Co-Targeting of BTK and TrxR as a Therapeutic Approach to the Treatment of Lymphoma
Abstract
1. Introduction
2. Method and Materials
2.1. Cells and Reagents
2.2. Compounds Preparation
2.3. Cell Proliferation Assay
2.4. Isobologram Analysis
2.5. TrxR Activity Assay
2.6. Caspase-3 Activity Assay
2.7. Transient Transfections
2.8. Reverse Transcriptase-Quantitative PCR (RT-qPCR)
2.9. Western Blot Analysis
2.10. Bioinformatics
2.11. Human Protein Atlas
2.12. Statistical Analysis
3. Results
3.1. The Trx System and the BCR Signalling Pathway-Related Genes Are Overexpressed in DLBLC
3.2. The Gene Expression of TrxR Is Correlated with BCR Signalling Pathway-Related Gene Expression
3.3. Knockdown of TrxR1 in Lymphoma Cells Decreased the Expression of BTK and Affected Its Downstream Signalling Pathway
3.4. [Au(d2pype)2]Cl/Ibrutinib Cotreatment Synergistically Induced Cell Death in Lymphoma Cells
3.5. Ibrutinib/[Au(d2pype)2]Cl Cotreatment Induced Cell Death via Apoptosis and Ferroptosis in Lymphoma Cells
3.6. The [Au(d2pype)2]Cl/Ibrutinib Treatment Decreased the Total Expression of BTK in Non-Hodgkin’s Lymphoma Cell Lines
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Goparaju, K.; Caimi, P.F. Loncastuximab tesirine for treatment of relapsed or refractory diffuse large B cell lymphoma. Expert Opin. Biol. Ther. 2021, 21, 1373–1381. [Google Scholar] [CrossRef] [PubMed]
- He, M.Y.; Kridel, R. Treatment resistance in diffuse large B-cell lymphoma. Leukemia 2021, 35, 2151–2165. [Google Scholar] [CrossRef] [PubMed]
- Ichikawa, A.; Miyoshi, H.; Yamauchi, T.; Arakawa, F.; Kawano, R.; Muta, H.; Sugita, Y.; Akashi, K.; Ohshima, K. Composite lymphoma of peripheral T-cell lymphoma and Hodgkin lymphoma, mixed cellularity type; pathological and molecular analysis. Pathol. Int. 2017, 67, 194–201. [Google Scholar] [CrossRef] [PubMed]
- Tse, E.; Au-Yeung, R.; Chau, D.; Hwang, Y.-Y.; Loong, F.; Kwong, Y.-L. Epstein-Barr virus–positive diffuse large B-cell lymphoma after frontline brentuximab vedotin treatment of classical Hodgkin lymphoma. Ann. Hematol. 2022, 101, 1149–1152. [Google Scholar] [CrossRef]
- Armitage, J.O.; Gascoyne, R.D.; Lunning, M.A.; Cavalli, F. Non-hodgkin lymphoma. Lancet 2017, 390, 298–310. [Google Scholar] [CrossRef] [PubMed]
- Blenk, S.; Engelmann, J.C.; Weniger, M.; Schultz, J.; Dittrich, M.; Rosenwald, A.; Müller-Hermelink, H.; Müller, T.; Dandekar, T. Germinal Center B Cell-Like (GCB) and Activated B Cell-Like (ABC) Type of Diffuse Large B Cell Lymphoma (DLBCL): Analysis of Molecular Predictors, Signatures, Cell Cycle State and Patient Survival. Cancer Inform. 2007, 3, 399–420. [Google Scholar] [CrossRef]
- Painschab, M.S.; Kohler, R.; Kimani, S.; Mhango, W.; Kaimila, B.; Zuze, T.; Mithi, V.; Kasonkanji, E.; Mumba, N.; Nyasosela, R.; et al. Comparison of best supportive care, CHOP, or R-CHOP for treatment of diffuse large B-cell lymphoma in Malawi: A cost-effectiveness analysis. Lancet Glob. Health 2021, 9, e1305–e1313. [Google Scholar] [CrossRef]
