Glucotropaeolin Promotes Apoptosis by Calcium Dysregulation and Attenuates Cell Migration with FOXM1 Suppression in Pancreatic Cancer Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Chemicals
2.3. Spheroids Analysis
2.4. Cell Viability
2.5. Immunoblotting Analysis
2.6. Reactive Oxygen Species (ROS) Production Analysis
2.7. Analysis of Mitochondrial Membrane Potential
2.8. Annexin V and Propidium Iodide (PI) Staining
2.9. Mitochondrial and Intracellular Ca2+ Analysis
2.10. Quantitative PCR (qPCR)
2.11. Migration Assay
2.12. Invasion Assay
2.13. Small Interference RNA (siRNA) Transfection
2.14. Statistics
3. Results
3.1. GT Suppresses Cell Proliferation and Elevates ROS Production in PDAC Cells
3.2. GT Provokes the Induction of Apoptosis and Lowers Mitochondrial Membrane Potential (MMP) in PDAC Cells
3.3. GT Induces Mitochondrial Dysfunction via Calcium Dysregulation in PDAC Cells
3.4. Anticancer Signaling Pathways Induced by GT in PDAC Cells
3.5. GT Weakens Cell Invasiveness in PDAC Cells
3.6. Efficacy of GT Is Strengthened by FOXM1 Silencing via Calcium Dysregulation in PDAC Cells
3.7. Migratory Ability Is Attenuated by FOXM1 Silencing in PDAC Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Fuchs, H.E.; Jemal, A. Cancer statistics, 2022. CA Cancer J. Clin. 2022, 72, 7–33. [Google Scholar] [PubMed]
- Kamisawa, T.; Wood, L.D.; Itoi, T.; Takaori, K. Pancreatic cancer. Lancet 2016, 388, 73–85. [Google Scholar] [CrossRef] [PubMed]
- Elsayed, M.; Abdelrahim, M. The Latest Advancement in Pancreatic Ductal Adenocarcinoma Therapy: A Review Article for the Latest Guidelines and Novel Therapies. Biomedicines 2021, 9, 389. [Google Scholar] [CrossRef] [PubMed]
- Urbanova, M.; Buocikova, V.; Trnkova, L.; Strapcova, S.; Kajabova, V.H.; Melian, E.B.; Novisedlakova, M.; Tomas, M.; Dubovan, P.; Earl, J.; et al. DNA Methylation Mediates EMT Gene Expression in Human Pancreatic Ductal Adenocarcinoma Cell Lines. Int. J. Mol. Sci. 2022, 23, 2117. [Google Scholar] [CrossRef]
- Zeppa, L.; Aguzzi, C.; Versari, G.; Luongo, M.; Morelli, M.B.; Maggi, F.; Amantini, C.; Santoni, G.; Marinelli, O.; Nabissi, M. Evening Primrose Oil Improves Chemotherapeutic Effects in Human Pancreatic Ductal Adenocarcinoma Cell Lines-A Preclinical Study. Pharmaceuticals 2022, 15, 466. [Google Scholar] [CrossRef]
- Reni, M.; Zanon, S.; Peretti, U.; Chiaravalli, M.; Barone, D.; Pircher, C.; Balzano, G.; Macchini, M.; Romi, S.; Gritti, E.; et al. Nab-paclitaxel plus gemcitabine with or without capecitabine and cisplatin in metastatic pancreatic adenocarcinoma (PACT-19): A randomised phase 2 trial. Lancet Gastroenterol. Hepatol. 2018, 3, 691–697. [Google Scholar]
- Ducreux, M.; Seufferlein, T.; Van Laethem, J.L.; Laurent-Puig, P.; Smolenschi, C.; Malka, D.; Boige, V.; Hollebecque, A.; Conroy, T. Systemic treatment of pancreatic cancer revisited. Semin. Oncol. 2019, 46, 28–38. [Google Scholar] [CrossRef] [PubMed]
- Blazevic, I.; Dulovic, A.; Cikes Culic, V.; Burcul, F.; Ljubenkov, I.; Ruscic, M.; Generalic Mekinic, I. Bunias erucago L.: Glucosinolate Profile and In Vitro Biological Potential. Molecules 2019, 24, 741. [Google Scholar] [CrossRef]
