Next Article in Journal
Carbon Nanodots Inhibit Tumor Necrosis Factor-α-Induced Endothelial Inflammation through Scavenging Hydrogen Peroxide and Upregulating Antioxidant Gene Expression in EA.hy926 Endothelial Cells
Next Article in Special Issue
8-OxoG-Dependent Regulation of Global Protein Responses Leads to Mutagenesis and Stress Survival in Bacillus subtilis
Previous Article in Journal
A Kinetic Approach to Oxygen Radical Absorbance Capacity (ORAC): Restoring Order to the Antioxidant Activity of Hydroxycinnamic Acids and Fruit Juices
 
 
Due to scheduled maintenance work on our database systems, there may be short service disruptions on this website between 10:00 and 11:00 CEST on June 14th.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Halofantrine Hydrochloride Acts as an Antioxidant Ability Inhibitor That Enhances Oxidative Stress Damage to Candida albicans

Department of Pharmacy, Shanghai Tenth People’s Hospital, School of Medicine, Tongji University, Shanghai 200072, China
*
Authors to whom correspondence should be addressed.
Antioxidants 2024, 13(2), 223; https://doi.org/10.3390/antiox13020223
Submission received: 20 December 2023 / Revised: 25 January 2024 / Accepted: 6 February 2024 / Published: 9 February 2024

Abstract

:
Candida albicans, a prominent opportunistic pathogenic fungus in the human population, possesses the capacity to induce life-threatening invasive candidiasis in individuals with compromised immune systems despite the existence of antifungal medications. When faced with macrophages or neutrophils, C. albicans demonstrates its capability to endure oxidative stress through the utilization of antioxidant enzymes. Therefore, the enhancement of oxidative stress in innate immune cells against C. albicans presents a promising therapeutic approach for the treatment of invasive candidiasis. In this study, we conducted a comprehensive analysis of a library of drugs approved by the Food and Drug Administration (FDA). We discovered that halofantrine hydrochloride (HAL) can augment the antifungal properties of oxidative damage agents (plumbagin, menadione, and H2O2) by suppressing the response of C. albicans to reactive oxygen species (ROS). Furthermore, our investigation revealed that the inhibitory mechanism of HAL on the oxidative response is dependent on Cap1. In addition, the antifungal activity of HAL has been observed in the Galleria mellonella infection model. These findings provide evidence that targeting the oxidative stress response of C. albicans and augmenting the fungicidal capacity of oxidative damage agents hold promise as effective antifungal strategies.

1. Introduction

Candida albicans, a significant opportunistic pathogenic fungus in humans, has the potential to cause fatal invasive candidiasis in immunocompromised patients [1,2], despite the availability of antifungal drugs such as polyenes, azoles, and echinocandins [3]. The primary defense mechanism against C. albicans involves phagocytosis mediated by innate immune cells, including macrophages and neutrophils [4]. Upon engulfment of C. albicans, innate immune cells employ a major antifungal strategy by generating toxic reactive oxygen species (ROS), resulting in oxidative damage to C. albicans [5,6]. Indeed, ROS have the capability to initiate the oxidation of proteins, lipids, and nucleic acids, leading to impaired functionality of these vital biological macromolecules, ultimately triggering programmed cell death in the fungal pathogen [7]. C. albicans exhibits the ability to withstand oxidative stress by means of antioxidant enzymes, namely catalase, glutathione peroxidase, and superoxide dismutase when confronted with macrophages or neutrophils [5]. In individuals with profound innate immunodeficiency, such as those suffering from cancer, organ transplantation, and acquired immune deficiency syndrome (AIDS), C. albicans can persist in the bloodstream and establish colonies within internal organs, leading to the development of invasive candidiasis [8]. Thus, augmenting oxidative stress in innate immune cells against C. albicans represents a potential therapeutic strategy for managing invasive candidiasis.
Augmenting intracellular ROS levels in C. albicans represents a viable fungicidal approach akin to using amphotericin B and miconazole, which results in cell death [9,10,11]. Our prior investigations have demonstrated that increasing ROS levels in C. albicans using baicalein, berberine, and osthole enhances the antifungal efficacy of antifungal agents [12,13,14]. However, the generation of ROS, which is cytotoxic to C. albicans, is contingent upon dysfunctions in the tricarboxylic acid (TCA) cycle and the respiratory chain and may also prove toxic to mammalian cells. An alternative antifungal strategy involves weakening C. albicans’ resistance to oxidative damage. Cationic stress, resulting from an increased influx of K+ into the phagosome of innate immune cells [15], has been shown to inhibit C. albicans’ response to oxidative stress and render it highly susceptible [16,17]. The regulation of C. albicans’ response to ROS primarily depends on the transcription factors Cap1 and Hog1 [5]. The deletion of CAP1 and HOG1 genes in C. albicans rendered the organism susceptible to oxidative stress [18] and reduced its resistance to host cell-mediated killing, leading to diminished virulence in Caenorhabditis elegans, Galleria mellonella, and mouse infection models [17,19,20]. Consequently, targeting the response of C. albicans to ROS and augmenting the fungicidal efficacy of innate immune cells represents a promising therapeutic approach. Nevertheless, the number of compounds that function as antifungal agents through this mechanism remains limited.
Here, we performed a high throughput screening of a Food and Drug Administration (FDA)-approved drug library and identified that halofantrine hydrochloride (HAL) could enhance the antifungal activities of oxidative damage agents (plumbagin, menadione, and H2O2) by suppressing C. albicans’ response to ROS. We further found that the mechanism of inhibiting the oxidative response action of HAL depends on Cap1. In addition, the antifungal activity of HAL has been observed in the G. mellonella infection model. These findings demonstrate that inhibiting C. albicans’ response to oxidative stress and enhancing the fungicidal ability of innate immunity cells is a promising antifungal strategy.

2. Materials and Methods

2.1. Strains, Primers, Agents, and Cultural Conditions

The present study utilized C. albicans’ strains, which are documented in Table 1, and primers, which are documented in Table 2. C. albicans’ strains were cultured in a YPD medium (1% yeast extract, 2% peptone, and 2% dextrose) at 30 °C. Deletion and green fluorescence protein (GFP)-tagged mutants were constructed using a synthetic medium (0.67% yeast nitrogen base without amino acids, 2% dextrose, 2% agar). The FDA-approved drug library (MedChemExpress, Shanghai, China) consisted of 2372 drugs that were dissolved in dimethylsulfoxide (DMSO) at 10 mM. Plumbagin (Topscience, Shanghai, China) and menadione (Topscience, Shanghai, China) were dissolved in DMSO to prepare the stock solutions at 6.4 mg/mL and 102.4 mM, respectively.

2.2. High-Throughput Screening

To identify drugs that potentiate oxidative stress damage to C. albicans, a logarithmic long-term culture of C. albicans was diluted to a concentration of 1 × 103 cells/mL in a YPD medium containing 1 μg/mL plumbagin. Subsequently, 1 μL of each FDA-approved drug was added to 199 μL of the cell suspension, resulting in a concentration of 50 μM in each well of a 96-well plate, which was then incubated at 30 °C for 48 h. The criterion for drug inclusion was a growth reduction of >50%, as determined by OD600 values, in a combination of an FDA-approved drug and plumbagin compared to plumbagin monotherapy.

2.3. Minimum Inhibition Concentration (MIC) Assay

The MIC assay was conducted in accordance with the guidelines outlined in the Clinical and Laboratory Standards Institute (CLSI) M27-A3. YPD medium was utilized, with strains inoculated at a concentration of approximately 1 × 103 cells/mL and 100 μL per well in 96-well plates. Serial dilutions of compounds ranging from 50 μM to 0.1 μM were added to each well. These plates were then incubated at 30 °C for 24 h. Following incubation, the optical densities were measured at an absorbance of 600 nm, using a Multiskan Sky (Thermo Fisher Scientific, Waltham, MA, USA). The MIC was determined as the concentration of the compound that suppressed 50% or more of cellular growth, as evidenced by the OD600 measurement, in comparison to the control.