- Anastasiadou, E.; Seto, A.G.; Beatty, X.; Hermreck, M.; Gilles, M.-E.; Stroopinsky, D.; Pinter-Brown, L.C.; Pestano, L.; Marchese, C.; Avigan, D.; et al. Cobomarsen, an Oligonucleotide Inhibitor of miR-155, Slows DLBCL Tumor Cell Growth In Vitro and In Vivo. Clin. Cancer Res. 2021, 27, 1139–1149. [Google Scholar] [CrossRef]
- Hara, T.; Yoshikawa, T.; Goto, H.; Sawada, M.; Yamada, T.; Fukuno, K.; Kasahara, S.; Shibata, Y.; Matsumoto, T.; Mabuchi, R.; et al. R-THP-COP versus R-CHOP in patients younger than 70 years with untreated diffuse large B cell lymphoma: A randomized, open-label, noninferiority phase 3 trial. Hematol. Oncol. 2018, 36, 638–644. [Google Scholar] [CrossRef]
- Küppers, R. Mechanisms of B-cell lymphoma pathogenesis. Nat. Rev. Cancer 2005, 5, 251–262. [Google Scholar] [CrossRef]
- Tanaka, S.; Baba, Y. Baba, Y. B Cell Receptor Signaling. In B Cells in Immunity and Tolerance; Wang, J.-Y., Ed.; Springer: Singapore, 2020; Volume 1254, pp. 23–36. [Google Scholar] [CrossRef]
- Xue, C.; Wang, X.; Zhang, L.; Qu, Q.; Zhang, Q.; Jiang, Y. Ibrutinib in B-cell lymphoma: Single fighter might be enough? Cancer Cell Int. 2020, 20, 467. [Google Scholar] [CrossRef] [PubMed]
- Efremov, D.G.; Turkalj, S.; Laurenti, L. Mechanisms of B Cell Receptor Activation and Responses to B Cell Receptor Inhibitors in B Cell Malignancies. Cancers 2020, 12, 1396. [Google Scholar] [CrossRef]
- Xu, W.; Berning, P.; Lenz, G. Targeting B-cell receptor and PI3K signaling in diffuse large B-cell lymphoma. Blood 2021, 138, 1110–1119. [Google Scholar] [CrossRef]
- Pontoriero, M.; Fiume, G.; Vecchio, E.; de Laurentiis, A.; Albano, F.; Iaccino, E.; Mimmi, S.; Pisano, A.; Agosti, V.; Giovannone, E.; et al. Activation of NF-κB in B cell receptor signaling through Bruton’s tyrosine kinase-dependent phosphorylation of IκB-α. J. Mol. Med. 2019, 97, 675–690. [Google Scholar] [CrossRef] [PubMed]
- Shukla, A.; Rai, K.; Shukla, V.; Chaturvedi, N.K.; Bociek, R.G.; Pirruccello, S.J.; Band, H.; Lu, R.; Joshi, S.S. Sprouty 2: A novel attenuator of B-cell receptor and MAPK-Erk signaling in CLL. Blood 2016, 127, 2310–2321. [Google Scholar] [CrossRef] [PubMed]
- Longo, P.G.; Laurenti, L.; Gobessi, S.; Sica, S.; Leone, G.; Efremov, D. The Akt/Mcl-1 pathway plays a prominent role in mediating antiapoptotic signals downstream of the B-cell receptor in chronic lymphocytic leukemia B cells. Blood 2008, 111, 846–855. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, A.J.; Yu, L.; Bäckesjö, C.-M.; Vargas, L.; Faryal, R.; Aints, A.; Christensson, B.; Berglöf, A.; Vihinen, M.; Nore, B.F.; et al. Bruton’s tyrosine kinase (Btk): Function, regulation, and transformation with special emphasis on the PH domain. Immunol. Rev. 2009, 228, 58–73. [Google Scholar] [CrossRef] [PubMed]
- Cameron, F.; Sanford, M. Ibrutinib: First Global Approval. Drugs 2014, 74, 263–271. [Google Scholar] [CrossRef]
