Halofantrine Hydrochloride Acts as an Antioxidant Ability Inhibitor That Enhances Oxidative Stress Damage to Candida albicans
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strains, Primers, Agents, and Cultural Conditions
2.2. High-Throughput Screening
2.3. Minimum Inhibition Concentration (MIC) Assay
2.4. Dose–Matrix Titration Assay
2.5. Disruption of Target Genes
2.6. Quantitative Real-Time PCR (qRT-PCR) Analysis
2.7. C-Terminal of Proteins Tagging GFP
2.8. Western Blot Analysis
2.9. G. mellonella Infection Model
3. Results
3.1. HAL Enhances the Antifungal Activities of Oxidative Damage Agents
3.2. HAL Inhibits the Oxidative Stress Response in C. albicans
3.3. The Inhibitory Effect of HAL on Oxidative Stress Response Depends on the Cap1–Ybp1 Signaling Pathway
3.4. HAL Exhibits Antifungal Activity in the G. mellonella Infection Model
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Denning, D.W. Global incidence and mortality of severe fungal disease. Lancet Infect. Dis. 2024. [Google Scholar] [CrossRef] [PubMed]
- Lu, H.; Hong, T.; Jiang, Y.; Whiteway, M.; Zhang, S. Candidiasis: From cutaneous to systemic, new perspectives of potential targets and therapeutic strategies. Adv. Drug Deliv. Rev. 2023, 199, 114960. [Google Scholar] [CrossRef]
- Zhen, C.; Lu, H.; Jiang, Y. Novel Promising Antifungal Target Proteins for Conquering Invasive Fungal Infections. Front. Microbiol. 2022, 13, 911322. [Google Scholar] [CrossRef]
- Wang, Y.; Zou, Y.; Chen, X.; Li, H.; Yin, Z.; Zhang, B.; Xu, Y.; Zhang, Y.; Zhang, R.; Huang, X.; et al. Innate immune responses against the fungal pathogen Candida auris. Nat. Commun. 2022, 13, 3553. [Google Scholar] [CrossRef] [PubMed]
- Dantas, A.D.S.; Day, A.; Ikeh, M.; Kos, I.; Achan, B.; Quinn, J. Oxidative stress responses in the human fungal pathogen, Candida albicans. Biomolecules 2015, 5, 142–165. [Google Scholar] [CrossRef]
- Miranda, J.E.A.; Baronetti, J.L.; Sotomayor, C.E.; Paraje, M.G. Oxidative and nitrosative stress responses during macrophage–Candida albicans biofilm interaction. Med. Mycol. 2019, 57, 101–113. [Google Scholar] [CrossRef]
- Atriwal, T.; Chawla, M.; Hussain, A.; Alajmi, M.F.; Abid, M. Reactive oxygen mediated apoptosis as a therapeutic approach against opportunistic Candida albicans. Adv. Protein Chem. Struct. Biol. 2021, 125, 25–49. [Google Scholar] [CrossRef] [PubMed]
- Erwig, L.P.; Gow, N.A.R. Interactions of fungal pathogens with phagocytes. Nat. Rev. Microbiol. 2016, 14, 163–176. [Google Scholar] [CrossRef]
- Belenky, P.; Camacho, D.; Collins, J.J. Fungicidal drugs induce a common oxidative-damage cellular death pathway. Cell Rep. 2013, 3, 350–358. [Google Scholar] [CrossRef]
- Guirao-Abad, J.P.; Sánchez-Fresneda, R.; Román, E.; Pla, J.; Argüelles, J.C.; Alonso-Monge, R. The MAPK Hog1 mediates the response to amphotericin B in Candida albicans. Fungal Genet. Biol. 2020, 136, 103302. [Google Scholar] [CrossRef]
- Regidor, P.A.; Thamkhantho, M.; Chayachinda, C.; Palacios, S. Miconazole for the treatment of vulvovaginal candidiasis. In vitro, in vivo and clinical results. Review of the literature. J. Obstet. Gynaecol. 2023, 43, 2195001. [Google Scholar] [CrossRef]
- Xu, Y.; Wang, Y.; Yan, L.; Liang, R.-M.; Dai, B.-D.; Tang, R.-J.; Gao, P.-H.; Jiang, Y.-Y. Proteomic analysis reveals a synergistic mechanism of fluconazole and berberine against fluconazole-resistant Candida albicans: Endogenous ROS augmentation. J. Proteome Res. 2009, 8, 5296–5304. [Google Scholar] [CrossRef]