2.4. Dose–Matrix Titration Assay

The dose–matrix titration assay, as outlined in the reference, was employed to evaluate the synergistic effects of drugs [22]. In summary, drug A was diluted in a two-fold serial manner across columns of a 96-well plate, with each well containing 50 μL of drug A at a concentration four times higher than the final drug concentration. Similarly, drug B was dispensed in a two-fold serial dilution manner across rows of the plate, with each well containing 50 μL of drug B at a concentration four times higher than the final drug concentration. Following this, a volume of 50 μL of the diluted drug B was subsequently transferred to the plate containing drug A. Subsequently, a volume of 100 μL of overnight diluted C. albicans cultures (1 × 103 cells/mL) was added to all wells containing the drugs and incubated at 30 °C for 24 h. The synergy between drugs A and B was assessed using the Loewe additivity model, employing the fractional inhibitory concentration index (FICI). Synergism is indicated by an FICI value of ≤0.5, additive effects by an FICI value of 0.5 < FICI ≤ 1, indifference by an FICI value of 1 < FICI ≤ 4, and antagonism by an FICI value greater than 4 [23].

2.5. Disruption of Target Genes

Fusion PCR methodology was utilized to generate null mutants of genes of interest from the C. albicans’ strain SN152, as previously described in reference [21]. In brief, the flanking sequences of the target genes were amplified using primers P1 and P3 or P4 and P6, with the genomic DNA of SN152 serving as the template. The selectable HIS1 or ARG4 marker was then amplified using universal primers 2 and 5, with plasmids pSN52 or pSN69 as the template. Subsequently, a fusion product was generated using primers P1 and P6, with three PCR products serving as the template. The transformation was selected on synthetic media supplemented with the necessary auxotrophic supplements.

2.6. Quantitative Real-Time PCR (qRT-PCR) Analysis

The methodology for total RNA extraction and qRT-PCR was conducted according to the procedures described in a previous study [24]. To ensure the absence of genomic DNA contamination, the isolated RNA was subjected to DNase I treatment (Takara, Beijing, China). First-strand cDNAs were synthesized using a reverse transcription PCR cDNA synthesis kit (Takara, China). Triplicate independent qRT-PCR analyses were performed using the Roche Lightcycler 96 Fluorescence Quantitative PCR Instrument and TB Green Premix Ex TaqTM II (Takara, China). The ACT1 gene served as the internal control.

2.7. C-Terminal of Proteins Tagging GFP

A PCR-based approach was employed to amplify the desired DNA cassettes within plasmid pCPC64 for tagging the C-terminal of Cap1 with GFP [25]. The generation of DNA cassettes with 78 bp homology regions to the CAP1 gene was achieved through two rounds of PCR utilizing primers F1 plus R1 and F2 plus R2, respectively. The resulting product was subsequently transformed into C. albicans cells to generate a mutant strain with the C-terminal of Cap1 tagged with GFP.

2.8. Western Blot Analysis

C. albicans’ cells were washed with sterile water once and then were subjected to cell lysis using the Bead Ruptor12 System (OMNI International, Kennesaw, GA, USA) in lysis buffer (PBS containing 5 mM EDTA (pH 8.0), 1 mM PMSF, 1.0% Protease Inhibitor Cocktail). Proteins were separated by 4–20% SDS–PAGE and transferred to a PVDF membrane. After blocking, anti-GFP antibodies (Santa Cruz, Dallas, TX, USA) or anti-tubulin antibodies (Abbkine, Atlanta, GA, USA) were used for probing GFP-tagged proteins or the tubulin, which were then detected using the secondary antibody goat anti-mouse IgG-HRP (Santa Cruz) and the Pierce™ ECL system (Thermo Fisher Scientific, Waltham, MA, USA) [26].

2.9. G. mellonella Infection Model

G. mellonella larvae, obtained from the Tianjin Huiyude Biotech Company, were selected based on an average weight of 300 mg and randomly assigned to four groups (n = 10 per group), with any larvae displaying signs of melanization being excluded. The larvae were infected with 5 μL of an SN152 suspension (7.0 × 105 cells/larvae) using a Hamilton syringe and subsequently treated with a single injection of HAL (0, 0.5, 1, 2 mg/kg). All G. mellonella larvae were incubated at 30 °C for eight days. The mortality of G. mellonella was evaluated daily and subjected to statistical analysis using the Kaplan–Meier method, specifically employing the log-rank test [22,27].

3. Results

3.1. HAL Enhances the Antifungal Activities of Oxidative Damage Agents

Plumbagin (5-hydroxy-2-methyl-1,4-naphthoquinone) is a strong inducer of ROS and causes oxidative stress in fungi [28,29]. We found that the MIC value of plumbagin against C. albicans’ SC5314 is 2 μg/mL, with the strongest antifungal activity among a series of anthraquinone analogs (Figure 1).
In this study, we performed a high-throughput screening of the FDA-approved drug library containing 2372 drugs to determine candidate agents that are synergistic with the ROS inducer plumbagin. Previous studies demonstrated that loss of Cap1 and Hog1 increased the susceptibility of C. albicans to oxidizing agents [10,30,31] but had no function in the growth of C. albicans [32]. Therefore, we utilize three criteria to screen candidate inhibitors of the oxidative stress response of C. albicans: a candidate inhibitor should (1) have weak antifungal activity but (2) enhance the antifungal activity of ROS inducers, and (3) ROS inducers can also enhance its antifungal activity. We tested the antifungal activity of 50 μM of each of the 2372 drugs on C. albicans’ SN152, grown in YPD medium with 1 μg/mL plumbagin in 96-well plates. We found that 147 compounds enhanced the antifungal activity of plumbagin, and the relative growth of C. albicans treated with the combination of candidate compounds and plumbagin is less than 50% of that of plumbagin alone after incubation at 30 °C for 24 h (Figure 2A, Table 3). We further investigated the ability of these compounds to enhance the antifungal activity of plumbagin (1 μg/mL), using the MIC assay by diluting these candidate compounds from 50 μM to 0.1 μM in a 2-fold ratio. We excluded 30 drugs for subsequent study as these drugs have potent antifungal activities (MIC values are less than 0.1 μM). We precluded 10 drugs for which plumbagin antagonized their antifungal activity, and 64 for which plumbagin slightly enhanced their antifungal activities (the ratio of MIC alone to the MIC in the presence of plumbagin is equal or less than 2) (Figure 2A, Table 3). Subsequently, we used a dose–matrix titration assay to determine the interaction between the remaining 43 drugs and plumbagin by the FICI. We included seven drugs as candidate oxidative response inhibitors as they synergize with plumbagin. Among them, the combination of HAL and plumbagin had the lowest FICI value (FICI = 0.0938) (Figure 2B, Table 4). We further tested the interaction of each of the seven drugs and menadione (2-methyl-1,4-naphthoquinone), another ROS inducer [29]. Only HAL was synergistic with menadione, with an FICI value of 0.1563 (Figure 2A, Table 5). We then gauged the combination of HAL and H2O2; as expected, they are synergistic (FICI = 0.2526) (Table 6). These findings suggest that HAL is a promising synergistic agent for ROS inducers.