- Dubovsky, J.A.; Beckwith, K.A.; Woyach, J.A.; Jaglowski, S.M.; Hessler, J.; Chang, B.Y.; Larkin, K.; Stefanovski, M.R.; Frissora, F.W.; Smith, L.L.; et al. Ibrutinib Is an Irreversible Molecular Inhibitor of Interleukin-2 Inducible Kinase: Expanding Therapeutic Potential and Modulating a Th1 Selective Pressure in CD4 T-Cells. Blood 2012, 120, 775. [Google Scholar] [CrossRef]
- McMullen, J.R.; Boey, E.J.H.; Ooi, J.; Seymour, J.F.; Keating, M.J.; Tam, C.S. Ibrutinib increases the risk of atrial fibrillation, potentially through inhibition of cardiac PI3K-Akt signaling. Blood 2014, 124, 3829–3830. [Google Scholar] [CrossRef]
- Paydas, S. Management of adverse effects/toxicity of ibrutinib. Crit. Rev. Oncol. Hematol. 2019, 136, 56–63. [Google Scholar] [CrossRef]
- Holmgren, A.; Lu, J. Thioredoxin and thioredoxin reductase: Current research with special reference to human disease. Biochem. Biophys. Res. Commun. 2010, 396, 120–124. [Google Scholar] [CrossRef] [PubMed]
- Matsuzawa, A. Thioredoxin and redox signaling: Roles of the thioredoxin system in control of cell fate. Arch. Biochem. Biophys. 2017, 617, 101–105. [Google Scholar] [CrossRef] [PubMed]
- Muri, J.; Thut, H.; Feng, Q.; Kopf, M. Thioredoxin-1 distinctly promotes NF-κB target DNA binding and NLRP3 inflammasome activation independently of Txnip. eLife 2020, 9, e53627. [Google Scholar] [CrossRef]
- Wang, S.; Di Trapani, G.; Tonissen, K.F. Expanding the armory for treating lymphoma: Targeting redox cellular status through thioredoxin reductase inhibition. Pharmacol. Res. 2022, 177, 106134. [Google Scholar] [CrossRef] [PubMed]
- Okamoto, T.; Sanda, T.; Asamitsu, K. NF-κB Signaling and Carcinogenesis. Curr. Pharm. Des. 2007, 13, 447–462. [Google Scholar] [CrossRef] [PubMed]
- Stafford, W.C.; Peng, X.; Olofsson, M.H.; Zhang, X.; Luci, D.K.; Lu, L.; Cheng, Q.; Trésaugues, L.; Dexheimer, T.S.; Coussens, N.P.; et al. Irreversible inhibition of cytosolic thioredoxin reductase 1 as a mechanistic basis for anticancer therapy. Sci. Transl. Med. 2018, 10, eaaf7444. [Google Scholar] [CrossRef]
- Sze, J.H.; Raninga, P.V.; Nakamura, K.; Casey, M.; Khanna, K.K.; Berners-Price, S.J.; Di Trapani, G.; Tonissen, K.F. Anticancer activity of a Gold(I) phosphine thioredoxin reductase inhibitor in multiple myeloma. Redox Biol. 2020, 28, 101310. [Google Scholar] [CrossRef]
- Arnér, E.S. Perspectives of TrxR1-based cancer therapies. In Oxidative Stress; Sies, H., Ed.; Academic Press: Cambridge, MA, USA, 2020; pp. 639–667. [Google Scholar] [CrossRef]
- Zhang, X.; Selvaraju, K.; Saei, A.A.; D’Arcy, P.; Zubarev, R.A.; Arnér, E.S.; Linder, S. Repurposing of auranofin: Thioredoxin reductase remains a primary target of the drug. Biochimie 2019, 162, 46–54. [Google Scholar] [CrossRef]
- Saei, A.A.; Gullberg, H.; Sabatier, P.; Beusch, C.M.; Johansson, K.; Lundgren, B.; Arvidsson, P.I.; Arnér, E.S.; Zubarev, R.A. Comprehensive chemical proteomics for target deconvolution of the redox active drug auranofin. Redox Biol. 2020, 32, 101491. [Google Scholar] [CrossRef]