- Fu, Z.; Lu, H.; Zhu, Z.; Yan, L.; Jiang, Y.; Cao, Y. Combination of Baicalein and Amphotericin B Accelerates Candida albicans Apoptosis. Biol. Pharm. Bull. 2011, 34, 214–218. [Google Scholar] [CrossRef] [PubMed]
- Li, D.-D.; Chai, D.; Huang, X.-W.; Guan, S.-X.; Du, J.; Zhang, H.-Y.; Sun, Y.; Jiang, Y.-Y. Potent In Vitro Synergism of Fluconazole and Osthole against Fluconazole-Resistant Candida albicans. Antimicrob. Agents Chemother. 2017, 61. [Google Scholar] [CrossRef]
- Reeves, E.P.; Lu, H.; Jacobs, H.L.; Messina, C.G.M.; Bolsover, S.; Gabella, G.; Potma, E.O.; Warley, A.; Roes, J.; Segal, A.W. Killing activity of neutrophils is mediated through activation of proteases by K+ flux. Nature 2002, 416, 291–297. [Google Scholar] [CrossRef]
- Kaloriti, D.; Jacobsen, M.; Yin, Z.; Patterson, M.; Tillmann, A.; Smith, D.A.; Cook, E.; You, T.; Grimm, M.J.; Bohovych, I.; et al. Mechanisms underlying the exquisite sensitivity of candida albicans to combinatorial cationic and oxidative stress that enhances the potent fungicidal activity of phagocytes. mBio 2014, 5, e01334-14. [Google Scholar] [CrossRef] [PubMed]
- Kos, I.; Patterson, M.J.; Znaidi, S.; Kaloriti, D.; Dantas, A.d.S.; Herrero-De-Dios, C.M.; D’enfert, C.; Brown, A.J.P.; Quinn, J. Mechanisms Underlying the Delayed Activation of the Cap1 Transcription Factor in Candida albicans following Combinatorial Oxidative and Cationic Stress Important for Phagocytic Potency. mBio 2016, 7, e00331. [Google Scholar] [CrossRef]
- Chien, C.-T.; Chen, Y.-C.; Liu, Y.-C.; Liang, S.-H.; Lin, H.-H.; Lin, C.-H. The antimicrobial photodynamic inactivation resistance of Candida albicans is modulated by the Hog1 pathway and the Cap1 transcription factor. Med. Mycol. 2019, 57, 618–627. [Google Scholar] [CrossRef] [PubMed]
- Patterson, M.J.; McKenzie, C.G.; Smith, D.A.; Dantas, A.d.S.; Sherston, S.; Veal, E.A.; Morgan, B.A.; MacCallum, D.M.; Erwig, L.-P.; Quinn, J. Ybp1 and Gpx3 Signaling in Candida albicans Govern hydrogen peroxide-induced oxidation of the Cap1 transcription factor and macrophage escape. Antioxidants Redox Signal. 2013, 19, 2244–2260. [Google Scholar] [CrossRef]
- Jain, C.; Pastor, K.; Gonzalez, A.Y.; Lorenz, M.C.; Rao, R.P. The role of Candida albicans AP-1 protein against host derived ROS in in vivo models of infection. Virulence 2013, 4, 67–76. [Google Scholar] [CrossRef]
- Noble, S.M.; Johnson, A.D. Strains and strategies for large-scale gene deletion studies of the diploid human fungal pathogen Candida albicans. Eukaryot. Cell 2005, 4, 298–309. [Google Scholar] [CrossRef]
- Fang, T.; Xiong, J.; Wang, L.; Feng, Z.; Hang, S.; Yu, J.; Li, W.; Feng, Y.; Lu, H.; Jiang, Y. Unexpected Inhibitory Effect of Octenidine Dihydrochloride on Candida albicans Filamentation by Impairing Ergosterol Biosynthesis and Disrupting Cell Membrane Integrity. Antibiotics 2023, 12, 1675. [Google Scholar] [CrossRef]
- Johnson, M.D.; MacDougall, C.; Ostrosky-Zeichner, L.; Perfect, J.R.; Rex, J.H. Combination antifungal therapy. Antimicrob. Agents Chemother. 2004, 48, 693–715. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Ji, Z.; Feng, Y.; Yan, T.; Cao, Y.; Lu, H.; Jiang, Y. Myriocin enhances the antifungal activity of fluconazole by blocking the membrane localization of the efflux pump Cdr1. Front. Pharmacol. 2022, 13, 1101553. [Google Scholar] [CrossRef] [PubMed]
- Chang, P.; Wang, W.; Igarashi, Y.; Luo, F.; Chen, J. Efficient vector systems for economical and rapid epitope-tagging and overexpression in Candida albicans. J. Microbiol. Methods 2018, 149, 14–19. [Google Scholar] [CrossRef] [PubMed]