3.2. HAL Inhibits the Oxidative Stress Response in C. albicans

Is it possible that HAL acts as an oxidant that enhances the antifungal activity of ROS inducers? Exposure to cationic stress, such as sodium chloride (NaCl), inhibits the oxidative stress response of C. albicans [16]. If HAL is indeed an oxidant, it would be expected that HAL and NaCl would mutually enhance their respective antifungal activities. However, the interaction between HAL and NaCl appears indifferent (Table 7). On the other hand, in the presence of plumbagin, HAL and NaCl exhibit additive interactions (Table 7), indicating that HAL, like NaCl, can inhibit C. albicans’ oxidative stress response. One of the mechanisms employed by C. albicans to withstand oxidative stress involves active transcriptional responses to oxidative stress. This includes the activation of specific genes, such as the CAP1 gene (C3_02220W_A), encoding an AP-1 bZIP transcription factor, the CAT1 gene (C1_06810W_A), encoding catalase, and the TTR1 gene (C1_00490C_A), encoding glutaredoxin [5]. When C. albicans are exposed to a 10 mM concentration of H2O2 for 1 h, an upregulation in the expression levels of the three genes is observed. Conversely, a high concentration of HAL (20 μM) has minimal impact on the expression of these three genes (Figure 3). These findings indicate that HAL acts as an inhibitor of the oxidative stress response in C. albicans, thereby enhancing the antifungal activities of oxidative damage agents.

3.3. The Inhibitory Effect of HAL on Oxidative Stress Response Depends on the Cap1–Ybp1 Signaling Pathway

Three signaling pathways play a crucial role in response to ROS in C. albicans, including the transcriptional factor Cap1, the stress-activated protein kinase Hog1, and the DNA damage checkpoint kinase Rad53 [5]. Since HAL can inhibit the response to oxidative stress in C. albicans, HAL may target one of the signaling pathways that mediate C. albicans’ responses to ROS. To verify this conjecture, we constructed the CAP1 (C3_02220W_A), HOG1 (C2_03330C_A), and RAD53 (C3_03810W_A) genes’ null mutants (cap1Δ/cap1Δ, hog1Δ/hog1Δ, and rad53Δ/rad53Δ) in C. albicans. We found that the synergistic effect between HAL and H2O2 became indifferent in the cap1Δ/cap1Δ mutant, while their interaction remained synergistic in the hog1Δ/hog1Δ and rad53Δ/rad53Δ mutants (Table 6), suggesting that the inhibitory effect of HAL on oxidative stress response depends on the transcriptional factor Cap1.
Ybp1 is encoded by the YBP1 (C1_13960W_A) gene in C. albicans, binds to cytoplasmic pools of Cap1, and forms a complex with Cap1 [19], protecting Cap1 from ubiquitin-mediated degradation [33]. Like in the cap1Δ/cap1Δ mutant, HAL can no longer enhance the antifungal activity of H2O2 against the ybp1Δ/ybp1Δ mutant (Table 6). These findings indicate that the inhibitory effect of HAL on the antioxidant ability of C. albicans depends on the presence of Cap1 and Ybp1.
Cap1 will degrade when it cannot form a complex with Ybp1 [19]. Therefore, we conjecture that HAL inhibits the antioxidant ability of C. albicans by disrupting the interaction between Cap1 and Ybp1 and improving the degradation of Cap1. To verify this hypothesis, we tagged the C-termini of Cap1 with a GFP tag [25]. We then cultured the Cap1–GFP mutant in the presence (10 μM, 20 μM, 30 μM) or absence of HAL, respectively, and then treated it with 10 mM H2O2 for 1 h. We tested the expression of Cap1 using an anti-GFP antibody and found that the HAL did not affect the Cap1 levels in the presence of H2O2 (Figure 4), which refuted our conjecture that HAL should disrupt the interaction of Cap1 and Ybp1.
Following exposure of C. albicans to H2O2, Cap1 is activated by oxidation through a glutathione peroxidase Gpx3 [19]. Oxidized Cap1 (Cap1ox) can detach from the nuclear export factor Crm1, resulting in the accumulation of Cap1 in the nucleus and inducing the expression of genes with antioxidant functions [5]. When HAL and H2O2 are used together, they exhibit additive interactions against the gpx3Δ/gpx3Δ mutant (Table 6), suggesting that, like Gpx3, HAL may inhibit the activation and nucleation of Cap1 by inhibiting its oxidation or phosphorylation, thereby inhibiting the antioxidant activity of Cap1.

3.4. HAL Exhibits Antifungal Activity in the G. mellonella Infection Model

We used the G. mellonella infection model to test the antifungal efficacy of HAL in vivo, as G. mellonella utilizes phagocytic cells (hemocytes) as part of their host defense [34,35]. We divided the G. mellonella larvae into four groups, with ten larvae in each group: (1) a control group receiving no drug treatment, (2) a group treated with 0.5 mg/kg HAL, (3) a group treated with 1 mg/kg HAL, and (4) a group treated with 2 mg/kg HAL. Our observations revealed a mortality rate of 100% in the control group throughout the 8-day observation period. However, upon administration of 2 mg/kg HAL, the mortality rate of infected mice decreased to 40% (Figure 5). These in vivo experiments prove that HAL has antifungal activity against C. albicans in the G. mellonella infection model.

4. Discussion

In this study, we performed a high-throughput screening of an FDA-approved drug library and identified that HAL could enhance the antifungal activities of oxidative damage agents by suppressing C. albicans’ response to ROS. We further found that HAL inhibits the oxidative stress response of C. albicans, depending on Cap1. In addition, the antifungal activity of HAL has been observed in the G. mellonella infection model. These findings demonstrated that inhibiting the oxidative stress response of C. albicans, thereby enhancing the antifungal activity of oxidative damage agents and innate immunity cells, is a promising antifungal strategy.
Candidiasis, primarily attributed to C. albicans, presents a significant risk to human health, and the availability of effective drugs for its treatment remains limited [26]. Consequently, there is an imperative to explore the development of novel antifungal medications. However, the comprehensive creation of new antifungal compounds with potent antifungal properties and optimal safety profiles, rendering them clinically valuable, necessitates substantial investments of time and resources. Considering this, repurposing FDA-approved drugs to treat candidiasis can circumvent the need for extensive safety assessments and reduce the associated time and financial burdens [36]. Numerous studies have demonstrated that FDA-approved non-antifungal drugs, such as statins and sertraline, can exhibit antifungal properties [37,38]. Following this drug repurposing strategy, our study conducted a high-throughput screening of a library comprising 2372 FDA-approved compounds and found that HAL effectively enhanced the antifungal activities of oxidative damage agents and exhibited antifungal activity in the G. mellonella infection model.
Inhibiting the oxidative stress response of C. albicans presents a promising strategy for enhancing the efficacy of antifungal treatment. Phagocytic cells are known to exert antifungal effects by generating ROS to eliminate C. albicans. Therefore, it is plausible to increase the intracellular ROS levels of C. albicans, intensify their oxidative damage, and synergistically enhance the antifungal activity of phagocytic cells or oxidative damage agents. However, there is a significant degree of conservation in the proteins comprising the mitochondrial respiratory chain between C. albicans and mammals. Consequently, the dysfunction of the mitochondrial respiratory chain induced by these compounds not only enhances the generation of ROS in C. albicans’ cells but also elevates ROS levels in mammalian cells. This ultimately leads to oxidative damage and cytotoxicity in mammalian cells, thereby restricting the potential clinical utility of these compounds. Consequently, it becomes imperative to investigate novel approaches to intensify the oxidative damage inflicted upon C. albicans. Loss of Cap1 increases susceptibility to menadione, H2O2, and host phagocytes [17,19,30], suggesting that the transcriptional factor Cap1 is important for the virulence of C. albicans [20] and is a valuable target for antifungal treatment. In the present study, we found that HAL can be repurposed as an inhibitor of the oxidative stress response of C. albicans to enhance the antifungal activity of oxidative damage agents in vitro. We further found that the mechanism of inhibiting the oxidative response action of HAL depends on inhibiting the transcriptional activity of C. albicans’ Cap1. In this study, we provide a novel antifungal strategy that inhibits the transcriptional activity of Cap1 and enhances the antifungal activity of oxidative damage agents.
Several mini-host models, including Drosophila melanogaster, Caenorhabditis elegans, and G. mellonella, have been utilized to investigate the pathophysiology of various fungal species [39]. Of interest is the G. mellonella infection model, which offers advantages such as cost effectiveness, ease of use, and independence from specialized infrastructures. The small size of G. mellonella larvae facilitates convenient manipulation, and their ability to withstand temperatures of 37 °C adds to their suitability for experimentation. The observation of melanization of larvae, decreased mobility, and mortality allows for easy detection of experimental outcomes [40]. The immune system of G. mellonella consists of phagocytic cells, which play a crucial role in the host defense by neutralizing and eliminating pathogens. This organism has been widely utilized in medical mycology research to investigate the virulence of pathogens and assess the effectiveness of antifungal treatments [41]. Thus, in this study, we employed the G. mellonella infection model to evaluate the antifungal properties of HAL, and our findings demonstrate that HAL effectively safeguards G. mellonella against C. albicans’ infection.
As an antimalarial drug, HAL has recently been reported to enhance the antifungal activity of amphotericin B against Cryptococcus and Candida species [42], suggesting that HAL may affect the fungal oxidative stress system since amphotericin B culminates C. albicans in death through the production of cytotoxic ROS [9]. In this study, we further uncovered the mechanism of HAL and its actions. The toxicity of HAL is low in G. mellonella, suggesting a promising clinical application. However, HAL is a blocker of delayed rectifier potassium current via the inhibition of the human-ether-a-go-go-related gene (hERG) channel [43,44]. Therefore, further research should develop a series of HAL analogs without inhibiting the hERG channel.