- Berners-Price, S.J.; Filipovska, A. Gold compounds as therapeutic agents for human diseases. Metallomics 2011, 3, 863–873. [Google Scholar] [CrossRef]
- Rackham, O.; Shearwood, A.-M.J.; Thyer, R.; McNamara, E.; Davies, S.M.; Callus, B.A.; Miranda-Vizuete, A.; Berners-Price, S.J.; Cheng, Q.; Arnér, E.S.; et al. Substrate and inhibitor specificities differ between human cytosolic and mitochondrial thioredoxin reductases: Implications for development of specific inhibitors. Free Radic. Biol. Med. 2011, 50, 689–699. [Google Scholar] [CrossRef]
- Wang, S.; Lu, Y.; Woods, K.; Di Trapani, G.; Tonissen, K.F. Investigating the Thioredoxin and Glutathione Systems’ Response in Lymphoma Cells after Treatment with [Au(d2pype)2]CL. Antioxidants 2021, 10, 104. [Google Scholar] [CrossRef]
- Clapper, E.; Wang, S.; Raninga, P.V.; Di Trapani, G.; Tonissen, K.F. Cross-talk between Bcr-abl and the Thioredoxin System in Chronic Myeloid Leukaemia: Implications for CML Treatment. Antioxidants 2020, 9, 207. [Google Scholar] [CrossRef]
- Berners-Price, S.J.; Bowen, R.J.; Hambley, T.W.; Healy, P.C. NMR and structural studies of gold(I) chloride adducts with bidentate 2-, 3- and 4-pyridyl phosphines. J. Chem. Soc. Dalton Trans. 1999, 8, 1337–1346. [Google Scholar] [CrossRef]
- Hall, M.J.; Middleton, R.F.; Westmacott, D. The fractional inhibitory concentration (FIC) index as a measure of synergy. J. Antimicrob. Chemother. 1983, 11, 427–433. [Google Scholar] [CrossRef]
- Nair, H.B.; Sung, B.; Yadav, V.R.; Kannappan, R.; Chaturvedi, M.M.; Aggarwal, B.B. Delivery of antiinflammatory nutraceuticals by nanoparticles for the prevention and treatment of cancer. Biochem. Pharmacol. 2010, 80, 1833–1843. [Google Scholar] [CrossRef] [PubMed]
- Lafleur, M.A.; Drew, A.F.; de Sousa, E.L.; Blick, T.; Bills, M.; Walker, E.C.; Williams, E.D.; Waltham, M.; Thompson, E.W. Upregulation of matrix metalloproteinases (MMPs) in breast cancer xenografts: A major induction of stromal MMP-13. Int. J. Cancer 2005, 114, 544–554. [Google Scholar] [CrossRef]
- Uhlén, M.; Fagerberg, L.; Hallström, B.M.; Lindskog, C.; Oksvold, P.; Mardinoglu, A.; Sivertsson, Å.; Kampf, C.; Sjöstedt, E.; Asplund, A.; et al. Proteomics. Tissue-Based Map of the Human Proteome. Science 2015, 347, 1260419. [Google Scholar] [CrossRef] [PubMed]
- Madrigal-Matute, J.; Fernandez-Garcia, C.-E.; Blanco-Colio, L.M.; Burillo, E.; Fortuño, A.; Martinez-Pinna, R.; Llamas-Granda, P.; Beloqui, O.; Egido, J.; Zalba, G.; et al. Thioredoxin-1/peroxiredoxin-1 as sensors of oxidative stress mediated by NADPH oxidase activity in atherosclerosis. Free Radic. Biol. Med. 2015, 86, 352–361. [Google Scholar] [CrossRef] [PubMed]
- Lee, D.H.; Kim, G.W.; Kwon, S.H. The HDAC6-selective inhibitor is effective against non-Hodgkin lymphoma and synergizes with ibrutinib in follicular lymphoma. Mol. Carcinog. 2019, 58, 944–956. [Google Scholar] [CrossRef] [PubMed]
- Kuo, H.-P.; Ezell, S.A.; Schweighofer, K.J.; Cheung, L.W.; Hsieh, S.; Apatira, M.; Sirisawad, M.; Eckert, K.; Hsu, S.J.; Chen, C.-T.; et al. Combination of Ibrutinib and ABT-199 in Diffuse Large B-Cell Lymphoma and Follicular Lymphoma. Mol. Cancer Ther. 2017, 16, 1246–1256. [Google Scholar] [CrossRef]
- Ding, N.; Li, X.; Shi, Y.; Ping, L.; Wu, L.; Fu, K.; Feng, L.; Zheng, X.; Song, Y.; Pan, Z.; et al. Irreversible dual inhibitory mode: The novel Btk inhibitor PLS-123 demonstrates promising anti-tumor activity in human B-cell lymphoma. Oncotarget 2015, 6, 15122–15136. [Google Scholar] [CrossRef]
- Tang, D.; Chen, X.; Kang, R.; Kroemer, G. Ferroptosis: Molecular mechanisms and health implications. Cell Res. 2021, 31, 107–125. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Wang, H.; Yang, X.; Wu, Q.; An, P.; Jin, X.; Liu, W.; Huang, X.; Li, Y.; Yan, S.; et al. Auranofin mitigates systemic iron overload and induces ferroptosis via distinct mechanisms. Signal Transduct. Target. Ther. 2020, 5, 138. [Google Scholar] [CrossRef] [PubMed]
- Boullosa, L.F.; Van Loenhout, J.; Flieswasser, T.; De Waele, J.; Hermans, C.; Lambrechts, H.; Cuypers, B.; Laukens, K.; Bartholomeus, E.; Siozopoulou, V.; et al. Auranofin reveals therapeutic anticancer potential by triggering distinct molecular cell death mechanisms and innate immunity in mutant p53 non-small cell lung cancer. Redox Biol. 2021, 42, 101949. [Google Scholar] [CrossRef] [PubMed]
- Gilmore, T.D. Introduction to NF-κB: Players, pathways, perspectives. Oncogene 2006, 25, 6680–6684. [Google Scholar] [CrossRef]
- Vandromme, M.; Gauthier-Rouvière, C.; Lamb, N.; Fernandez, A. Regulation of transcription factor localization: Fine-tuning of gene expression. Trends Biochem. Sci. 1996, 21, 59–64. [Google Scholar] [CrossRef]
- Wang, K.; Jiang, J.; Lei, Y.; Zhou, S.; Wei, Y.; Huang, C. Targeting Metabolic–Redox Circuits for Cancer Therapy. Trends Biochem. Sci. 2019, 44, 401–414. [Google Scholar] [CrossRef]
- Chen, A.C.-H.; Arany, P.; Huang, Y.; Tomkinson, E.M.; Sharma, S.K.; Kharkwal, G.B.; Saleem, T.; Mooney, D.; Yull, F.; Blackwell, T.S.; et al. Low-Level Laser Therapy Activates NF-κB via Generation of Reactive Oxygen Species in Mouse Embryonic Fibroblasts. PLoS ONE 2011, 6, e22453. [Google Scholar] [CrossRef]
- Nogueira, V.; Hay, N. Molecular Pathways: Reactive Oxygen Species Homeostasis in Cancer Cells and Implications for Cancer Therapy. Clin. Cancer Res. 2013, 19, 4309–4314. [Google Scholar] [CrossRef] [PubMed]
- Purohit, V.; Simeone, D.M.; Lyssiotis, C.A. Metabolic Regulation of Redox Balance in Cancer. Cancers 2019, 11, 955. [Google Scholar] [CrossRef] [PubMed]
- Panieri, E.; Santoro, M.M. ROS homeostasis and metabolism: A dangerous liason in cancer cells. Cell Death Dis. 2016, 7, e2253. [Google Scholar] [CrossRef] [PubMed]
- Wilson, W.H.; Young, R.M.; Schmitz, R.; Yang, Y.; Pittaluga, S.; Wright, G.; Lih, C.-J.; Williams, P.M.; Shaffer, A.L.; Gerecitano, J.; et al. Targeting B cell receptor signaling with ibrutinib in diffuse large B cell lymphoma. Nat. Med. 2015, 21, 922–926. [Google Scholar] [CrossRef]
- Hamadani, M.; Balasubramanian, S.; Hari, P.N. Ibrutinib in Refractory Classic Hodgkin’s Lymphoma. N. Engl. J. Med. 2015, 373, 1381–1382. [Google Scholar] [CrossRef]
- Jin, J.; Wang, L.; Tao, Z.; Zhang, J.; Lv, F.; Cao, J.; Hu, X. PDGFD induces ibrutinib resistance of diffuse large B-cell lymphoma through activation of EGFR. Mol. Med. Rep. 2020, 21, 2209–2219. [Google Scholar] [CrossRef]
- Jacobson, C.; Kopp, N.; Layer, J.V.; Redd, R.A.; Tschuri, S.; Haebe, S.; Van Bodegom, D.; Bird, L.; Christie, A.L.; Christodoulou, A.; et al. HSP90 inhibition overcomes ibrutinib resistance in mantle cell lymphoma. Blood 2016, 128, 2517–2526. [Google Scholar] [CrossRef]
- Chiron, D.; Di Liberto, M.; Martin, P.; Huang, X.; Sharman, J.; Blecua, P.; Mathew, S.; Vijay, P.; Eng, K.; Ali, S.; et al. Cell-Cycle Reprogramming for PI3K Inhibition Overrides a Relapse-Specific C481S BTK Mutation Revealed by Longitudinal Functional Genomics in Mantle Cell Lymphoma. Cancer Discov. 2014, 4, 1022–1035. [Google Scholar] [CrossRef]
- Liu, Y.; Barta, S.K. Diffuse large B-cell lymphoma: 2019 update on diagnosis, risk stratification, and treatment. Am. J. Hematol. 2019, 94, 604–616. [Google Scholar] [CrossRef]
- Piechotta, V.; Jakob, T.; Langer, P.; Monsef, I.; Scheid, C.; Estcourt, L.J.; Ocheni, S.; Theurich, S.; Kuhr, K.; Scheckel, B.; et al. Multiple drug combinations of bortezomib, lenalidomide, and thalidomide for first-line treatment in adults with transplant-ineligible multiple myeloma: A network meta-analysis. Cochrane Database Syst. Rev. 2019, 11, CD013487. [Google Scholar] [CrossRef]
- Hu, J.; Zhang, H.; Cao, M.; Wang, L.; Wu, S.; Fang, B. Auranofin Enhances Ibrutinib’s Anticancer Activity in EGFR-Mutant Lung Adenocarcinoma. Mol. Cancer Ther. 2018, 17, 2156–2163. [Google Scholar] [CrossRef] [PubMed]
- Joo, M.-K.; Shin, S.; Ye, D.-J.; An, H.-G.; Kwon, T.-U.; Baek, H.-S.; Kwon, Y.-J.; Chun, Y.-J. Combined treatment with auranofin and trametinib induces synergistic apoptosis in breast cancer cells. J. Toxicol. Environ. Health Part A 2021, 84, 84–94. [Google Scholar] [CrossRef] [PubMed]
- Myers, C.R. Enhanced targeting of mitochondrial peroxide defense by the combined use of thiosemicarbazones and inhibitors of thioredoxin reductase. Free Radic. Biol. Med. 2016, 91, 81–92. [Google Scholar] [CrossRef] [PubMed]
- Tsubata, T. Involvement of Reactive Oxygen Species (ROS) in BCR Signaling as a Second Messenger. B Cells Immun. Toler. 2020, 1254, 37–46. [Google Scholar] [CrossRef]
- Cancer Council Australia. Non-Hodgkin Lymphoma. 2023. Available online: https://www.cancer.org.au/cancer-information/types-of-cancer/non-hodgkin-lymphoma (accessed on 3 February 2023).
- Kotla, S.; Singh, N.K.; Rao, G.N. ROS via BTK-p300-STAT1-PPARγ signaling activation mediates cholesterol crystals-induced CD36 expression and foam cell formation. Redox Biol. 2017, 11, 350–364. [Google Scholar] [CrossRef] [PubMed]
- Weber, T.; Schmitz, R. Molecular Subgroups of Diffuse Large B Cell Lymphoma: Biology and Implications for Clinical Practice. Curr. Oncol. Rep. 2022, 24, 13–21. [Google Scholar] [CrossRef]
- Mai, Y.; Yu, J.J.; Bartholdy, B.; Xu-Monette, Z.Y.; Knapp, E.E.; Yuan, F.; Chen, H.; Ding, B.B.; Yao, Z.; Das, B.; et al. An oxidative stress-based mechanism of doxorubicin cytotoxicity suggests new therapeutic strategies in ABC-DLBCL. Blood 2016, 128, 2797–2807. [Google Scholar] [CrossRef]
- Frick, M.; Dörken, B.; Lenz, G. The molecular biology of diffuse large B-cell lymphoma. Ther. Adv. Hematol. 2011, 2, 369–379. [Google Scholar] [CrossRef] [PubMed]
- Susanibar-Adaniya, S.; Barta, S.K. 2021 Update on Diffuse large B cell lymphoma: A review of current data and potential applications on risk stratification and management. Am. J. Hematol. 2021, 96, 617–629. [Google Scholar] [CrossRef]
- Dixon, S.J.; Lemberg, K.M.; Lamprecht, M.R.; Skouta, R.; Zaitsev, E.M.; Gleason, C.E.; Patel, D.N.; Bauer, A.J.; Cantley, A.M.; Yang, W.S.; et al. Ferroptosis: An Iron-Dependent Form of Nonapoptotic Cell Death. Cell 2012, 149, 1060–1072. [Google Scholar] [CrossRef]
- Chen, X.; Li, J.; Kang, R.; Klionsky, D.J.; Tang, D. Ferroptosis: Machinery and regulation. Autophagy 2021, 17, 2054–2081. [Google Scholar] [CrossRef] [PubMed]
- Wen, Y.; Chen, H.; Zhang, L.; Wu, M.; Zhang, F.; Yang, D.; Shen, J.; Chen, J. Glycyrrhetinic acid induces oxidative/nitrative stress and drives ferroptosis through activating NADPH oxidases and iNOS, and depriving glutathione in triple-negative breast cancer cells. Free Radic. Biol. Med. 2021, 173, 41–51. [Google Scholar] [CrossRef] [PubMed]
- Angeli, J.P.F.; Shah, R.; Pratt, D.A.; Conrad, M. Ferroptosis Inhibition: Mechanisms and Opportunities. Trends Pharmacol. Sci. 2017, 38, 489–498. [Google Scholar] [CrossRef]
- Das, K.C.; Muniyappa, H.; Kundumani-Sridharan, V.; Subramani, J. Thioredoxin Decreases Anthracycline Cardiotoxicity, But Sensitizes Cancer Cell Apoptosis. Cardiovasc. Toxicol. 2021, 21, 142–151. [Google Scholar] [CrossRef] [PubMed]
- Naveenkumar, S.K.; Hemshekhar, M.; Jagadish, S.; Manikanta, K.; Vishalakshi, G.J.; Kemparaju, K.; Girish, K.S. Melatonin restores neutrophil functions and prevents apoptosis amid dysfunctional glutathione redox system. J. Pineal Res. 2020, 69, e12676. [Google Scholar] [CrossRef]
- Sun, Y.; Zheng, Y.; Wang, C.; Liu, Y. Glutathione depletion induces ferroptosis, autophagy, and premature cell senescence in retinal pigment epithelial cells. Cell Death Dis. 2018, 9, 753. [Google Scholar] [CrossRef]
- Li, J.; Cao, F.; Yin, H.; Huang, Z.; Lin, Z.; Mao, N.; Sun, B.; Wang, G. Ferroptosis: Past, present and future. Cell Death Dis. 2020, 11, 88. [Google Scholar] [CrossRef]
