Anti-Neuroinflammatory Effects of the Human Milk Oligosaccharide, 2′-Fucosyllactose, Exerted via Modulation of M2 Microglial Activation in a Mouse Model of Ischemia–Reperfusion Injury
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Animals
2.3. Drug Administration
2.4. Middle Cerebral Artery Occlusion (MCAO) Model
2.5. Behavioral Experiments
2.5.1. Neurological Function Evaluation
2.5.2. Corner Test
2.5.3. Wire Grip Test
2.6. Reverse Transcription–Polymerase Chain Reaction (RT-PCR)
2.7. Nissl Staining
2.8. Enzyme-Linked Immunoassay (ELISA)
2.9. Western Blot
2.10. Detection of ROS
2.11. Immunofluorescence (IF) Staining
2.12. Statistical Analysis
3. Results
3.1. 2′-FL Modulates the Polarization of Microglia in Ischemic Stroke
3.2. 2′-FL Abrogates Neurological Deficits and Motor Function in Ischemic Stroke
3.3. 2′-FL Reduces Neuronal Damage in the Brain of Ischemic Stroke
3.4. 2′-FL Reduces ROS Generation in Ischemic Stroke
3.5. 2′-FL Regulates Cytokines Related to Inflammation and Microglial Activation in Ischemic Stroke
3.6. 2′-FL Activates M2 Type Microglia via IL-4 Induction and STAT6 Activation after MCAO
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Peng, T.; Jiang, Y.; Farhan, M.; Lazarovici, P.; Chen, L.; Zheng, W. Anti-inflammatory Effects of Traditional Chinese Medicines on Preclinical In Vivo Models of Brain Ischemia-Reperfusion-Injury: Prospects for Neuroprotective Drug Discovery and Therapy. Front. Pharmacol. 2019, 10, 204. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Doyle, K.P.; Simon, R.P.; Stenzel-Poore, M.P. Mechanisms of ischemic brain damage. Neuropharmacology 2008, 55, 310–318. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lahiani, A.; Brand-Yavin, A.; Yavin, E.; Lazarovici, P. Neuroprotective Effects of Bioactive Compounds and MAPK Pathway Modulation in “Ischemia”-Stressed PC12 Pheochromocytoma Cells. Brain Sci. 2018, 8, 32. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reekmans, K.; Praet, J.; Daans, J.; Reumers, V.; Pauwels, P.; Van der Linden, A.; Berneman, Z.N.; Ponsaerts, P. Current challenges for the advancement of neural stem cell biology and transplantation research. Stem Cell Rev. Rep. 2012, 8, 262–278. [Google Scholar] [CrossRef]
- Yoneyama, M.; Shiba, T.; Hasebe, S.; Ogita, K. Adult neurogenesis is regulated by endogenous factors produced during neurodegeneration. J. Pharmacol. Sci. 2011, 115, 425–432. [Google Scholar] [CrossRef] [Green Version]
- Iadecola, C.; Anrather, J. Stroke research at a crossroad: Asking the brain for directions. Nat. Neurosci. 2011, 14, 1363–1368. [Google Scholar] [CrossRef] [Green Version]
- Lyu, J.; Xie, D.; Bhatia, T.N.; Leak, R.K.; Hu, X.; Jiang, X. Microglial/Macrophage polarization and function in brain injury and repair after stroke. CNS Neurosci. Ther. 2021, 27, 515–527. [Google Scholar] [CrossRef]
- Colonna, M.; Butovsky, O. Microglia Function in the Central Nervous System During Health and Neurodegeneration. Annu. Rev. Immunol. 2017, 35, 441–468. [Google Scholar] [CrossRef]
- Guo, S.; Wang, H.; Yin, Y. Microglia Polarization from M1 to M2 in Neurodegenerative Diseases. Front. Aging Neurosci. 2022, 14, 815347. [Google Scholar] [CrossRef]
- Jiang, C.T.; Wu, W.F.; Deng, Y.H.; Ge, J.W. Modulators of microglia activation and polarization in ischemic stroke (Review). Mol. Med. Rep. 2020, 21, 2006–2018. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Xing, H.; Wan, L.; Jiang, X.; Wang, C.; Wu, Y. Treatment targets for M2 microglia polarization in ischemic stroke. Biomed. Pharmacother. 2018, 105, 518–525. [Google Scholar] [CrossRef]
- Picciano, M.F. Nutrient composition of human milk. Pediatr. Clin. N. Am. 2001, 48, 53–67. [Google Scholar] [CrossRef]