5. Conclusions

In conclusion, our study has identified that HAL has the potential to enhance the antifungal activities of oxidative damage agents (plumbagin, menadione, and H2O2) by suppressing the response of C. albicans to ROS. Furthermore, we discovered that the mechanism behind HAL’s inhibition of the oxidative response involves the inhibition of Cap1’s transcriptional activity. Additionally, the antifungal activity of HAL has been observed in the G. mellonella infection model. These findings provide evidence that targeting the oxidative stress response of C. albicans and enhancing the fungicidal ability of innate immunity cells could serve as a promising antifungal strategy.

Author Contributions

Conceptualization, H.L. and Y.J.; methodology, J.X., L.W. and Z.F.; software, J.X.; validation, S.H., J.Y. and Y.F.; formal analysis, J.X., L.W. and Z.F.; investigation, J.X., L.W. and Z.F.; data curation, S.H., J.Y. and Y.F.; writing—original draft preparation, J.X. and H.L.; writing—review and editing, H.L. and Y.J.; visualization, J.X.; supervision, H.L. and Y.J.; project administration, Y.J.; funding acquisition, Y.J. All authors have read and agreed to the published version of the manuscript.

Funding

This study received financial support from the National Key Research and Development Program of China (No. 2022YFC2303004 and No. 2021YFC2300404), the National Natural Science Foundation of China (No. 82020108032), and the Innovation Program of Shanghai Municipal Education Commission (202101070007-E00094).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Denning, D.W. Global incidence and mortality of severe fungal disease. Lancet Infect. Dis. 2024. [Google Scholar] [CrossRef] [PubMed]
  2. Lu, H.; Hong, T.; Jiang, Y.; Whiteway, M.; Zhang, S. Candidiasis: From cutaneous to systemic, new perspectives of potential targets and therapeutic strategies. Adv. Drug Deliv. Rev. 2023, 199, 114960. [Google Scholar] [CrossRef]
  3. Zhen, C.; Lu, H.; Jiang, Y. Novel Promising Antifungal Target Proteins for Conquering Invasive Fungal Infections. Front. Microbiol. 2022, 13, 911322. [Google Scholar] [CrossRef]
  4. Wang, Y.; Zou, Y.; Chen, X.; Li, H.; Yin, Z.; Zhang, B.; Xu, Y.; Zhang, Y.; Zhang, R.; Huang, X.; et al. Innate immune responses against the fungal pathogen Candida auris. Nat. Commun. 2022, 13, 3553. [Google Scholar] [CrossRef] [PubMed]
  5. Dantas, A.D.S.; Day, A.; Ikeh, M.; Kos, I.; Achan, B.; Quinn, J. Oxidative stress responses in the human fungal pathogen, Candida albicans. Biomolecules 2015, 5, 142–165. [Google Scholar] [CrossRef]
  6. Miranda, J.E.A.; Baronetti, J.L.; Sotomayor, C.E.; Paraje, M.G. Oxidative and nitrosative stress responses during macrophage–Candida albicans biofilm interaction. Med. Mycol. 2019, 57, 101–113. [Google Scholar] [CrossRef]
  7. Atriwal, T.; Chawla, M.; Hussain, A.; Alajmi, M.F.; Abid, M. Reactive oxygen mediated apoptosis as a therapeutic approach against opportunistic Candida albicans. Adv. Protein Chem. Struct. Biol. 2021, 125, 25–49. [Google Scholar] [CrossRef] [PubMed]
  8. Erwig, L.P.; Gow, N.A.R. Interactions of fungal pathogens with phagocytes. Nat. Rev. Microbiol. 2016, 14, 163–176. [Google Scholar] [CrossRef]
  9. Belenky, P.; Camacho, D.; Collins, J.J. Fungicidal drugs induce a common oxidative-damage cellular death pathway. Cell Rep. 2013, 3, 350–358. [Google Scholar] [CrossRef]
  10. Guirao-Abad, J.P.; Sánchez-Fresneda, R.; Román, E.; Pla, J.; Argüelles, J.C.; Alonso-Monge, R. The MAPK Hog1 mediates the response to amphotericin B in Candida albicans. Fungal Genet. Biol. 2020, 136, 103302. [Google Scholar] [CrossRef]
  11. Regidor, P.A.; Thamkhantho, M.; Chayachinda, C.; Palacios, S. Miconazole for the treatment of vulvovaginal candidiasis. In vitro, in vivo and clinical results. Review of the literature. J. Obstet. Gynaecol. 2023, 43, 2195001. [Google Scholar] [CrossRef]
  12. Xu, Y.; Wang, Y.; Yan, L.; Liang, R.-M.; Dai, B.-D.; Tang, R.-J.; Gao, P.-H.; Jiang, Y.-Y. Proteomic analysis reveals a synergistic mechanism of fluconazole and berberine against fluconazole-resistant Candida albicans: Endogenous ROS augmentation. J. Proteome Res. 2009, 8, 5296–5304. [Google Scholar] [CrossRef]
  13. Fu, Z.; Lu, H.; Zhu, Z.; Yan, L.; Jiang, Y.; Cao, Y. Combination of Baicalein and Amphotericin B Accelerates Candida albicans Apoptosis. Biol. Pharm. Bull. 2011, 34, 214–218. [Google Scholar] [CrossRef] [PubMed]
  14. Li, D.-D.; Chai, D.; Huang, X.-W.; Guan, S.-X.; Du, J.; Zhang, H.-Y.; Sun, Y.; Jiang, Y.-Y. Potent In Vitro Synergism of Fluconazole and Osthole against Fluconazole-Resistant Candida albicans. Antimicrob. Agents Chemother. 2017, 61. [Google Scholar] [CrossRef]
  15. Reeves, E.P.; Lu, H.; Jacobs, H.L.; Messina, C.G.M.; Bolsover, S.; Gabella, G.; Potma, E.O.; Warley, A.; Roes, J.; Segal, A.W. Killing activity of neutrophils is mediated through activation of proteases by K+ flux. Nature 2002, 416, 291–297. [Google Scholar] [CrossRef]
  16. Kaloriti, D.; Jacobsen, M.; Yin, Z.; Patterson, M.; Tillmann, A.; Smith, D.A.; Cook, E.; You, T.; Grimm, M.J.; Bohovych, I.; et al. Mechanisms underlying the exquisite sensitivity of candida albicans to combinatorial cationic and oxidative stress that enhances the potent fungicidal activity of phagocytes. mBio 2014, 5, e01334-14. [Google Scholar] [CrossRef] [PubMed]
  17. Kos, I.; Patterson, M.J.; Znaidi, S.; Kaloriti, D.; Dantas, A.d.S.; Herrero-De-Dios, C.M.; D’enfert, C.; Brown, A.J.P.; Quinn, J. Mechanisms Underlying the Delayed Activation of the Cap1 Transcription Factor in Candida albicans following Combinatorial Oxidative and Cationic Stress Important for Phagocytic Potency. mBio 2016, 7, e00331. [Google Scholar] [CrossRef]