- Mou, Y.; Wang, J.; Wu, J.; He, D.; Zhang, C.; Duan, C.; Li, B. Ferroptosis, a new form of cell death: Opportunities and challenges in cancer. J. Hematol. Oncol. 2019, 12, 34. [Google Scholar] [CrossRef]
- Ramadass, V.; Vaiyapuri, T.; Tergaonkar, V. Small Molecule NF-κB Pathway Inhibitors in Clinic. Int. J. Mol. Sci. 2020, 21, 5164. [Google Scholar] [CrossRef]
- Raninga, P.V.; Di Trapani, G.; Vuckovic, S.; Tonissen, K.F. TrxR1 inhibition overcomes both hypoxia-induced and acquired bortezomib resistance in multiple myeloma through NF-κβ inhibition. Cell Cycle 2016, 15, 559–572. [Google Scholar] [CrossRef]
- Kelleher, Z.T.; Sha, Y.; Foster, M.W.; Foster, W.M.; Forrester, M.T.; Marshall, H.E. Thioredoxin-mediated Denitrosylation Regulates Cytokine-induced Nuclear Factor κB (NF-κB) Activation. J. Biol. Chem. 2014, 289, 3066–3072. [Google Scholar] [CrossRef] [PubMed]
- Butturini, E.; De Prati, A.C.; Mariotto, S. Redox Regulation of STAT1 and STAT3 Signaling. Int. J. Mol. Sci. 2020, 21, 7034. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.; Mohamed, A.J.; Simonson, O.E.; Vargas, L.; Blomberg, K.E.M.; Björkstrand, B.; Arteaga, H.J.; Nore, B.F.; Smith, C.I.E. Proteasome-dependent autoregulation of Bruton tyrosine kinase (Btk) promoter via NF-κB. Blood 2008, 111, 4617–4626. [Google Scholar] [CrossRef] [PubMed]






| Protein Name | Gene Name | * Accession Number | Forward | Reverse |
|---|---|---|---|---|
| L32 | RPL32 | NC_000003.12 | 5′CAGGGTTCGTAGAAGATTCAAGGG3′ | 5′CTTGGAGGAAAACATTGTGAGCGATC3′ |
| TrxR1 | TXNRD1 | NC_000012.12 | 5′GGAATCCACCCTGTCTCTGC3′ | 5′ACGAGCCAGTGGTTTGCAGT3′ |
| BTK | BTK | NC_000023.11 | 5′CTGAAGAACTAAGGAAGCGGTGGATT3′ | 5′ACTTGTGGAGACTGGTGCTGCT3′ |
| P65 | RelA | NC_000011.10 | 5′ATATGAGACCTTCAAGAGCATCA3′ | 5′ATAGTTGATGGTGCTCAGGGATGA3′ |
| Survivin | Survivin | NC_000011.10 | 5′ACCACCGCATCTCTACATTCAAGAACT3′ | 5′TCCCAGCCTTCCAGCTCCTT3′ |
| Normal Lymph Node | NHL | |
|---|---|---|
| TrxR (CAB015834) | Low | High |
| BTK (HPA001198) | Medium | High |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, S.; Clapper, E.; Tonissen, K.F.; Di Trapani, G. Co-Targeting of BTK and TrxR as a Therapeutic Approach to the Treatment of Lymphoma. Antioxidants 2023, 12, 529. https://doi.org/10.3390/antiox12020529
Wang S, Clapper E, Tonissen KF, Di Trapani G. Co-Targeting of BTK and TrxR as a Therapeutic Approach to the Treatment of Lymphoma. Antioxidants. 2023; 12(2):529. https://doi.org/10.3390/antiox12020529
Chicago/Turabian StyleWang, Sicong, Erin Clapper, Kathryn F. Tonissen, and Giovanna Di Trapani. 2023. "Co-Targeting of BTK and TrxR as a Therapeutic Approach to the Treatment of Lymphoma" Antioxidants 12, no. 2: 529. https://doi.org/10.3390/antiox12020529
APA StyleWang, S., Clapper, E., Tonissen, K. F., & Di Trapani, G. (2023). Co-Targeting of BTK and TrxR as a Therapeutic Approach to the Treatment of Lymphoma. Antioxidants, 12(2), 529. https://doi.org/10.3390/antiox12020529

