|---|
| PbrCAD1 | TGACCTTGGCACGTCAAACT | CAGTACTGCTCGTTGTCCGT | 174 |
| PbrCAD11 | CGGAACAAAGGACACGCAAG | TCGAGCGCTTCAGTTGCATA | 102 |
| PbrCAD20 | CCAGGCCGGAAATTCACTG | TGCCGTAAAGAGTTGTATCAGC | 221 |
| PbrCAD27 | GGGCCCATGATGTTCGAGT | AACTTCATGTCCGGGCAAAGA | 245 |
| PbrCAD31 | TGTTAGAGACGCCAAACCTGC | TCCGATCACCATCGGATCCTTA | 195 |
| PbrCAD37 | GTCTACAGCTGGTCAGGTTATCAGATG | CCACAACTCCTCCAGCTTCATGA | 202 |
| PbrCAD39 | GATGGCCAGTCCAGGTTCTC | AGCAAGGGAACCAACATGAC | 102 |
| PbrCAD41 | TCAGCTCACTTGTGCCTCTG | CACCTTGTGCAACGGAAAGG | 153 |
| PbrCAD43 | GTCCAAGTCGAGGTGGCACC | TGCATTCTCCTGTGAACACTGGCA | 203 |
| TUB-b2 | TGGGCTTTGCTCCTCTTAC | CCTTCGTGCTCATCTTACC | 169 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qi, K.; Song, X.; Yuan, Y.; Bao, J.; Gong, X.; Huang, X.; Khanizadeh, S.; Zhang, S.; Tao, S. CAD Genes: Genome-Wide Identification, Evolution, and Their Contribution to Lignin Biosynthesis in Pear (Pyrus bretschneideri). Plants 2021, 10, 1444. https://doi.org/10.3390/plants10071444
Qi K, Song X, Yuan Y, Bao J, Gong X, Huang X, Khanizadeh S, Zhang S, Tao S. CAD Genes: Genome-Wide Identification, Evolution, and Their Contribution to Lignin Biosynthesis in Pear (Pyrus bretschneideri). Plants. 2021; 10(7):1444. https://doi.org/10.3390/plants10071444
Chicago/Turabian StyleQi, Kaijie, Xiaofei Song, Yazhou Yuan, Jianping Bao, Xin Gong, Xiaosan Huang, Shahrokh Khanizadeh, Shaoling Zhang, and Shutian Tao. 2021. "CAD Genes: Genome-Wide Identification, Evolution, and Their Contribution to Lignin Biosynthesis in Pear (Pyrus bretschneideri)" Plants 10, no. 7: 1444. https://doi.org/10.3390/plants10071444
APA StyleQi, K., Song, X., Yuan, Y., Bao, J., Gong, X., Huang, X., Khanizadeh, S., Zhang, S., & Tao, S. (2021). CAD Genes: Genome-Wide Identification, Evolution, and Their Contribution to Lignin Biosynthesis in Pear (Pyrus bretschneideri). Plants, 10(7), 1444. https://doi.org/10.3390/plants10071444