  18. Chien, C.-T.; Chen, Y.-C.; Liu, Y.-C.; Liang, S.-H.; Lin, H.-H.; Lin, C.-H. The antimicrobial photodynamic inactivation resistance of Candida albicans is modulated by the Hog1 pathway and the Cap1 transcription factor. Med. Mycol. 2019, 57, 618–627. [Google Scholar] [CrossRef] [PubMed]
  19. Patterson, M.J.; McKenzie, C.G.; Smith, D.A.; Dantas, A.d.S.; Sherston, S.; Veal, E.A.; Morgan, B.A.; MacCallum, D.M.; Erwig, L.-P.; Quinn, J. Ybp1 and Gpx3 Signaling in Candida albicans Govern hydrogen peroxide-induced oxidation of the Cap1 transcription factor and macrophage escape. Antioxidants Redox Signal. 2013, 19, 2244–2260. [Google Scholar] [CrossRef]
  20. Jain, C.; Pastor, K.; Gonzalez, A.Y.; Lorenz, M.C.; Rao, R.P. The role of Candida albicans AP-1 protein against host derived ROS in in vivo models of infection. Virulence 2013, 4, 67–76. [Google Scholar] [CrossRef]
  21. Noble, S.M.; Johnson, A.D. Strains and strategies for large-scale gene deletion studies of the diploid human fungal pathogen Candida albicans. Eukaryot. Cell 2005, 4, 298–309. [Google Scholar] [CrossRef]
  22. Fang, T.; Xiong, J.; Wang, L.; Feng, Z.; Hang, S.; Yu, J.; Li, W.; Feng, Y.; Lu, H.; Jiang, Y. Unexpected Inhibitory Effect of Octenidine Dihydrochloride on Candida albicans Filamentation by Impairing Ergosterol Biosynthesis and Disrupting Cell Membrane Integrity. Antibiotics 2023, 12, 1675. [Google Scholar] [CrossRef]
  23. Johnson, M.D.; MacDougall, C.; Ostrosky-Zeichner, L.; Perfect, J.R.; Rex, J.H. Combination antifungal therapy. Antimicrob. Agents Chemother. 2004, 48, 693–715. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, H.; Ji, Z.; Feng, Y.; Yan, T.; Cao, Y.; Lu, H.; Jiang, Y. Myriocin enhances the antifungal activity of fluconazole by blocking the membrane localization of the efflux pump Cdr1. Front. Pharmacol. 2022, 13, 1101553. [Google Scholar] [CrossRef] [PubMed]
  25. Chang, P.; Wang, W.; Igarashi, Y.; Luo, F.; Chen, J. Efficient vector systems for economical and rapid epitope-tagging and overexpression in Candida albicans. J. Microbiol. Methods 2018, 149, 14–19. [Google Scholar] [CrossRef] [PubMed]
  26. Lu, H.; Li, W.; Whiteway, M.; Wang, H.; Zhu, S.; Ji, Z.; Feng, Y.; Yan, L.; Fang, T.; Li, L.; et al. A Small Molecule Inhibitor of Erg251 Makes Fluconazole Fungicidal by Inhibiting the Synthesis of the 14α-Methylsterols. mBio 2023, 14, e0263922. [Google Scholar] [CrossRef] [PubMed]
  27. Li, L.; Lu, H.; Zhang, X.; Whiteway, M.; Wu, H.; Tan, S.; Zang, J.; Tian, S.; Zhen, C.; Meng, X.; et al. Baicalein Acts against Candida albicans by Targeting Eno1 and Inhibiting Glycolysis. Microbiol. Spectr. 2022, 10, e0208522. [Google Scholar] [CrossRef] [PubMed]
  28. Padhye, S.; Dandawate, P.; Yusufi, M.; Ahmad, A.; Sarkar, F.H. Perspectives on medicinal properties of plumbagin and its analogs. Med. Res. Rev. 2012, 32, 1131–1158. [Google Scholar] [CrossRef] [PubMed]
  29. Castro, F.A.V.; Mariani, D.; Panek, A.D.; Eleutherio, E.C.A.; Pereira, M.D. Cytotoxicity mechanism of two naphthoquinones (menadione and plumbagin) in Saccharomyces cerevisiae. PLoS ONE 2008, 3, e3999. [Google Scholar] [CrossRef] [PubMed]
  30. Cao, Y.; Wang, Y.; Dai, B.; Wang, B.; Zhang, H.; Zhu, Z.; Xu, Y.; Cao, Y.; Jiang, Y.; Zhang, G. Trehalose is an important mediator of Cap1p oxidative stress response in Candida albicans. Biol. Pharm. Bull. 2008, 31, 421–425. [Google Scholar] [CrossRef]
  31. Wang, Y.; Cao, Y.-Y.; Jia, X.-M.; Cao, Y.-B.; Gao, P.-H.; Fu, X.-P.; Ying, K.; Chen, W.-S.; Jiang, Y.-Y. Cap1p is involved in multiple pathways of oxidative stress response in Candida albicans. Free. Radic. Biol. Med. 2006, 40, 1201–1209. [Google Scholar] [CrossRef]
  32. Noble, S.M.; French, S.; Kohn, L.A.; Chen, V.; Johnson, A.D. Systematic screens of a Candida albicans homozygous deletion library decouple morphogenetic switching and pathogenicity. Nat. Genet. 2010, 42, 590–598. [Google Scholar] [CrossRef]
  33. Gulshan, K.; Thommandru, B.; Moye-Rowley, W.S. Proteolytic degradation of the Yap1 transcription factor is regulated by subcellular localization and the E3 ubiquitin ligase Not4. J. Biol. Chem. 2012, 287, 26796–26805. [Google Scholar] [CrossRef]
  34. Durieux, M.-F.; Melloul, S.; Jemel, S.; Roisin, L.; Dardé, M.-L.; Guillot, J.; Dannaoui, S.; Botterel, F. Galleria mellonella as a screening tool to study virulence factors of Aspergillus fumigatus. Virulence 2021, 12, 818–834. [Google Scholar] [CrossRef] [PubMed]
  35. Fallon, J.; Kelly, J.; Kavanagh, K. Galleria mellonella as a model for fungal pathogenicity testing. Methods Mol. Biol. 2012, 845, 469–485. [Google Scholar] [CrossRef] [PubMed]
  36. Rossi, S.A.; de Oliveira, H.C.; Agreda-Mellon, D.; Lucio, J.; Mendes-Giannini, M.J.S.; García-Cambero, J.P.; Zaragoza, O. Identification of Off-Patent Drugs That Show Synergism with Amphotericin B or That Present Antifungal Action against Cryptococcus neoformans and Candida spp. Antimicrob. Agents Chemother. 2020, 64. [Google Scholar] [CrossRef]
  37. Tavakkoli, A.; Johnston, T.P.; Sahebkar, A. Antifungal effects of statins. Pharmacol. Ther. 2020, 208, 107483. [Google Scholar] [CrossRef] [PubMed]
  38. Spitzer, M.; Griffiths, E.; Blakely, K.M.; Wildenhain, J.; Ejim, L.; Rossi, L.; De Pascale, G.; Curak, J.; Brown, E.; Tyers, M.; et al. Cross-species discovery of syncretic drug combinations that potentiate the antifungal fluconazole. Mol. Syst. Biol. 2011, 7, 499. [Google Scholar] [CrossRef] [PubMed]
  39. Arvanitis, M.; Glavis-Bloom, J.; Mylonakis, E. Invertebrate models of fungal infection. Biochim. Biophys. Acta 2013, 1832, 1378–1383. [Google Scholar] [CrossRef]