- Miyoshi, N.; Takabayashi, S.; Osawa, T.; Nakamura, Y. Benzyl isothiocyanate inhibits excessive superoxide generation in inflammatory leukocytes: Implication for prevention against inflammation-related carcinogenesis. Carcinogenesis 2004, 25, 567–575. [Google Scholar] [CrossRef]
- Huang, C.S.; Lin, A.H.; Liu, C.T.; Tsai, C.W.; Chang, I.S.; Chen, H.W.; Lii, C.K. Isothiocyanates protect against oxidized LDL-induced endothelial dysfunction by upregulating Nrf2-dependent antioxidation and suppressing NFkappaB activation. Mol. Nutr. Food Res. 2013, 57, 1918–1930. [Google Scholar]
- Boreddy, S.R.; Sahu, R.P.; Srivastava, S.K. Benzyl isothiocyanate suppresses pancreatic tumor angiogenesis and invasion by inhibiting HIF-alpha/VEGF/Rho-GTPases: Pivotal role of STAT-3. PLoS ONE 2011, 6, e25799. [Google Scholar] [CrossRef] [PubMed]
- Lin, J.F.; Tsai, T.F.; Lin, Y.C.; Chen, H.E.; Chou, K.Y.; Hwang, T.I. Benzyl isothiocyanate suppresses IGF1R, FGFR3 and mTOR expression by upregulation of miR-99a-5p in human bladder cancer cells. Int. J. Oncol. 2019, 54, 2106–2116. [Google Scholar] [CrossRef] [PubMed]
- Xiao, D.; Bommareddy, A.; Kim, S.H.; Sehrawat, A.; Hahm, E.R.; Singh, S.V. Benzyl isothiocyanate causes FoxO1-mediated autophagic death in human breast cancer cells. PLoS ONE 2012, 7, e32597. [Google Scholar]
- Huang, Y.P.; Jiang, Y.W.; Chen, H.Y.; Hsiao, Y.T.; Peng, S.F.; Chou, Y.C.; Yang, J.L.; Hsia, T.C.; Chung, J.G. Benzyl Isothiocyanate Induces Apoptotic Cell Death Through Mitochondria-dependent Pathway in Gefitinib-resistant NCI-H460 Human Lung Cancer Cells In Vitro. Anticancer. Res. 2018, 38, 5165–5176. [Google Scholar] [CrossRef]
- Kasiappan, R.; Jutooru, I.; Karki, K.; Hedrick, E.; Safe, S. Benzyl Isothiocyanate (BITC) Induces Reactive Oxygen Species-dependent Repression of STAT3 Protein by Down-regulation of Specificity Proteins in Pancreatic Cancer. J. Biol. Chem. 2016, 291, 27122–27133. [Google Scholar] [CrossRef]
- Lenzi, R.M.; Campestrini, L.H.; Semprebon, S.C.; Paschoal, J.A.R.; Silva, M.A.G.; Zawadzki-Baggio, S.F.; Mantovani, M.S.; Petkowicz, C.L.O.; Maurer, J.B.B. Glucosinolate-Enriched Fractions from Maca (Lepidium meyenii) Exert Myrosinase-Dependent Cytotoxic Effects against HepG2/C3A and HT29 Tumor Cell Lines. Nutr. Cancer 2022, 74, 1322–1337. [Google Scholar] [CrossRef]
- Kolodziejski, D.; Koss-Mikolajczyk, I.; Glatt, H.; Bartoszek, A. The comparison of cytotoxic and genotoxic activities of glucosinolates, isothiocyanates, and indoles. Sci. Rep. 2022, 12, 4875. [Google Scholar]
- Xie, D.; Yu, S.; Li, L.; Quan, M.; Gao, Y. The FOXM1/ATX signaling contributes to pancreatic cancer development. Am. J. Transl. Res. 2020, 12, 4478–4487. [Google Scholar]
- Quan, M.; Wang, P.; Cui, J.; Gao, Y.; Xie, K. The roles of FOXM1 in pancreatic stem cells and carcinogenesis. Mol. Cancer 2013, 12, 159. [Google Scholar]
- Xia, J.T.; Wang, H.; Liang, L.J.; Peng, B.G.; Wu, Z.F.; Chen, L.Z.; Xue, L.; Li, Z.; Li, W. Overexpression of FOXM1 is associated with poor prognosis and clinicopathologic stage of pancreatic ductal adenocarcinoma. Pancreas 2012, 41, 629–635. [Google Scholar]
- Huang, C.; Qiu, Z.; Wang, L.; Peng, Z.; Jia, Z.; Logsdon, C.D.; Le, X.; Wei, D.; Huang, S.; Xie, K. A novel FoxM1-caveolin signaling pathway promotes pancreatic cancer invasion and metastasis. Cancer Res. 2012, 72, 655–665. [Google Scholar]