- Lu, H.; Li, W.; Whiteway, M.; Wang, H.; Zhu, S.; Ji, Z.; Feng, Y.; Yan, L.; Fang, T.; Li, L.; et al. A Small Molecule Inhibitor of Erg251 Makes Fluconazole Fungicidal by Inhibiting the Synthesis of the 14α-Methylsterols. mBio 2023, 14, e0263922. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Lu, H.; Zhang, X.; Whiteway, M.; Wu, H.; Tan, S.; Zang, J.; Tian, S.; Zhen, C.; Meng, X.; et al. Baicalein Acts against Candida albicans by Targeting Eno1 and Inhibiting Glycolysis. Microbiol. Spectr. 2022, 10, e0208522. [Google Scholar] [CrossRef] [PubMed]
- Padhye, S.; Dandawate, P.; Yusufi, M.; Ahmad, A.; Sarkar, F.H. Perspectives on medicinal properties of plumbagin and its analogs. Med. Res. Rev. 2012, 32, 1131–1158. [Google Scholar] [CrossRef] [PubMed]
- Castro, F.A.V.; Mariani, D.; Panek, A.D.; Eleutherio, E.C.A.; Pereira, M.D. Cytotoxicity mechanism of two naphthoquinones (menadione and plumbagin) in Saccharomyces cerevisiae. PLoS ONE 2008, 3, e3999. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Wang, Y.; Dai, B.; Wang, B.; Zhang, H.; Zhu, Z.; Xu, Y.; Cao, Y.; Jiang, Y.; Zhang, G. Trehalose is an important mediator of Cap1p oxidative stress response in Candida albicans. Biol. Pharm. Bull. 2008, 31, 421–425. [Google Scholar] [CrossRef]
- Wang, Y.; Cao, Y.-Y.; Jia, X.-M.; Cao, Y.-B.; Gao, P.-H.; Fu, X.-P.; Ying, K.; Chen, W.-S.; Jiang, Y.-Y. Cap1p is involved in multiple pathways of oxidative stress response in Candida albicans. Free. Radic. Biol. Med. 2006, 40, 1201–1209. [Google Scholar] [CrossRef]
- Noble, S.M.; French, S.; Kohn, L.A.; Chen, V.; Johnson, A.D. Systematic screens of a Candida albicans homozygous deletion library decouple morphogenetic switching and pathogenicity. Nat. Genet. 2010, 42, 590–598. [Google Scholar] [CrossRef]
- Gulshan, K.; Thommandru, B.; Moye-Rowley, W.S. Proteolytic degradation of the Yap1 transcription factor is regulated by subcellular localization and the E3 ubiquitin ligase Not4. J. Biol. Chem. 2012, 287, 26796–26805. [Google Scholar] [CrossRef]
- Durieux, M.-F.; Melloul, S.; Jemel, S.; Roisin, L.; Dardé, M.-L.; Guillot, J.; Dannaoui, S.; Botterel, F. Galleria mellonella as a screening tool to study virulence factors of Aspergillus fumigatus. Virulence 2021, 12, 818–834. [Google Scholar] [CrossRef] [PubMed]
- Fallon, J.; Kelly, J.; Kavanagh, K. Galleria mellonella as a model for fungal pathogenicity testing. Methods Mol. Biol. 2012, 845, 469–485. [Google Scholar] [CrossRef] [PubMed]
- Rossi, S.A.; de Oliveira, H.C.; Agreda-Mellon, D.; Lucio, J.; Mendes-Giannini, M.J.S.; García-Cambero, J.P.; Zaragoza, O. Identification of Off-Patent Drugs That Show Synergism with Amphotericin B or That Present Antifungal Action against Cryptococcus neoformans and Candida spp. Antimicrob. Agents Chemother. 2020, 64. [Google Scholar] [CrossRef]
- Tavakkoli, A.; Johnston, T.P.; Sahebkar, A. Antifungal effects of statins. Pharmacol. Ther. 2020, 208, 107483. [Google Scholar] [CrossRef] [PubMed]
- Spitzer, M.; Griffiths, E.; Blakely, K.M.; Wildenhain, J.; Ejim, L.; Rossi, L.; De Pascale, G.; Curak, J.; Brown, E.; Tyers, M.; et al. Cross-species discovery of syncretic drug combinations that potentiate the antifungal fluconazole. Mol. Syst. Biol. 2011, 7, 499. [Google Scholar] [CrossRef] [PubMed]
- Arvanitis, M.; Glavis-Bloom, J.; Mylonakis, E. Invertebrate models of fungal infection. Biochim. Biophys. Acta 2013, 1832, 1378–1383. [Google Scholar] [CrossRef]
- Andrea, A.; Krogfelt, K.A.; Jenssen, H. Methods and Challenges of Using the Greater Wax Moth (Galleria mellonella) as a Model Organism in Antimicrobial Compound Discovery. Microorganisms 2019, 7, 85. [Google Scholar] [CrossRef]
- Jemel, S.; Guillot, J.; Kallel, K.; Botterel, F.; Dannaoui, E. Galleria mellonella for the Evaluation of Antifungal Efficacy against Medically Important Fungi, a Narrative Review. Microorganisms 2020, 8, 390. [Google Scholar] [CrossRef] [PubMed]
- Freitas, G.J.; Ribeiro, N.Q.; Gouveia-Eufrasio, L.; Emidio, E.C.; Guimarães, G.M.; César, I.C.; Paixão, T.A.; Oliveira, J.B.; Caza, M.; Kronstad, J.W.; et al. Antimalarials and amphotericin B interact synergistically and are new options to treat cryptococcosis. Int. J. Antimicrob. Agents 2023, 62, 106807. [Google Scholar] [CrossRef] [PubMed]
- Tie, H.; Walker, B.D.; Singleton, C.B.; Valenzuela, S.M.; Bursill, J.A.; Wyse, K.R.; Breit, S.N.; Campbell, T.J. Inhibition of HERG potassium channels by the antimalarial agent halofantrine. Br. J. Pharmacol. 2000, 130, 1967–1975. [Google Scholar] [CrossRef] [PubMed]
- Traebert, M.; Dumotier, B.; Meister, L.; Hoffmann, P.; Dominguez-Estevez, M.; Suter, W. Inhibition of hERG K+ currents by antimalarial drugs in stably transfected HEK293 cells. Eur. J. Pharmacol. 2004, 484, 41–48. [Google Scholar] [CrossRef]
Gene Accession No. | Strain | Genotype | Source or Reference |
---|---|---|---|
SC5314 | Wild type | [21] | |
SN152 | his1/his1 arg4/arg4 leu2/leu2 | [21] | |
3636640 | cap1Δ/cap1Δ | cap1::HIS1/cap1::ARG4 leu2/leu2 | This study |
3637393 | hog1Δ/hog1Δ | hog1::HIS1/hog1::ARG4 leu2/leu2 | This study |
3645633 | rad53Δ/rad53Δ | rad53::HIS1/rad53::ARG4 leu2/leu2 | This study |
3636187 | ybp1Δ/ybp1Δ | ybp1::HIS1/ybp1::ARG4 leu2/leu2 | This study |
3644471 | gpx3Δ/gpx3Δ | gpx3::HIS1/gpx3::ARG4 leu2/leu2 | This study |
3636640 | CAP1-GFP | his1/his1 arg4/arg4 CAP1/cap1::CAP1-GFP-LEU2 | This study |
Gene Accession No. | Gene Name | Primer Name a | Primer Sequence (5′ to 3′) b |
---|---|---|---|
Primers for genes deletion | |||
3636640 | CAP1 | CAP1 P1 | GATTACTAATTATTCTTTGAC |
CAP1 P3 | cacggcgcgcctagcagcggGAATAAGGATAGTTGAAAATG | ||
CAP1 P4 | gtcagcggccgcatccctgcCATTAATCAAGTTAGTGGTGG | ||
CAP1 P6 | CTAGTTGAATCAAAGAAAGCC | ||
3637393 | HOG1 | HOG1 P1 | GCCTTGCTTATGTTCACAAAC |
HOG1 P3 | cacggcgcgcctagcagcggCATTTTCTTATATGCTTTATC | ||
HOG1 P4 | gtcagcggccgcatccctgcTCTTCAAAAATACAAGCTAGC | ||
HOG1 P6 | TCGTAAGGACGGTATTACAGC | ||
3645633 | RAD53 | RAD53 P1 | CTAGTTTTCATCTTGATCTTG |
RAD53 P3 | cacggcgcgcctagcagcggTGTAGTTTGGTAAATTAAGGG | ||
RAD53 P4 | gtcagcggccgcatccctgcATTTAGCATATATACAAGCAT | ||
RAD53 P6 | GAACGGAGATGGCAACATGTG | ||
3636187 | YBP1 | YBP1 P1 | GCTAGTTTATCCCCTCTTATG |
YBP1 P3 | cacggcgcgcctagcagcggAAATTGAAATGGCTCAATGGT | ||
YBP1 P4 | gtcagcggccgcatccctgcTGTATATGTATGTAACTACGT | ||
YBP1 P6 | CTTCACCATTACCATCTCATC | ||
3644471 | GPX3 | GPX3 P1 | GCTGTCAAACCATTGGAGCTC |
GPX3 P3 | cacggcgcgcctagcagcggTGATGATTGTTGATAATTGTA | ||
GPX3 P4 | gtcagcggccgcatccctgcAAATACAGTAGTATTATACAT | ||
GPX3 P6 | CGGGCAGGTCAATGCCAAACC | ||
Universal primer 2 | ccgctgctaggcgcgccgtgACCAGTGTGATGGATATCTGC | ||
Universal primer 5 | gcagggatgcggccgctgacAGCTCGGATCCACTAGTAACG | ||
Primers for diagnosing the genes null mutants | |||
3636640 | CAP1 | CAP1 Ucheck | CTGGCTGGCTTATACTCTAAC |
CAP1 Dcheck | ATCTGGATCGATCTCTGCAAG | ||
3637393 | HOG1 | HOG1 Ucheck | AGGTAGTGTTGGTGTTATCAC |
HOG1 Dcheck | GAAGCATTTGGATAAATTGGG | ||
3645633 | RAD53 | RAD53 Ucheck | CGAAATACGATACGTTAGACG |
RAD53 Dcheck | TTGGACATTGAGCATGTTCGG | ||
3636187 | YBP1 | YBP1 Ucheck | GGTATTTTGGTTGGGATTGGG |
YBP1 Dcheck | TGAATGTTCTTAAACTTGCCG | ||
3644471 | GPX3 | GPX3 Ucheck | TGTGTCATGTCACGTGATAAC |
GPX3 Dcheck | CATAGCCATCAATCTCTTGGT | ||
8048008 | HIS1 | HIS1 Left | ATTAGATACGTTGGTGGTTC |
HIS1 Right | AACACAACTGCACAATCTGG | ||
8049225 | ARG4 | ARG4 Left | ACACAGAGATACCTTGTACT |
ARG4 Right | ACGGAGTACCACATACGATG | ||
Primers for GFP-tagged C-terminals of Cap1 | |||
3636640 | CAP1 | Cap1gfp-F1 | GCTGATGTGAATCAATTACTAGAGCGAAGTATAAAACATCCCCAGGTCGACTCTAGATC |
Cap1gfp-R1 | GAAATACCGTAAAATAAATTAAACCCACCACTAACTTGATTCTTTCCTGCGTTATCCTG | ||
Cap1gfp-F2 | AAAGCTAAATGTTCTGAAAAGGGAGTAGTGATAAATACTGCTGATGTGAATCAATTACTA | ||
Cap1gfp-R2 | ATATAAATACAAAAAAATAAAGCCAAATAGATGTCAATTGAAATACCGTAAAATAAATTA | ||
Cap1check-F | GAAGTTGTGCCGGCACCTCC | ||
Cap1check-R | AGATGATGTTGATTATGGTG | ||
VP8 | GAATAATTCTTCACCTTTAGAGATGGT | ||
VP19 | TGCAGATATCCATCACACTGG | ||
Primers for qRT-PCR | |||
3636640 | CAP1 | CAP1-rtF | TGGGTTCATCTTCATCGT |
CAP1-rtR | TTGGGCACTGGGTTACTT | ||
3639495 | CAT1 | CAT1-rtF | AAGAGTTGTCCACGCTAA |
CAT1-rtR | GAACCTAATTCACCACCA | ||
3639313 | TTR1 | TTR1-rtF | ATTGCCTCCAAATCCTAT |
TTR1-rtR | TGTTGACCACCAATAAAG | ||
3636195 | ACT1 | ACT1-rtF | TTGATTTGGCTGGTAGAG |
ACT1-rtR | ATGGCAGAAGATTGAGAA |
No. | Drugs | MIC (μM) | Fold Change of MIC (MICalone/MICcombined) | |
---|---|---|---|---|
Alone | Combination with Plumbagin | |||
1 | Almonertinib hydrochloride | >50 | 0.78 | 64 |
2 | Bosutinib | >50 | 12.5 | 4 |
3 | Ceritinib dihydrochloride | 50 | 6.25 | 8 |
4 | Cetylpyridinium chloride | 6.25 | 1.56 | 4 |
5 | Cinacalcet | >50 | 12.5 | 4 |
6 | Clomiphene citrate | 25 | 6.25 | 4 |
7 | Dacomitinib | >50 | 12.5 | 4 |
8 | Halofantrine hydrochloride | >50 | 6.25 | 8 |
9 | Ilaprazole | >50 | 6.25 | 8 |
10 | Nilotinib monohydrochloride monohydrate | >50 | 12.5 | 4 |
11 | Pimavanserin tartrate | 50 | 12.5 | 4 |
12 | Tafenoquine Succinate | 25 | 3.13 | 8 |
13 | Triflupromazine hydrochloride | >50 | 6.25 | 8 |
14 | Vilanterol trifenatate | >50 | 1.56 | 32 |
15 | Vortioxetine | 25 | 6.25 | 4 |
16 | Vortioxetine hydrobromide | 50 | 12.5 | 4 |
17 | Alectinib | >50 | 0.78 | 64 |
18 | Amiodarone hydrochloride | >50 | 12.5 | 4 |
19 | Amphotericin B | 0.78 | <0.1 | 8 |
20 | Benzethonium chloride | 12.5 | 3.13 | 4 |
21 | Bleomycin hydrochloride | 50 | 6.25 | 8 |
22 | Ceritinib | 50 | 6.25 | 8 |
23 | Chlorhexidine | 25 | 3.13 | 8 |
24 | Clioquinol | 25 | 6.25 | 4 |
25 | Disulfiram | 12.5 | 3.13 | 4 |
26 | Domiphen bromide | 25 | 3.13 | 8 |
27 | Ebastine | 25 | 6.25 | 4 |
28 | Fingolimod | 12.5 | 1.56 | 8 |
29 | Ibudilast | >50 | 12.5 | 4 |
30 | Magnolol | 50 | 6.25 | 8 |
31 | Menadione | 50 | 12.5 | 4 |
32 | Olmutinib | >50 | 6.25 | 8 |
33 | Pinaverium bromide | 50 | 3.13 | 16 |
34 | Ponatinib | >50 | 6.25 | 8 |
35 | Rolapitant | 50 | 12.5 | 4 |
36 | Sertindole | >50 | 12.5 | 4 |
37 | Sonidegib | >50 | 0.78 | 64 |
38 | Sultiame | 50 | 6.25 | 8 |
39 | Tegaserod maleate | 50 | 12.5 | 4 |
40 | Telotristat ethyl | 12.5 | 3.13 | 4 |
41 | Telotristat etiprate | 25 | 3.13 | 8 |
42 | Thonzonium bromide | 12.5 | 0.78 | 16 |
43 | Triclosan | 12.5 | 1.56 | 8 |
44 | Butoconazole nitrate | <0.1 | NA | NA |
45 | Cinacalcet hydrochloride | <0.1 | NA | NA |
46 | Clotrimazole | <0.1 | NA | NA |
47 | Econazole nitrate | <0.1 | NA | NA |
48 | Efinaconazole | <0.1 | NA | NA |
49 | Everolimus | <0.1 | NA | NA |
50 | Fenticonazole Nitrate | <0.1 | NA | NA |
51 | Isavuconazole | <0.1 | NA | NA |
52 | Isoconazole nitrate | <0.1 | NA | NA |
53 | Itraconazole | <0.1 | NA | NA |
54 | Ketoconazole | <0.1 | NA | NA |
55 | Luliconazole | <0.1 | NA | NA |
56 | Micafungin sodium | <0.1 | NA | NA |
57 | Miconazole nitrate | <0.1 | NA | NA |
58 | Neticonazole hydrochloride | <0.1 | NA | NA |
59 | Oxiconazole nitrate | <0.1 | NA | NA |
60 | Posaconazole | <0.1 | NA | NA |
61 | Rapamycin | <0.1 | NA | NA |
62 | Sertaconazole nitrate | <0.1 | NA | NA |
63 | Sulconazole mononitrate | <0.1 | NA | NA |
64 | Temsirolimus | <0.1 | NA | NA |
65 | (+)-Ketoconazole | <0.1 | NA | NA |
66 | Amorolfine hydrochloride | <0.1 | NA | NA |
67 | Dasatinib | <0.1 | NA | NA |
68 | Econazole | <0.1 | NA | NA |
69 | Isavuconazonium sulfate | <0.1 | NA | NA |
70 | Lapatinib | <0.1 | NA | NA |
71 | Neticonazole | <0.1 | NA | NA |
72 | Tioconazole | <0.1 | NA | NA |
73 | Voriconazole | <0.1 | NA | NA |
74 | Atracurium besylate | 25 | 50 | 0.50 |
75 | Broxyquinoline | 1.56 | 3.13 | 0.50 |
76 | Cetrorelix Acetate | 6.25 | 50 | 0.13 |
77 | Revefenacin | 25 | 50 | 0.50 |
78 | Adapalene | 25 | 50 | 0.50 |
79 | Bifonazole | 3.13 | 6.25 | 0.50 |
80 | Dimetridazole | 12.5 | 25 | 0.50 |
81 | Dioscin | 0.2 | 3.13 | 0.06 |
82 | Terbinafine | 1.56 | 3.13 | 0.50 |
83 | Terbinafine hydrochloride | 1.56 | 3.13 | 0.50 |
84 | 10-Undecenoic acid | >50 | 50 | 1 |
85 | 10-Undecenoic acid zinc salt | >50 | 50 | 1 |
86 | Aclacinomycin A hydrochloride | 25 | 12.5 | 2 |
87 | Atorvastatin | 12.5 | 12.5 | 1 |
88 | Aviptadil acetate | >50 | >50 | 1 |
89 | Bleomycin sulfate | 25 | 12.5 | 2 |
90 | Blonanserin | >50 | 50 | 1 |
91 | Chlorprothixene | >50 | 25 | 2 |
92 | Chlorquinaldol | 3.13 | 1.56 | 2 |
93 | Ciclopirox | 50 | 50 | 1 |
94 | Dronedarone hydrochloride | 25 | 12.5 | 2 |
95 | Fluconazole | 6.25 | 6.25 | 1 |
96 | Fluvastatin sodium | 3.13 | 3.13 | 1 |
97 | Fosravuconazole lysine ethanolate | 12.5 | 12.5 | 1 |
98 | Josamycin | >50 | 50 | 1 |
99 | Lonafarnib | >50 | >50 | 1 |
100 | L-Thyroxine sodium | >50 | 50 | 1 |
101 | Miltefosine | 50 | 50 | 1 |
102 | Mycophenolic acid | 3.13 | 3.13 | 1 |
103 | Natamycin | 25 | 25 | 1 |
104 | Nintedanib esylate | >50 | 50 | 1 |
105 | Nitroxoline | 6.25 | 6.25 | 1 |
106 | Otilonium bromide | 3.13 | 1.56 | 2 |
107 | Penfluridol | >50 | 25 | 2 |
108 | Piroctone olamine | 50 | 50 | 1 |
109 | Pitavastatin Calcium | 1.56 | 0.78 | 2 |
110 | Pramocaine hydrochloride | 50 | 50 | 1 |
111 | Tamoxifen Citrate | 50 | 25 | 2 |
112 | Teprenone | 50 | 50 | 1 |
113 | Vilazodone | >50 | 25 | 2 |
114 | Visomitin | 25 | 12.5 | 2 |
115 | Abiraterone | >50 | 50 | 1 |
116 | Armillarisin A | >50 | >50 | 1 |
117 | Atorvastatin hemicalcium salt | 12.5 | 6.25 | 2 |
118 | Auranofin | >50 | 50 | 1 |
119 | Bepridil hydrochloride hydrate | 50 | 50 | 1 |
120 | Bithionol | 50 | 50 | 1 |
121 | Boceprevir | 50 | 50 | 1 |
122 | Bromperidol | 25 | 25 | 1 |
123 | Calcium lactate | 25 | 25 | 1 |
124 | Carmofur | >50 | 50 | 1 |
125 | Cerivastatin sodium | 1.56 | 1.56 | 1 |
126 | Cetylpyridinium chloride monohydrate | 6.25 | 3.13 | 2 |
127 | Chloroxine | 3.13 | 3.13 | 1 |
128 | Ciclopirox olamine | >50 | 50 | 1 |
129 | Degarelix | >50 | 50 | 1 |
130 | Dichlorisone acetate | >50 | 50 | 1 |
131 | Dronedarone | 25 | 12.5 | 2 |
132 | Eltrombopag | >50 | 50 | 1 |
133 | Fingolimod hydrochloride | 6.25 | 3.13 | 2 |
134 | Flucytosine | >50 | 25 | 2 |
135 | Fluspirilene | >50 | 50 | 1 |
136 | Hexylresorcinol | 50 | 50 | 1 |
137 | Levamlodipine besylate | >50 | >50 | 1 |
138 | Nintedanib | >50 | 50 | 1 |
139 | Octenidine dihydrochloride | 1.56 | 1.56 | 1 |
140 | Osimertinib mesylate | >50 | 25 | 2 |
141 | Propofol | >50 | 50 | 1 |
142 | Rosuvastatin calcium | 25 | 25 | 1 |
143 | Tamoxifen | 12.5 | 12.5 | 1 |
144 | Tavaborole | 0.78 | 0.78 | 1 |
145 | Terconazole | 0.2 | 0.2 | 1 |
146 | Ticagrelor | >50 | 25 | 2 |
147 | Zinc Pyrithione | 0.78 | 0.39 | 2 |
No. | Antifungal Agents | MIC (μM) | FIC | FICI | Outcome | |
---|---|---|---|---|---|---|
Alone | Combination | |||||
1 | HAL | 50 | 1.56 | 0.03125 | 0.09375 | Synergy |
Plumbagin | 4 | 0.25 | 0.0625 | |||
2 | Ceritinib dihydrochloride | 50 | 12.5 | 0.25 | 0.3125 | Synergy |
Plumbagin | 4 | 0.25 | 0.0625 | |||
3 | Vortioxetine hydrobromide | 50 | 12.5 | 0.25 | 0.3125 | Synergy |
Plumbagin | 4 | 0.25 | 0.0625 | |||
4 | Disulfiram | 25 | 3.13 | 0.125 | 0.375 | Synergy |
Plumbagin | 4 | 1 | 0.25 | |||
5 | Ponatinib | 50 | 12.5 | 0.25 | 0.5 | Synergy |
Plumbagin | 4 | 1 | 0.25 | |||
6 | Tafenoquine succinate | 25 | 6.25 | 0.25 | 0.5 | Synergy |
Plumbagin | 4 | 1 | 0.25 | |||
7 | Thonzonium bromide | 12.5 | 3.13 | 0.25 | 0.5 | Synergy |
Plumbagin | 4 | 1 | 0.25 | |||
8 | Almonertinib hydrochloride | 50 | 3.13 | 0.0625 | 0.5625 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
9 | Ebastine | 25 | 3.13 | 0.125 | 0.625 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
10 | Menadione | 50 | 6.25 | 0.125 | 0.625 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
11 | Sultiame | 50 | 6.25 | 0.125 | 0.625 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
12 | Vilanterol trifenatate | 50 | 6.25 | 0.125 | 0.625 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
13 | Amiodarone hydrochloride | 50 | 12.5 | 0.25 | 0.75 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
14 | Cinacalcet | 50 | 12.5 | 0.25 | 0.75 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
15 | Domiphen bromide | 12.5 | 3.13 | 0.25 | 0.75 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
16 | Ilaprazole | 50 | 12.5 | 0.25 | 0.75 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
17 | Rolapitant | 50 | 12.5 | 0.25 | 0.75 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
18 | Amphotericin B | 0.78 | 0.39 | 0.5 | 1 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
19 | Bleomycin hydrochloride | 25 | 12.5 | 0.5 | 1 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
20 | Cetylpyridinium chloride | 6.25 | 3.13 | 0.5 | 1 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
21 | Clioquinol | 25 | 12.5 | 0.5 | 1 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
22 | Clomiphene (citrate) | 25 | 12.5 | 0.5 | 1 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
23 | Fingolimod | 6.25 | 3.13 | 0.5 | 1 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
24 | Pinaverium bromide | 0.78 | 0.39 | 0.5 | 1 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
25 | Tegaserod (maleate) | 50 | 25 | 0.5 | 1 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
26 | Telotristat ethyl | 12.5 | 6.25 | 0.5 | 1 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
27 | Telotristat etiprate | 12.5 | 6.25 | 0.5 | 1 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
28 | Triclosan | 25 | 12.5 | 0.5 | 1 | Addition |
Plumbagin | 4 | 2 | 0.5 | |||
29 | Alectinib | 50 | 50 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 | |||
30 | Benzethonium chloride | 12.5 | 12.5 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 | |||
31 | Bosutinib | 50 | 50 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 | |||
32 | Ceritinib | 50 | 50 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 | |||
33 | Chlorhexidine | 50 | 50 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 | |||
34 | Dacomitinib | 50 | 50 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 | |||
35 | Ibudilast | 50 | 50 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 | |||
36 | Magnolol | 50 | 50 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 | |||
37 | Nilotinib monohydrochloride monohydrate | 50 | 50 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 | |||
38 | Olmutinib | 50 | 50 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 | |||
39 | Pimavanserin tartrate | 50 | 50 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 | |||
40 | Sertindole | 50 | 50 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 | |||
41 | Sonidegib | 50 | 50 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 | |||
42 | Triflupromazine hydrochloride | 50 | 50 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 | |||
43 | Vortioxetine | 25 | 25 | 1 | 2 | Indifferent |
Plumbagin | 4 | 4 | 1 |
No. | Antifungal Agents | MIC (μM) | FIC | FICI | Outcome | |
---|---|---|---|---|---|---|
Alone | Combination | |||||
1 | HAL | 50 | 1.56 | 0.03125 | 0.1563 | Synergy |
Menadione | 32 | 4 | 0.125 | |||
2 | Tafenoquine Succinate | 25 | 12.5 | 0.5 | 0.625 | Addition |
Menadione | 32 | 4 | 0.125 | |||
3 | Ceritinib dihydrochloride | 50 | 25 | 0.5 | 0.75 | Addition |
Menadione | 32 | 8 | 0.25 | |||
4 | Disulfiram | 6.25 | 3.13 | 0.5 | 1 | Addition |
Menadione | 32 | 16 | 0.5 | |||
5 | Ponatinib | 50 | 25 | 0.5 | 1 | Addition |
Menadione | 32 | 16 | 0.5 | |||
6 | Thonzonium bromide | 12.5 | 6.25 | 0.5 | 1 | Addition |
Menadione | 32 | 16 | 0.5 | |||
7 | Vortioxetine hydrobromide | 50 | 25 | 0.5 | 1 | Addition |
Menadione | 32 | 16 | 0.5 |
Strain | Antifungal Agents | MIC | FIC | FICI | Outcome | |
---|---|---|---|---|---|---|
Alone | Combination | |||||
SN152 | HAL | >25 μM | 0.78 μM | 0.0156 | 0.2526 | Synergy |
H2O2 | 3.13 mM | 0.78 mM | 0.25 | |||
hog1Δ/Δ | HAL | 1.56 μM | 0.39 μM | 0.25 | 0.5 | Synergy |
H2O2 | 1.56 mM | 0.39 mM | 0.25 | |||
rad53Δ/Δ | HAL | >25 μM | 1.56 μM | 0.03125 | 0.2813 | Synergy |
H2O2 | 3.13 mM | 0.78 mM | 0.25 | |||
cap1Δ/Δ | HAL | >25 μM | >25 μM | 1 | 2 | Indiferent |
H2O2 | 1.56 mM | 1.56 mM | 1 | |||
ybp1Δ/Δ | HAL | >25 μM | >25 μM | 1 | 2 | Indiferent |
H2O2 | 0.78 mM | 0.78 mM | 1 | |||
gpx3Δ/Δ | HAL | >25 μM | 3.13 μM | 0.0625 | 0.5625 | addition |
H2O2 | 1.56 mM | 0.78 mM | 0.5 |
Conditions | Agents | MIC | FIC | FICI | Outcome | |
---|---|---|---|---|---|---|
Alone | Combination | |||||
in the absence of plumbagin | HAL | >25 μM | >25 μM | 1 | 2 | Indifferent |
NaCl | 1000 mM | 1000 mM | 1 | |||
in the presence of plumbagin (2 μg/mL) | HAL | 0.78 μM | 0.39 μM | 0.5 | 1 | Addition |
NaCl | 62.5 mM | 31.25 mM | 0.5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiong, J.; Wang, L.; Feng, Z.; Hang, S.; Yu, J.; Feng, Y.; Lu, H.; Jiang, Y. Halofantrine Hydrochloride Acts as an Antioxidant Ability Inhibitor That Enhances Oxidative Stress Damage to Candida albicans. Antioxidants 2024, 13, 223. https://doi.org/10.3390/antiox13020223
Xiong J, Wang L, Feng Z, Hang S, Yu J, Feng Y, Lu H, Jiang Y. Halofantrine Hydrochloride Acts as an Antioxidant Ability Inhibitor That Enhances Oxidative Stress Damage to Candida albicans. Antioxidants. 2024; 13(2):223. https://doi.org/10.3390/antiox13020223
Chicago/Turabian StyleXiong, Juan, Li Wang, Zhe Feng, Sijin Hang, Jinhua Yu, Yanru Feng, Hui Lu, and Yuanying Jiang. 2024. "Halofantrine Hydrochloride Acts as an Antioxidant Ability Inhibitor That Enhances Oxidative Stress Damage to Candida albicans" Antioxidants 13, no. 2: 223. https://doi.org/10.3390/antiox13020223
APA StyleXiong, J., Wang, L., Feng, Z., Hang, S., Yu, J., Feng, Y., Lu, H., & Jiang, Y. (2024). Halofantrine Hydrochloride Acts as an Antioxidant Ability Inhibitor That Enhances Oxidative Stress Damage to Candida albicans. Antioxidants, 13(2), 223. https://doi.org/10.3390/antiox13020223