  40. Andrea, A.; Krogfelt, K.A.; Jenssen, H. Methods and Challenges of Using the Greater Wax Moth (Galleria mellonella) as a Model Organism in Antimicrobial Compound Discovery. Microorganisms 2019, 7, 85. [Google Scholar] [CrossRef]
  41. Jemel, S.; Guillot, J.; Kallel, K.; Botterel, F.; Dannaoui, E. Galleria mellonella for the Evaluation of Antifungal Efficacy against Medically Important Fungi, a Narrative Review. Microorganisms 2020, 8, 390. [Google Scholar] [CrossRef] [PubMed]
  42. Freitas, G.J.; Ribeiro, N.Q.; Gouveia-Eufrasio, L.; Emidio, E.C.; Guimarães, G.M.; César, I.C.; Paixão, T.A.; Oliveira, J.B.; Caza, M.; Kronstad, J.W.; et al. Antimalarials and amphotericin B interact synergistically and are new options to treat cryptococcosis. Int. J. Antimicrob. Agents 2023, 62, 106807. [Google Scholar] [CrossRef] [PubMed]
  43. Tie, H.; Walker, B.D.; Singleton, C.B.; Valenzuela, S.M.; Bursill, J.A.; Wyse, K.R.; Breit, S.N.; Campbell, T.J. Inhibition of HERG potassium channels by the antimalarial agent halofantrine. Br. J. Pharmacol. 2000, 130, 1967–1975. [Google Scholar] [CrossRef] [PubMed]
  44. Traebert, M.; Dumotier, B.; Meister, L.; Hoffmann, P.; Dominguez-Estevez, M.; Suter, W. Inhibition of hERG K+ currents by antimalarial drugs in stably transfected HEK293 cells. Eur. J. Pharmacol. 2004, 484, 41–48. [Google Scholar] [CrossRef]
Figure 1. The MIC values of anthraquinone analogs against C. albicans. The red star symbolizes the compound exhibiting the lowest MIC value against C. albicans.
Figure 1. The MIC values of anthraquinone analogs against C. albicans. The red star symbolizes the compound exhibiting the lowest MIC value against C. albicans.
Antioxidants 13 00223 g001
Figure 2. (A) Identification of HAL for enhancing the antifungal activity of ROS inducers from an FDA-approved compound library. (B) HAL chemical structure.
Figure 2. (A) Identification of HAL for enhancing the antifungal activity of ROS inducers from an FDA-approved compound library. (B) HAL chemical structure.
Antioxidants 13 00223 g002
Figure 3. The transcription levels of the CAP1, CAT1, and TTR1 genes in response to 10 mM H2O2 and 20 μM HAL for 1 h were measured by qRT-PCR. The significance of differences was determined by one-way ANOVA analysis, followed by Dunnett’s multiple comparisons test (* p < 0.05).
Figure 3. The transcription levels of the CAP1, CAT1, and TTR1 genes in response to 10 mM H2O2 and 20 μM HAL for 1 h were measured by qRT-PCR. The significance of differences was determined by one-way ANOVA analysis, followed by Dunnett’s multiple comparisons test (* p < 0.05).
Antioxidants 13 00223 g003
Figure 4. The expression levels of Cap1 in the presence (10 μM, 20 μM, and 30 μM) or absence of HAL were detected by immunoblotting.
Figure 4. The expression levels of Cap1 in the presence (10 μM, 20 μM, and 30 μM) or absence of HAL were detected by immunoblotting.
Antioxidants 13 00223 g004
Figure 5. HAL exhibits antifungal efficacy in the G. mellonella infection model. Survival curves of larvae infected with SN152 (7.0 × 105 cells/larvae) and injected with 0 mg/kg, 0.5 mg/kg, 1 mg/kg, 2 mg/kg doses of HAL. Each curve represents a group of 10 larvae (n = 10), monitored daily for survival for up to 8 days after infection. The significance of differences was determined by the Kaplan–Meier method, followed by the log-rank test (* p < 0.05).
Figure 5. HAL exhibits antifungal efficacy in the G. mellonella infection model. Survival curves of larvae infected with SN152 (7.0 × 105 cells/larvae) and injected with 0 mg/kg, 0.5 mg/kg, 1 mg/kg, 2 mg/kg doses of HAL. Each curve represents a group of 10 larvae (n = 10), monitored daily for survival for up to 8 days after infection. The significance of differences was determined by the Kaplan–Meier method, followed by the log-rank test (* p < 0.05).
Antioxidants 13 00223 g005
Table 1. Strains used in this study.
Table 1. Strains used in this study.
Gene Accession No.StrainGenotypeSource or Reference
SC5314Wild type[21]
SN152his1/his1 arg4/arg4 leu2/leu2[21]
3636640cap1Δ/cap1Δcap1::HIS1/cap1::ARG4 leu2/leu2This study
3637393hog1Δ/hog1Δhog1::HIS1/hog1::ARG4 leu2/leu2This study
3645633rad53Δ/rad53Δrad53::HIS1/rad53::ARG4 leu2/leu2This study
3636187ybp1Δ/ybp1Δybp1::HIS1/ybp1::ARG4 leu2/leu2This study
3644471gpx3Δ/gpx3Δgpx3::HIS1/gpx3::ARG4 leu2/leu2This study
3636640CAP1-GFPhis1/his1 arg4/arg4 CAP1/cap1::CAP1-GFP-LEU2This study
Table 2. Primers used in this study.
Table 2. Primers used in this study.
Gene Accession No.Gene NamePrimer Name aPrimer Sequence (5′ to 3′) b
Primers for genes deletion
3636640CAP1CAP1 P1GATTACTAATTATTCTTTGAC
CAP1 P3cacggcgcgcctagcagcggGAATAAGGATAGTTGAAAATG
CAP1 P4gtcagcggccgcatccctgcCATTAATCAAGTTAGTGGTGG
CAP1 P6CTAGTTGAATCAAAGAAAGCC
3637393HOG1HOG1 P1GCCTTGCTTATGTTCACAAAC
HOG1 P3cacggcgcgcctagcagcggCATTTTCTTATATGCTTTATC
HOG1 P4gtcagcggccgcatccctgcTCTTCAAAAATACAAGCTAGC
HOG1 P6TCGTAAGGACGGTATTACAGC
3645633RAD53RAD53 P1CTAGTTTTCATCTTGATCTTG
RAD53 P3cacggcgcgcctagcagcggTGTAGTTTGGTAAATTAAGGG
RAD53 P4gtcagcggccgcatccctgcATTTAGCATATATACAAGCAT
RAD53 P6GAACGGAGATGGCAACATGTG
3636187YBP1YBP1 P1GCTAGTTTATCCCCTCTTATG
YBP1 P3cacggcgcgcctagcagcggAAATTGAAATGGCTCAATGGT
YBP1 P4gtcagcggccgcatccctgcTGTATATGTATGTAACTACGT
YBP1 P6CTTCACCATTACCATCTCATC
3644471GPX3GPX3 P1GCTGTCAAACCATTGGAGCTC
GPX3 P3cacggcgcgcctagcagcggTGATGATTGTTGATAATTGTA
GPX3 P4gtcagcggccgcatccctgcAAATACAGTAGTATTATACAT
GPX3 P6CGGGCAGGTCAATGCCAAACC
Universal primer 2 ccgctgctaggcgcgccgtgACCAGTGTGATGGATATCTGC
Universal primer 5gcagggatgcggccgctgacAGCTCGGATCCACTAGTAACG
Primers for diagnosing the genes null mutants
3636640CAP1CAP1 UcheckCTGGCTGGCTTATACTCTAAC
CAP1 DcheckATCTGGATCGATCTCTGCAAG