- Erney, R.M.; Malone, W.T.; Skelding, M.B.; Marcon, A.A.; Kleman-Leyer, K.M.; O’Ryan, M.L.; Ruiz-Palacios, G.; Hilty, M.D.; Pickering, L.K.; Prieto, P.A. Variability of human milk neutral oligosaccharides in a diverse population. J. Pediatr. Gastroenterol. Nutr. 2000, 30, 181–192. [Google Scholar] [CrossRef]
- Lowe, J.B. The blood group-specific human glycosyltransferases. Baillieres Clin. Haematol. 1993, 6, 465–492. [Google Scholar] [CrossRef]
- Puccio, G.; Alliet, P.; Cajozzo, C.; Janssens, E.; Corsello, G.; Sprenger, N.; Wernimont, S.; Egli, D.; Gosoniu, L.; Steenhout, P. Effects of Infant Formula with Human Milk Oligosaccharides on Growth and Morbidity: A Randomized Multicenter Trial. J. Pediatr. Gastroenterol. Nutr. 2017, 64, 624–631. [Google Scholar] [CrossRef] [Green Version]
- Elison, E.; Vigsnaes, L.K.; Krogsgaard, L.R.; Rasmussen, J.; Sørensen, N.; McConnell, B.; Hennet, T.; Sommer, M.O.; Bytzer, P. Oral supplementation of healthy adults with 2′-O-fucosyllactose and lacto-N-neotetraose is well tolerated and shifts the intestinal microbiota. Br. J. Nutr. 2016, 116, 1356–1368. [Google Scholar] [CrossRef] [Green Version]
- Vazquez, E.; Barranco, A.; Ramirez, M.; Gruart, A.; Delgado-Garcia, J.M.; Jimenez, M.L.; Buck, R.; Rueda, R. Dietary 2′-Fucosyllactose Enhances Operant Conditioning and Long-Term Potentiation via Gut-Brain Communication through the Vagus Nerve in Rodents. PLoS ONE 2016, 11, e0166070. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grabinger, T.; Garzon, J.F.G.; Hausmann, M.; Geirnaert, A.; Lacroix, C.; Hennet, T. Alleviation of Intestinal Inflammation by Oral Supplementation with 2-Fucosyllactose in Mice. Front. Microbiol. 2019, 10, 1385. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bode, L. Human milk oligosaccharides: Prebiotics and beyond. Nutr. Rev. 2009, 67 (Suppl. S2), S183–S191. [Google Scholar] [CrossRef] [PubMed]
- Newburg, D.S.; Ruiz-Palacios, G.M.; Morrow, A.L. Human milk glycans protect infants against enteric pathogens. Annu. Rev. Nutr. 2005, 25, 37–58. [Google Scholar] [CrossRef]
- Mosca, F.; Giannì, M.L. Human milk: Composition and health benefits. Pediatr. Med. Chir. 2017, 39, 155. [Google Scholar] [CrossRef] [Green Version]
- Weichert, S.; Koromyslova, A.; Singh, B.K.; Hansman, S.; Jennewein, S.; Schroten, H.; Hansman, G.S. Structural Basis for Norovirus Inhibition by Human Milk Oligosaccharides. J. Virol. 2016, 90, 4843–4848. [Google Scholar] [CrossRef] [Green Version]
- Oliveros, E.; Ramirez, M.; Vazquez, E.; Barranco, A.; Gruart, A.; Delgado-Garcia, J.M.; Buck, R.; Rueda, R.; Martin, M.J. Oral supplementation of 2′-fucosyllactose during lactation improves memory and learning in rats. J. Nutr. Biochem. 2016, 31, 20–27. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Liu, S.; Kling, D.E.; Leone, S.; Lawlor, N.T.; Huang, Y.; Feinberg, S.B.; Hill, D.R.; Newburg, D.S. The human milk oligosaccharide 2′-fucosyllactose modulates CD14 expression in human enterocytes, thereby attenuating LPS-induced inflammation. Gut 2016, 65, 33–46. [Google Scholar] [CrossRef] [Green Version]
- Longa, E.Z.; Weinstein, P.R.; Carlson, S.; Cummins, R. Reversible middle cerebral artery occlusion without craniectomy in rats. Stroke 1989, 20, 84–91. [Google Scholar] [CrossRef] [Green Version]
- Bederson, J.B.; Pitts, L.H.; Tsuji, M.; Nishimura, M.C.; Davis, R.L.; Bartkowski, H. Rat middle cerebral artery occlusion: Evaluation of the model and development of a neurologic examination. Stroke 1986, 17, 472–476. [Google Scholar] [CrossRef] [Green Version]