- Bergamaschi, A.; Madak-Erdogan, Z.; Kim, Y.J.; Choi, Y.L.; Lu, H.; Katzenellenbogen, B.S. The forkhead transcription factor FOXM1 promotes endocrine resistance and invasiveness in estrogen receptor-positive breast cancer by expansion of stem-like cancer cells. Breast Cancer Res. 2014, 16, 436. [Google Scholar] [CrossRef]
- Liu, C.; Shi, J.; Li, Q.; Li, Z.; Lou, C.; Zhao, Q.; Zhu, Y.; Zhan, F.; Lian, J.; Wang, B.; et al. STAT1-mediated inhibition of FOXM1 enhances gemcitabine sensitivity in pancreatic cancer. Clin. Sci. 2019, 133, 645–663. [Google Scholar]
- Lee, W.; Song, G.; Bae, H. Matairesinol Induces Mitochondrial Dysfunction and Exerts Synergistic Anticancer Effects with 5-Fluorouracil in Pancreatic Cancer Cells. Mar. Drugs 2022, 20, 473. [Google Scholar] [PubMed]
- Perillo, B.; Di Donato, M.; Pezone, A.; Di Zazzo, E.; Giovannelli, P.; Galasso, G.; Castoria, G.; Migliaccio, A. ROS in cancer therapy: The bright side of the moon. Exp. Mol. Med. 2020, 52, 192–203. [Google Scholar] [PubMed]
- Ricci, J.E.; Munoz-Pinedo, C.; Fitzgerald, P.; Bailly-Maitre, B.; Perkins, G.A.; Yadava, N.; Scheffler, I.E.; Ellisman, M.H.; Green, D.R. Disruption of mitochondrial function during apoptosis is mediated by caspase cleavage of the p75 subunit of complex I of the electron transport chain. Cell 2004, 117, 773–786. [Google Scholar] [CrossRef] [PubMed]
- Furlong, I.J.; Lopez Mediavilla, C.; Ascaso, R.; Lopez Rivas, A.; Collins, M.K. Induction of apoptosis by valinomycin: Mitochondrial permeability transition causes intracellular acidification. Cell Death Differ. 1998, 5, 214–221. [Google Scholar] [CrossRef]
- Kania, E.; Pajak, B.; Orzechowski, A. Calcium Homeostasis and ER Stress in Control of Autophagy in Cancer Cells. Biomed Res. Int. 2015, 2015, 352794. [Google Scholar]
- Kong, X.Y.; Li, L.; Li, Z.S.; Le, X.D.; Huang, C.; Jia, Z.L.; Cui, J.J.; Huang, S.Y.; Wang, L.W.; Xie, K.P. Dysregulated Expression of FOXM1 Isoforms Drives Progression of Pancreatic Cancer. Cancer Res. 2013, 73, 3987–3996. [Google Scholar]
- Huang, C.; Xie, D.C.; Cui, J.J.; Li, Q.; Gao, Y.; Xie, K.P. FOXM1c Promotes Pancreatic Cancer Epithelial-to-Mesenchymal Transition and Metastasis via Upregulation of Expression of the Urokinase Plasminogen Activator System. Clin. Cancer Res. 2014, 20, 1477–1488. [Google Scholar]
- Han, K.W.W.; Po, W.W.; Sohn, U.D.; Kim, H.J. Benzyl Isothiocyanate Induces Apoptosis via Reactive Oxygen Species-Initiated Mitochondrial Dysfunction and DR4 and DR5 Death Receptor Activation in Gastric Adenocarcinoma Cells. Biomolecules 2019, 9, 839. [Google Scholar] [CrossRef] [PubMed]
- Zhu, M.; Li, W.; Dong, X.; Chen, Y.; Lu, Y.; Lin, B.; Guo, J.; Li, M. Benzyl-isothiocyanate Induces Apoptosis and Inhibits Migration and Invasion of Hepatocellular Carcinoma Cells in vitro. J. Cancer 2017, 8, 240–248. [Google Scholar] [CrossRef] [PubMed]
- Nazeri, M.; Nemati, H.; Khazaei, M. Nrf2 antioxidant pathway and apoptosis induction and inhibition of NF-kappaB-mediated inflammatory response in human prostate cancer PC3 cells by Brassica oleracea var. acephala: An in vitro study. Mol. Biol. Rep. 2022, 49, 7251–7261. [Google Scholar] [CrossRef] [PubMed]