3637393HOG1HOG1 UcheckAGGTAGTGTTGGTGTTATCAC
HOG1 DcheckGAAGCATTTGGATAAATTGGG
3645633RAD53RAD53 UcheckCGAAATACGATACGTTAGACG
RAD53 DcheckTTGGACATTGAGCATGTTCGG
3636187YBP1YBP1 UcheckGGTATTTTGGTTGGGATTGGG
YBP1 DcheckTGAATGTTCTTAAACTTGCCG
3644471GPX3GPX3 UcheckTGTGTCATGTCACGTGATAAC
GPX3 DcheckCATAGCCATCAATCTCTTGGT
8048008HIS1HIS1 LeftATTAGATACGTTGGTGGTTC
HIS1 RightAACACAACTGCACAATCTGG
8049225ARG4ARG4 LeftACACAGAGATACCTTGTACT
ARG4 RightACGGAGTACCACATACGATG
Primers for GFP-tagged C-terminals of Cap1
3636640CAP1Cap1gfp-F1GCTGATGTGAATCAATTACTAGAGCGAAGTATAAAACATCCCCAGGTCGACTCTAGATC
Cap1gfp-R1GAAATACCGTAAAATAAATTAAACCCACCACTAACTTGATTCTTTCCTGCGTTATCCTG
Cap1gfp-F2AAAGCTAAATGTTCTGAAAAGGGAGTAGTGATAAATACTGCTGATGTGAATCAATTACTA
Cap1gfp-R2ATATAAATACAAAAAAATAAAGCCAAATAGATGTCAATTGAAATACCGTAAAATAAATTA
Cap1check-FGAAGTTGTGCCGGCACCTCC
Cap1check-RAGATGATGTTGATTATGGTG
VP8GAATAATTCTTCACCTTTAGAGATGGT
VP19TGCAGATATCCATCACACTGG
Primers for qRT-PCR
3636640CAP1CAP1-rtFTGGGTTCATCTTCATCGT
CAP1-rtRTTGGGCACTGGGTTACTT
3639495CAT1CAT1-rtFAAGAGTTGTCCACGCTAA
CAT1-rtRGAACCTAATTCACCACCA
3639313TTR1TTR1-rtFATTGCCTCCAAATCCTAT
TTR1-rtRTGTTGACCACCAATAAAG
3636195ACT1ACT1-rtFTTGATTTGGCTGGTAGAG
ACT1-rtRATGGCAGAAGATTGAGAA
Annotation: a Ucheck, upstream check primer for target genes; Dcheck, downstream check primer for target genes; Left, upstream check primer for the HIS1 and ARG4 genes; Right, downstream check primer for the HIS1 and ARG4 genes; rtF, forward primer for qRT-PCR; rtR, reverse primer for qRT-PCR. b Lowercase sequences correspond to exogenous, complementary sequences that were added to primers 2, 3, 4, and 5 to facilitate mutually primed synthesis during the second round of fusion PCR.
Table 3. Compounds enhance the antifungal activity of plumbagin.
Table 3. Compounds enhance the antifungal activity of plumbagin.
No.DrugsMIC (μM)Fold Change of MIC (MICalone/MICcombined)
AloneCombination with Plumbagin
1Almonertinib hydrochloride>500.7864
2Bosutinib>5012.54
3Ceritinib dihydrochloride506.258
4Cetylpyridinium chloride6.251.564
5Cinacalcet>5012.54
6Clomiphene citrate256.254
7Dacomitinib>5012.54
8Halofantrine hydrochloride>506.258
9Ilaprazole>506.258
10Nilotinib monohydrochloride monohydrate>5012.54
11Pimavanserin tartrate5012.54
12Tafenoquine Succinate253.138
13Triflupromazine hydrochloride>506.258
14Vilanterol trifenatate>501.5632
15Vortioxetine256.254
16Vortioxetine hydrobromide5012.54
17Alectinib>500.7864
18Amiodarone hydrochloride>5012.54
19Amphotericin B0.78<0.18
20Benzethonium chloride12.53.134
21Bleomycin hydrochloride506.258
22Ceritinib506.258
23Chlorhexidine253.138
24Clioquinol256.254
25Disulfiram12.53.134
26Domiphen bromide253.138
27Ebastine256.254
28Fingolimod12.51.568
29Ibudilast>5012.54
30Magnolol506.258
31Menadione5012.54
32Olmutinib>506.258
33Pinaverium bromide503.1316
34Ponatinib>506.258
35Rolapitant5012.54
36Sertindole>5012.54
37Sonidegib>500.7864
38Sultiame506.258
39Tegaserod maleate5012.54
40Telotristat ethyl12.53.134
41Telotristat etiprate253.138
42Thonzonium bromide12.50.7816
43Triclosan12.51.568
44Butoconazole nitrate<0.1NANA
45Cinacalcet hydrochloride<0.1NANA
46Clotrimazole<0.1NANA
47Econazole nitrate<0.1NANA
48Efinaconazole<0.1NANA
49Everolimus<0.1NANA
50Fenticonazole Nitrate<0.1NANA
51Isavuconazole<0.1NANA
52Isoconazole nitrate<0.1NANA
53Itraconazole<0.1NANA
54Ketoconazole<0.1NANA
55Luliconazole<0.1NANA
56Micafungin sodium<0.1NANA
57Miconazole nitrate<0.1NANA
58Neticonazole hydrochloride<0.1NANA
59Oxiconazole nitrate<0.1NANA
60Posaconazole<0.1NANA
61Rapamycin<0.1NANA
62Sertaconazole nitrate<0.1NANA
63Sulconazole mononitrate<0.1NANA
64Temsirolimus<0.1NANA
65(+)-Ketoconazole<0.1NANA
66Amorolfine hydrochloride<0.1NANA
67Dasatinib<0.1NANA
68Econazole<0.1NANA
69Isavuconazonium sulfate<0.1NANA
70Lapatinib<0.1NANA
71Neticonazole<0.1NANA
72Tioconazole<0.1NANA
73Voriconazole<0.1NANA
74Atracurium besylate25500.50
75Broxyquinoline1.563.130.50
76Cetrorelix Acetate6.25500.13
77Revefenacin25500.50
78Adapalene25500.50
79Bifonazole3.136.250.50
80Dimetridazole12.5250.50
81Dioscin0.23.130.06
82Terbinafine1.563.130.50
83Terbinafine hydrochloride1.563.130.50
8410-Undecenoic acid>50501
8510-Undecenoic acid zinc salt>50501
86Aclacinomycin A hydrochloride2512.52
87Atorvastatin12.512.51
88Aviptadil acetate>50>501
89Bleomycin sulfate2512.52
90Blonanserin>50501
91Chlorprothixene>50252
92Chlorquinaldol3.131.562
93Ciclopirox50501
94Dronedarone hydrochloride2512.52
95Fluconazole6.256.251
96Fluvastatin sodium3.133.131
97Fosravuconazole lysine ethanolate12.512.51
98Josamycin>50501
99Lonafarnib>50>501
100L-Thyroxine sodium>50501
101Miltefosine50501
102Mycophenolic acid3.133.131
103Natamycin25251
104Nintedanib esylate>50501
105Nitroxoline6.256.251
106Otilonium bromide3.131.562
107Penfluridol>50252
108Piroctone olamine50501
109Pitavastatin Calcium1.560.782
110Pramocaine hydrochloride50501
111Tamoxifen Citrate50252
112Teprenone50501
113Vilazodone>50252
114Visomitin2512.52
115Abiraterone>50501
116Armillarisin A>50>501
117Atorvastatin hemicalcium salt12.56.252
118Auranofin>50501
119Bepridil hydrochloride hydrate50501
120Bithionol50501
121Boceprevir50501
122Bromperidol25251
123Calcium lactate25251
124Carmofur>50501
125Cerivastatin sodium1.561.561
126Cetylpyridinium chloride monohydrate6.253.132
127Chloroxine3.133.131
128Ciclopirox olamine>50501
129Degarelix>50501
130Dichlorisone acetate>50501
131Dronedarone2512.52
132Eltrombopag>50501
133Fingolimod hydrochloride6.253.132
134Flucytosine>50252
135Fluspirilene>50501
136Hexylresorcinol50501
137Levamlodipine besylate>50>501
138Nintedanib>50501
139Octenidine dihydrochloride1.561.561
140Osimertinib mesylate>50252
141Propofol>50501
142Rosuvastatin calcium25251
143Tamoxifen12.512.51