- Kim, Y.R.; Kim, H.N.; Ahn, S.M.; Choi, Y.H.; Shin, H.K.; Choi, B.T. Electroacupuncture promotes post-stroke functional recovery via enhancing endogenous neurogenesis in mouse focal cerebral ischemia. PLoS ONE 2014, 9, e90000. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Balkaya, M.; Krober, J.M.; Rex, A.; Endres, M. Assessing post-stroke behavior in mouse models of focal ischemia. J. Cereb. Blood Flow Metab. 2013, 33, 330–338. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; Liu, J.; Zhao, S.; Zhang, H.; Cai, W.; Cai, M.; Ji, X.; Leak, R.K.; Gao, Y.; Chen, J.; et al. Interleukin-4 Is Essential for Microglia/Macrophage M2 Polarization and Long-Term Recovery After Cerebral Ischemia. Stroke 2016, 47, 498–504. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, W.C.; Hwang, Y.S.; Chen, Y.Y.; Liu, C.L.; Shen, C.N.; Hong, W.H.; Lo, S.M.; Shen, C.R. Interleukin-4 Supports the Suppressive Immune Responses Elicited by Regulatory T Cells. Front. Immunol. 2017, 8, 1508. [Google Scholar] [CrossRef] [Green Version]
- GBD 2019 Stroke Collaborators. Global, regional, and national burden of stroke and its risk factors, 1990–2019: A systematic analysis for the Global Burden of Disease Study 2019. Lancet Neurol. 2021, 20, 795–820. [Google Scholar] [CrossRef]
- Polidori, M.C.; Cherubini, A.; Stahl, W.; Senin, U.; Sies, H.; Mecocci, P. Plasma carotenoid and malondialdehyde levels in ischemic stroke patients: Relationship to early outcome. Free Radic. Res. 2002, 36, 265–268. [Google Scholar] [CrossRef]
- McColl, B.W.; Rothwell, N.J.; Allan, S.M. Systemic inflammatory stimulus potentiates the acute phase and CXC chemokine responses to experimental stroke and exacerbates brain damage via interleukin-1- and neutrophil-dependent mechanisms. J. Neurosci. 2007, 27, 4403–4412. [Google Scholar] [CrossRef] [Green Version]
- Kawabori, M.; Yenari, M.A. Inflammatory responses in brain ischemia. Curr. Med. Chem. 2015, 22, 1258–1277. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lakhan, S.E.; Kirchgessner, A.; Hofer, M. Inflammatory mechanisms in ischemic stroke: Therapeutic approaches. J. Transl. Med. 2009, 7, 97. [Google Scholar] [CrossRef] [Green Version]
- Li, P.; Stetler, R.A.; Leak, R.K.; Shi, Y.; Li, Y.; Yu, W.; Bennett, M.V.L.; Chen, J. Oxidative stress and DNA damage after cerebral ischemia: Potential therapeutic targets to repair the genome and improve stroke recovery. Neuropharmacology 2018, 134 Pt B, 208–217. [Google Scholar] [CrossRef]
- Yong, H.Y.F.; Rawji, K.S.; Ghorbani, S.; Xue, M.; Yong, V.W. The benefits of neuroinflammation for the repair of the injured central nervous system. Cell Mol. Immunol. 2019, 16, 540–546. [Google Scholar] [CrossRef] [PubMed]
- Tobin, M.K.; Bonds, J.A.; Minshall, R.D.; Pelligrino, D.A.; Testai, F.D.; Lazarov, O. Neurogenesis and inflammation after ischemic stroke: What is known and where we go from here. J. Cereb. Blood Flow Metab. 2014, 34, 1573–1584. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Narantuya, D.; Nagai, A.; Sheikh, A.M.; Wakabayashi, K.; Shiota, Y.; Watanabe, T.; Masuda, J.; Kobayashi, S.; Kim, S.U.; Yamaguchi, S. Microglia transplantation attenuates white matter injury in rat chronic ischemia model via matrix metalloproteinase-2 inhibition. Brain Res. 2010, 1316, 145–152. [Google Scholar] [CrossRef]
- Taylor, R.A.; Sansing, L.H. Microglial responses after ischemic stroke and intracerebral hemorrhage. Clin. Dev. Immunol. 2013, 2013, 746068. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tang, Y.; Li, T.; Li, J.; Yang, J.; Liu, H.; Zhang, X.J.; Le, W. Jmjd3 is essential for the epigenetic modulation of microglia phenotypes in the immune pathogenesis of Parkinson’s disease. Cell Death Differ. 2014, 21, 369–380. [Google Scholar] [CrossRef] [Green Version]
- Hu, X.; Li, P.; Guo, Y.; Wang, H.; Leak, R.K.; Chen, S.; Gao, Y.; Chen, J. Microglia/macrophage polarization dynamics reveal novel mechanism of injury expansion after focal cerebral ischemia. Stroke 2012, 43, 3063–3070. [Google Scholar] [CrossRef] [Green Version]
- Castillo-Courtade, L.; Han, S.; Lee, S.; Mian, F.M.; Buck, R.; Forsythe, P. Attenuation of food allergy symptoms following treatment with human milk oligosaccharides in a mouse model. Allergy 2015, 70, 1091–1102. [Google Scholar] [CrossRef]
- Pak, M.E.; Kim, Y.; Park, Y.J.; Go, Y.; Shin, C.S.; Yoon, J.; Jeon, S.; Song, Y.; Kim, K. Human milk oligosaccharide, 2′-Fucosyllactose, attenuates platelet activation in arterial thrombosis. J. Funct. Foods 2022, 94, 105138–105146. [Google Scholar] [CrossRef]
- Hinchy, E.C.; Gruszczyk, A.V.; Willows, R.; Navaratnam, N.; Hall, A.R.; Bates, G.; Bright, T.P.; Krieg, T.; Carling, D.; Murphy, M.P. Mitochondria-derived ROS activate AMP-activated protein kinase (AMPK) indirectly. J. Biol. Chem. 2018, 293, 17208–17217. [Google Scholar] [CrossRef] [Green Version]
- Lan, X.; Han, X.; Li, Q.; Yang, Q.W.; Wang, J. Modulators of microglial activation and polarization after intracerebral haemorrhage. Nat. Rev. Neurol. 2017, 13, 420–433. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Franco, R.; Fernandez-Suarez, D. Alternatively activated microglia and macrophages in the central nervous system. Prog. Neurobiol. 2015, 131, 65–86. [Google Scholar] [CrossRef] [PubMed]
- Xiao, L.; van De Worp, W.R.; Stassen, R.; van Maastrigt, C.; Kettelarij, N.; Stahl, B.; Blijenberg, B.; Overbeek, S.A.; Folkerts, G.; Garssen, J.; et al. Human milk oligosaccharides promote immune tolerance via direct interactions with human dendritic cells. Eur. J. Immunol. 2019, 49, 1001–1014. [Google Scholar] [CrossRef] [Green Version]
Gene | Primer (Forward) | Primer (Reverse) | Accession No. |
---|---|---|---|
CD32 | AATCCTGCCGTTCCTACTGATC | GTGTCACCGTGTCTTCCTTGAG | BC038070 |
iNOS | CAAGCACCTTGGAAGAGGAG | AAGGCCAAACACAGCATACC | BC062378 |
CD11b | CCAAGACGATCTCAGCATCA | TTCTGGCTTGCTGAATCCTT | NM_008401.2 |
Arg1 | TCACCTGAGCTTTGATGTCG | CTGAAAGGAGCCCTGTCTTG | NM_007482.3 |
CCL-22 | CTGATGCAGGTCCCTATGGT | GCAGGATTTTGAGGTCCAGA | NM_009137.2 |
TGF-β | TGCGCTTGCAGAGATTAAAA | CGTCAAAAGACAGCCACTCA | NM_011577.2 |
GAPDH | TCAACAGCAACTCCCACTCTTCCA | ACCCTGTTGCTGTAGCCGTATTCA | GU214026.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pak, M.E.; Kim, Y.-J.; Kim, H.; Shin, C.S.; Yoon, J.-W.; Jeon, S.-m.; Song, Y.-H.; Kim, K. Anti-Neuroinflammatory Effects of the Human Milk Oligosaccharide, 2′-Fucosyllactose, Exerted via Modulation of M2 Microglial Activation in a Mouse Model of Ischemia–Reperfusion Injury. Antioxidants 2023, 12, 1281. https://doi.org/10.3390/antiox12061281
Pak ME, Kim Y-J, Kim H, Shin CS, Yoon J-W, Jeon S-m, Song Y-H, Kim K. Anti-Neuroinflammatory Effects of the Human Milk Oligosaccharide, 2′-Fucosyllactose, Exerted via Modulation of M2 Microglial Activation in a Mouse Model of Ischemia–Reperfusion Injury. Antioxidants. 2023; 12(6):1281. https://doi.org/10.3390/antiox12061281
Chicago/Turabian StylePak, Malk Eun, Yeon-Ji Kim, Hanhae Kim, Chul Soo Shin, Jong-Won Yoon, Seon-min Jeon, Young-Ha Song, and Kyungho Kim. 2023. "Anti-Neuroinflammatory Effects of the Human Milk Oligosaccharide, 2′-Fucosyllactose, Exerted via Modulation of M2 Microglial Activation in a Mouse Model of Ischemia–Reperfusion Injury" Antioxidants 12, no. 6: 1281. https://doi.org/10.3390/antiox12061281
APA StylePak, M. E., Kim, Y.-J., Kim, H., Shin, C. S., Yoon, J.-W., Jeon, S.-m., Song, Y.-H., & Kim, K. (2023). Anti-Neuroinflammatory Effects of the Human Milk Oligosaccharide, 2′-Fucosyllactose, Exerted via Modulation of M2 Microglial Activation in a Mouse Model of Ischemia–Reperfusion Injury. Antioxidants, 12(6), 1281. https://doi.org/10.3390/antiox12061281