- Riedl, S.J.; Shi, Y. Molecular mechanisms of caspase regulation during apoptosis. Nat. Rev. Mol. Cell Biol. 2004, 5, 897–907. [Google Scholar] [CrossRef]
- Chen, M.; Wang, J. Initiator caspases in apoptosis signaling pathways. Apoptosis 2002, 7, 313–319. [Google Scholar] [CrossRef]
- Liu, Z.; Ding, Y.; Ye, N.; Wild, C.; Chen, H.; Zhou, J. Direct Activation of Bax Protein for Cancer Therapy. Med. Res. Rev. 2016, 36, 313–341. [Google Scholar] [PubMed]
- Nor Hisam, N.S.; Ugusman, A.; Rajab, N.F.; Ahmad, M.F.; Fenech, M.; Liew, S.L.; Mohamad Anuar, N.N. Combination Therapy of Navitoclax with Chemotherapeutic Agents in Solid Tumors and Blood Cancer: A Review of Current Evidence. Pharmaceutics 2021, 13, 1353. [Google Scholar] [PubMed]
- Prevarskaya, N.; Skryma, R.; Shuba, Y. Calcium in tumour metastasis: New roles for known actors. Nat. Rev. Cancer 2011, 11, 609–618. [Google Scholar] [CrossRef]
- Roderick, H.L.; Cook, S.J. Ca2+ signalling checkpoints in cancer: Remodelling Ca2+ for cancer cell proliferation and survival. Nat. Rev. Cancer 2008, 8, 361–375. [Google Scholar]
- Giorgi, C.; Baldassari, F.; Bononi, A.; Bonora, M.; De Marchi, E.; Marchi, S.; Missiroli, S.; Patergnani, S.; Rimessi, A.; Suski, J.M.; et al. Mitochondrial Ca2+ and apoptosis. Cell Calcium 2012, 52, 36–43. [Google Scholar] [CrossRef]
- Delierneux, C.; Kouba, S.; Shanmughapriya, S.; Potier-Cartereau, M.; Trebak, M.; Hempel, N. Mitochondrial Calcium Regulation of Redox Signaling in Cancer. Cells 2020, 9, 432. [Google Scholar]
- Wang, H.G.; Pathan, N.; Ethell, I.M.; Krajewski, S.; Yamaguchi, Y.; Shibasaki, F.; McKeon, F.; Bobo, T.; Franke, T.F.; Reed, J.C. Ca2+-induced apoptosis through calcineurin dephosphorylation of BAD. Science 1999, 284, 339–343. [Google Scholar] [PubMed]
- Hempel, N.; Trebak, M. Crosstalk between calcium and reactive oxygen species signaling in cancer. Cell Calcium 2017, 63, 70–96. [Google Scholar] [CrossRef] [PubMed]
- Collatz, M.B.; Rudel, R.; Brinkmeier, H. Intracellular calcium chelator BAPTA protects cells against toxic calcium overload but also alters physiological calcium responses. Cell Calcium 1997, 21, 453–459. [Google Scholar] [CrossRef]
- Bootman, M.D.; Collins, T.J.; Mackenzie, L.; Roderick, H.L.; Berridge, M.J.; Peppiatt, C.M. 2-aminoethoxydiphenyl borate (2-APB) is a reliable blocker of store-operated Ca2+ entry but an inconsistent inhibitor of InsP3-induced Ca2+ release. FASEB J. 2002, 16, 1145–1150. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Huang, S.; Sun, Y.L. Epithelial-Mesenchymal Transition in Pancreatic Cancer: A Review. Biomed Res. Int. 2017, 2017, 2646148. [Google Scholar] [PubMed]
- Zheng, X.F.; Carstens, J.L.; Kim, J.; Scheible, M.; Kaye, J.; Sugimoto, H.; Wu, C.C.; LeBleu, V.S.; Kalluri, R. Epithelial-to-mesenchymal transition is dispensable for metastasis but induces chemoresistance in pancreatic cancer. Nature 2015, 527, 525–530. [Google Scholar]
- Wu, C.Z.; Chu, Y.C.; Lai, S.W.; Hsieh, M.S.; Yadav, V.K.; Fong, I.H.; Deng, L.; Huang, C.C.; Tzeng, Y.M.; Yeh, C.T.; et al. Urokinase plasminogen activator induces epithelial-mesenchymal and metastasis of pancreatic cancer through plasmin/MMP14/TGF-beta axis, which is inhibited by 4-acetyl-antroquinonol B treatment. Phytomedicine 2022, 100, 154062. [Google Scholar] [CrossRef]
- Zhao, X.; Liu, Z.; Ren, Z.; Wang, H.; Wang, Z.; Zhai, J.; Cao, D.; Lyu, S.; Li, L.; Lang, R.; et al. Triptolide inhibits pancreatic cancer cell proliferation and migration via down-regulating PLAU based on network pharmacology of Tripterygium wilfordii Hook F. Eur. J. Pharmacol. 2020, 880, 173225. [Google Scholar]
- Seo, Y.; Baba, H.; Fukuda, T.; Takashima, M.; Sugimachi, K. High expression of vascular endothelial growth factor is associated with liver metastasis and a poor prognosis for patients with ductal pancreatic adenocarcinoma. Cancer 2000, 88, 2239–2245. [Google Scholar] [CrossRef]
- Momeny, M.; Alishahi, Z.; Eyvani, H.; Esmaeili, F.; Zaghal, A.; Ghaffari, P.; Tavakkoly-Bazzaz, J.; Alimoghaddam, K.; Ghavamzadeh, A.; Ghaffari, S.H. Anti-tumor activity of cediranib, a pan-vascular endothelial growth factor receptor inhibitor, in pancreatic ductal adenocarcinoma cells. Cell Oncol. 2020, 43, 81–93. [Google Scholar]
- Sher, G.; Masoodi, T.; Patil, K.; Akhtar, S.; Kuttikrishnan, S.; Ahmad, A.; Uddin, S. Dysregulated FOXM1 signaling in the regulation of cancer stem cells. Semin. Cancer Biol. 2022, 86, 107–121. [Google Scholar] [PubMed]
- Bryant, K.L.; Stalnecker, C.A.; Zeitouni, D.; Klomp, J.E.; Peng, S.; Tikunov, A.P.; Gunda, V.; Pierobon, M.; Waters, A.M.; George, S.D.; et al. Combination of ERK and autophagy inhibition as a treatment approach for pancreatic cancer. Nat. Med. 2019, 25, 628–640. [Google Scholar] [PubMed]
- Buscail, L.; Bournet, B.; Cordelier, P. Role of oncogenic KRAS in the diagnosis, prognosis and treatment of pancreatic cancer. Nat. Rev. Gastro. Hepat. 2020, 17, 153–168. [Google Scholar]
- Papke, B.; Der, C.J. Drugging RAS: Know the enemy. Science 2017, 355, 1158–1163. [Google Scholar]
- Bournet, B.; Buscail, C.; Muscari, F.; Cordelier, P.; Buscail, L. Targeting KRAS for diagnosis, prognosis, and treatment of pancreatic cancer: Hopes and realities. Eur. J. Cancer 2016, 54, 75–83. [Google Scholar]
- Namba, T.; Kodama, R. Avarol induces apoptosis in pancreatic ductal adenocarcinoma cells by activating PERK-eIF2alpha-CHOP signaling. Mar. Drugs 2015, 13, 2376–2389. [Google Scholar] [CrossRef]
- Bhattacharya, S.S.; Mandal, C.; Albiez, R.S.; Samanta, S.K.; Mandal, C. Mahanine drives pancreatic adenocarcinoma cells into endoplasmic reticular stress-mediated apoptosis through modulating sialylation process and Ca2+-signaling. Sci. Rep.-Uk 2018, 8, 3911. [Google Scholar] [CrossRef]
- Myatt, S.S.; Lam, E.W.F. The emerging roles of forkhead box (Fox) proteins in cancer. Nat. Rev. Cancer 2007, 7, 847–859. [Google Scholar]
- Palamaris, K.; Felekouras, E.; Sakellariou, S. Epithelial to Mesenchymal Transition: Key Regulator of Pancreatic Ductal Adenocarcinoma Progression and Chemoresistance. Cancers 2021, 13, 5532. [Google Scholar] [PubMed]
- Li, X.; Lin, P.; Tao, Y.; Jiang, X.; Li, T.; Wang, Y.; Wang, C.; Cao, Y. LECT 2 Antagonizes FOXM1 Signaling via Inhibiting MET to Retard PDAC Progression. Front. Cell Dev. Biol. 2021, 9, 661122. [Google Scholar] [CrossRef] [PubMed]
- Pandit, B.; Gartel, A.L. FoxM1 knockdown sensitizes human cancer cells to proteasome inhibitor-induced apoptosis but not to autophagy. Cell Cycle 2011, 10, 3269–3273. [Google Scholar] [CrossRef] [PubMed]
- Sun, H.; Zhang, N.; Jin, Y.; Xu, H. Cardamonin Promotes the Apoptosis and Chemotherapy Sensitivity to Gemcitabine of Pancreatic Cancer Through Modulating the FOXO3a-FOXM1 Axis. Dose Response 2021, 19, 15593258211042163. [Google Scholar] [CrossRef] [PubMed]








| Antibody | Supplier | Dilution | Catalog Number |
|---|---|---|---|
| Bcl-xL | Proteintech | 1:1000 | 10783-1-AP |
| BAX | Proteintech | 1:2000 | 50599-2-Ig |
| Cytochrome c | Proteintech | 1:1000 | 66264-1-Ig |
| GADD153 | Proteintech | 1:1000 | 15204-1-AP |
| GRP78 | Proteintech | 1:1000 | 11587-1-AP |
| p-eIF2α (Ser51) | Cell Signaling Technology | 1:1000 | 3398 |
| eIF2α | Cell Signaling Technology | 1:1000 | 5324 |
| p-ERK1/2 (Thr202/Tyr204) | Cell Signaling Technology | 1:1000 | 9101 |
| ERK1/2 | Cell Signaling Technology | 1:1000 | 4695 |
| p-JNK (Thr183/Tyr185) | Cell Signaling Technology | 1:1000 | 4668 |
| JNK | Cell Signaling Technology | 1:1000 | 9252 |
| p-P38 (Thr180/Tyr182) | Cell Signaling Technology | 1:1000 | 4511 |
| P38 | Cell Signaling Technology | 1:1000 | 9212 |
| p-AKT (Ser473) | Cell Signaling Technology | 1:1000 | 4060 |
| AKT | Cell Signaling Technology | 1:1000 | 9272 |
| β-actin | Santa Cruz Biotechnology | 1:1000 | sc-47778 |
| Gene | Size (bp) | GenBank Accession No. | Primer Sequence (5′→3′) |
|---|---|---|---|
| forkhead box protein M1 (FOXM1) | 104 | NM_001243088.2 | F: AGTCACACCCTAGCCACTGC |
| R: ACCATTGCCTTTGTTGTTCC | |||
| plasminogen activator, urokinase (PLAU) | 139 | NM_002658.6 | F: TGTGAGATCACTGGCTTTGG |
| R: TTTTGGTGGTGACTTCAGAG | |||
| vascular endothelial growth factor A (VEGFA) | 109 | NM_001025366.3 | F: CTGCTCTACCTCCACCATGC |
| R: AGCTGCGCTGATAGACATCC | |||
| cadherin 1 (CDH1) | 112 | NM_001317184.2 | F: CGTAGCAGTGACGAATGTGG |
| R: TTCAGGAGGCACAAAGATGG | |||
| cadherin 2 (CDH2) | 103 | NM_001308176.2 | F: AGGTTTGCCAGTGTGACTCC |
| R: ATGATGCAGAGCAGGATGG | |||
| glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | 149 | NM_001256799.3 | F: GGCTCTCCAGAACATCATCC |
| R: TTTCTAGACGGCAGGTCAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, W.; Song, G.; Bae, H. Glucotropaeolin Promotes Apoptosis by Calcium Dysregulation and Attenuates Cell Migration with FOXM1 Suppression in Pancreatic Cancer Cells. Antioxidants 2023, 12, 257. https://doi.org/10.3390/antiox12020257
Lee W, Song G, Bae H. Glucotropaeolin Promotes Apoptosis by Calcium Dysregulation and Attenuates Cell Migration with FOXM1 Suppression in Pancreatic Cancer Cells. Antioxidants. 2023; 12(2):257. https://doi.org/10.3390/antiox12020257
Chicago/Turabian StyleLee, Woonghee, Gwonhwa Song, and Hyocheol Bae. 2023. "Glucotropaeolin Promotes Apoptosis by Calcium Dysregulation and Attenuates Cell Migration with FOXM1 Suppression in Pancreatic Cancer Cells" Antioxidants 12, no. 2: 257. https://doi.org/10.3390/antiox12020257
APA StyleLee, W., Song, G., & Bae, H. (2023). Glucotropaeolin Promotes Apoptosis by Calcium Dysregulation and Attenuates Cell Migration with FOXM1 Suppression in Pancreatic Cancer Cells. Antioxidants, 12(2), 257. https://doi.org/10.3390/antiox12020257