144Tavaborole0.780.781
145Terconazole0.20.21
146Ticagrelor>50252
147Zinc Pyrithione0.780.392
Annotation: NA: Not applicable. : 30 drugs are excluded as these drugs have potent antifungal activities. : 10 drugs were excluded as plumbagin antagonizes them. : 64 drugs were excluded as plumbagin slightly affected their antifungal activities.
Table 4. Drugs were evaluated for their interaction with plumbagin.
Table 4. Drugs were evaluated for their interaction with plumbagin.
No.Antifungal AgentsMIC (μM)FICFICIOutcome
AloneCombination
1HAL501.560.031250.09375Synergy
Plumbagin40.250.0625
2Ceritinib dihydrochloride5012.50.250.3125Synergy
Plumbagin40.250.0625
3Vortioxetine hydrobromide5012.50.250.3125Synergy
Plumbagin40.250.0625
4Disulfiram253.130.1250.375Synergy
Plumbagin410.25
5Ponatinib5012.50.250.5Synergy
Plumbagin410.25
6Tafenoquine succinate256.250.250.5Synergy
Plumbagin410.25
7Thonzonium bromide12.53.130.250.5Synergy
Plumbagin410.25
8Almonertinib hydrochloride503.130.06250.5625Addition
Plumbagin420.5
9Ebastine253.130.1250.625Addition
Plumbagin420.5
10Menadione506.250.1250.625Addition
Plumbagin420.5
11Sultiame506.250.1250.625Addition
Plumbagin420.5
12Vilanterol trifenatate506.250.1250.625Addition
Plumbagin420.5
13Amiodarone hydrochloride5012.50.250.75Addition
Plumbagin420.5
14Cinacalcet5012.50.250.75Addition
Plumbagin420.5
15Domiphen bromide12.53.130.250.75Addition
Plumbagin420.5
16Ilaprazole5012.50.250.75Addition
Plumbagin420.5
17Rolapitant5012.50.250.75Addition
Plumbagin420.5
18Amphotericin B0.780.390.51Addition
Plumbagin420.5
19Bleomycin hydrochloride2512.50.51Addition
Plumbagin420.5
20Cetylpyridinium chloride6.253.130.51Addition
Plumbagin420.5
21Clioquinol2512.50.51Addition
Plumbagin420.5
22Clomiphene (citrate)2512.50.51Addition
Plumbagin420.5
23Fingolimod6.253.130.51Addition
Plumbagin420.5
24Pinaverium bromide0.780.390.51Addition
Plumbagin420.5
25Tegaserod (maleate)50250.51Addition
Plumbagin420.5
26Telotristat ethyl12.56.250.51Addition
Plumbagin420.5
27Telotristat etiprate12.56.250.51Addition
Plumbagin420.5
28Triclosan2512.50.51Addition
Plumbagin420.5
29Alectinib505012Indifferent
Plumbagin441
30Benzethonium chloride12.512.512Indifferent
Plumbagin441
31Bosutinib505012Indifferent
Plumbagin441
32Ceritinib505012Indifferent
Plumbagin441
33Chlorhexidine505012Indifferent
Plumbagin441
34Dacomitinib505012Indifferent
Plumbagin441
35Ibudilast505012Indifferent
Plumbagin441
36Magnolol505012Indifferent
Plumbagin441
37Nilotinib monohydrochloride monohydrate505012Indifferent
Plumbagin441
38Olmutinib505012Indifferent
Plumbagin441
39Pimavanserin tartrate505012Indifferent
Plumbagin441
40Sertindole505012Indifferent
Plumbagin441
41Sonidegib505012Indifferent
Plumbagin441
42Triflupromazine hydrochloride505012Indifferent
Plumbagin441
43Vortioxetine252512Indifferent
Plumbagin441
Annotation: : 15 drugs are excluded because their relationship with plumbagin is indifferent. : 21 drugs were excluded because their relationship with plumbagin is additive.
Table 5. Drugs were evaluated for their interaction with menadione.
Table 5. Drugs were evaluated for their interaction with menadione.
No.Antifungal AgentsMIC (μM)FICFICIOutcome
AloneCombination
1HAL501.560.031250.1563 Synergy
Menadione3240.125
2Tafenoquine Succinate2512.50.50.625Addition
Menadione3240.125
3Ceritinib dihydrochloride50250.50.75Addition
Menadione3280.25
4Disulfiram6.253.130.51Addition
Menadione32160.5
5Ponatinib50250.51Addition
Menadione32160.5
6Thonzonium bromide12.56.250.51Addition
Menadione32160.5
7Vortioxetine hydrobromide50250.51Addition
Menadione32160.5
Table 6. HAL combined with H2O2 against C. albicans.
Table 6. HAL combined with H2O2 against C. albicans.
StrainAntifungal AgentsMICFICFICIOutcome
AloneCombination
SN152HAL>25 μM0.78 μM0.01560.2526Synergy
H2O23.13 mM0.78 mM0.25
hog1Δ/ΔHAL1.56 μM0.39 μM0.250.5Synergy
H2O21.56 mM0.39 mM0.25
rad53Δ/ΔHAL>25 μM1.56 μM0.031250.2813Synergy
H2O23.13 mM0.78 mM0.25
cap1Δ/ΔHAL>25 μM>25 μM12Indiferent
H2O21.56 mM1.56 mM1
ybp1Δ/ΔHAL>25 μM>25 μM12Indiferent
H2O20.78 mM0.78 mM1
gpx3Δ/ΔHAL>25 μM3.13 μM0.06250.5625addition
H2O21.56 mM0.78 mM0.5
Table 7. The interaction between HAL and NaCl.
Table 7. The interaction between HAL and NaCl.
ConditionsAgentsMIC FICFICIOutcome
AloneCombination
in the absence of plumbaginHAL>25 μM>25 μM12Indifferent
NaCl1000 mM1000 mM1
in the presence of plumbagin (2 μg/mL)HAL0.78 μM0.39 μM0.51Addition
NaCl62.5 mM31.25 mM0.5
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xiong, J.; Wang, L.; Feng, Z.; Hang, S.; Yu, J.; Feng, Y.; Lu, H.; Jiang, Y. Halofantrine Hydrochloride Acts as an Antioxidant Ability Inhibitor That Enhances Oxidative Stress Damage to Candida albicans. Antioxidants 2024, 13, 223. https://doi.org/10.3390/antiox13020223

AMA Style

Xiong J, Wang L, Feng Z, Hang S, Yu J, Feng Y, Lu H, Jiang Y. Halofantrine Hydrochloride Acts as an Antioxidant Ability Inhibitor That Enhances Oxidative Stress Damage to Candida albicans. Antioxidants. 2024; 13(2):223. https://doi.org/10.3390/antiox13020223

Chicago/Turabian Style

Xiong, Juan, Li Wang, Zhe Feng, Sijin Hang, Jinhua Yu, Yanru Feng, Hui Lu, and Yuanying Jiang. 2024. "Halofantrine Hydrochloride Acts as an Antioxidant Ability Inhibitor That Enhances Oxidative Stress Damage to Candida albicans" Antioxidants 13, no. 2: 223. https://doi.org/10.3390/antiox13020223

APA Style

Xiong, J., Wang, L., Feng, Z., Hang, S., Yu, J., Feng, Y., Lu, H., & Jiang, Y. (2024). Halofantrine Hydrochloride Acts as an Antioxidant Ability Inhibitor That Enhances Oxidative Stress Damage to Candida albicans. Antioxidants, 13(2), 223. https://doi.org/10.3390/antiox13020223

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop