β-Cell Autophagy Pathway and Endoplasmic Reticulum Stress Regulating-Role of Liposomal Curcumin in Experimental Diabetes Mellitus: A Molecular and Morphometric Study
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Test Compounds
2.2. Experimental Animals
2.3. Preparation and Characterization of LPs-CUR
2.4. Induction of T1DM
2.5. Experimental Design
2.6. Dose Selection Strategy of LPs-CUR
2.7. Sample Collection
2.8. Biochemical Examinations
2.8.1. Blood Glucose Level, β-Cell Function, Insulin-Resistant, and Insulin Sensitivity
2.8.2. Serum Insulin and C-Peptide
2.8.3. Pancreatic Oxidants/Antioxidants Status
2.8.4. Pancreatic Pro-Inflammatory Cytokines
2.9. Real-Time RT-PCR
2.10. Histopathological Examination
2.11. Beclin-1 and LC3 Immunohistochemical Investigation
2.12. Statistical Analysis
3. Results
3.1. Characterization of LPs-CUR
3.2. Glucose, Insulin, and C-Peptide Levels in the Treatment Groups
3.3. Oxidative Stress and Antioxidants
3.4. Pro-Inflammatory Cytokines
3.5. Effects on mRNA Expression Levels of ER Stress-Dependent and Autophagy-Related Genes in the Pancreatic Tissue
3.6. Histological Examination Findings
3.7. Immunohistochemical Examination Findings
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hayes, H.L.; Peterson, B.S.; Haldeman, J.M.; Newgard, C.B.; Hohmeier, H.E.; Stephens, S.B. Delayed apoptosis allows islet β-cells to implement an autophagic mechanism to promote cell survival. PLoS ONE 2017, 12, e0172567. [Google Scholar] [CrossRef] [PubMed]
- Glick, D.; Barth, S.; Macleod, K.F. Autophagy: Cellular and molecular mechanisms. J. Pathol. 2010, 221, 3–12. [Google Scholar] [CrossRef] [PubMed]
- Turko, I.V.; Marcondes, S.; Murad, F. Diabetes-associated nitration of tyrosine and inactivation of succinyl-CoA: 3-oxoacid CoA-transferase. Am. J. Physiol.-Heart Circ. Physiol. 2001, 281, H2289–H2294. [Google Scholar] [CrossRef] [PubMed]
- Abd El-Hakim, Y.M.; Abdel-Rahman Mohamed, A.; Khater, S.I.; Hamed Arisha, A.; Metwally, M.M.; Nassan, M.A.; Hassan, M.E. Chitosan-stabilized selenium nanoparticles and metformin synergistically rescue testicular oxidative damage and steroidogenesis-related genes dysregulation in high-fat diet/streptozotocin-induced diabetic rats. Antioxidants 2020, 10, 17. [Google Scholar] [CrossRef] [PubMed]
- Riahi, Y.; Wikstrom, J.D.; Bachar-Wikstrom, E.; Polin, N.; Zucker, H.; Lee, M.-S.; Quan, W.; Haataja, L.; Liu, M.; Arvan, P. Autophagy is a major regulator of beta cell insulin homeostasis. Diabetologia 2016, 59, 1480–1491. [Google Scholar] [CrossRef]
- Kroemer, G.; Mariño, G.; Levine, B. Autophagy and the integrated stress response. Mol. Cell 2010, 40, 280–293. [Google Scholar] [CrossRef]
- Robertson, R.P. Chronic oxidative stress as a central mechanism for glucose toxicity in pancreatic islet beta cells in diabetes. J. Biol. Chem. 2004, 279, 42351–42354. [Google Scholar] [CrossRef]
- Senft, D.; Ze’ev, A.R. UPR, autophagy, and mitochondria crosstalk underlies the ER stress response. Trends Biochem. Sci. 2015, 40, 141–148. [Google Scholar] [CrossRef]
- Oakes, S.A.; Papa, F.R. The role of endoplasmic reticulum stress in human pathology. Annu. Rev. Pathol. Mech. Dis. 2015, 10, 173–194. [Google Scholar] [CrossRef]
- Lebeaupin, C.; Vallée, D.; Hazari, Y.; Hetz, C.; Chevet, E.; Bailly-Maitre, B. Endoplasmic reticulum stress signalling and the pathogenesis of non-alcoholic fatty liver disease. J. Hepatol. 2018, 69, 927–947. [Google Scholar] [CrossRef]
- Todd, D.J.; Lee, A.-H.; Glimcher, L.H. The endoplasmic reticulum stress response in immunity and autoimmunity. Nat. Rev. Immunol. 2008, 8, 663–674. [Google Scholar] [CrossRef]
- Tian, R.-D.; Chen, Y.-Q.; He, Y.-H.; Tang, Y.-J.; Chen, G.-M.; Yang, F.-W.; Li, Y.; Huang, W.-G.; Chen, H.; Liu, X. Phosphorylation of eIF2α mitigates endoplasmic reticulum stress and hepatocyte necroptosis in acute liver injury. Ann. Hepatol. 2020, 19, 79–87. [Google Scholar] [CrossRef]
- Blandino-Rosano, M.; Barbaresso, R.; Jimenez-Palomares, M.; Bozadjieva, N.; Werneck-de-Castro, J.P.; Hatanaka, M.; Mirmira, R.G.; Sonenberg, N.; Liu, M.; Rüegg, M.A. Loss of mTORC1 signalling impairs β-cell homeostasis and insulin processing. Nat. Commun. 2017, 8, 16014. [Google Scholar] [CrossRef]
- Bartolomé, A.; Kimura-Koyanagi, M.; Asahara, S.-I.; Guillén, C.; Inoue, H.; Teruyama, K.; Shimizu, S.; Kanno, A.; García-Aguilar, A.; Koike, M. Pancreatic β-cell failure mediated by mTORC1 hyperactivity and autophagic impairment. Diabetes 2014, 63, 2996–3008. [Google Scholar] [CrossRef]
- Green, A.; Patterson, C.C. Trends in the incidence of childhood-onset diabetes in Europe 1989–1998. Diabetologia 2001, 44, B3–B8. [Google Scholar] [CrossRef]
- Mordes, J.; Flanagan, J.; Leif, J.; Greiner, D.; Kislauskis, E.; Rossini, A.; Blankenhorn, E.; Hillebrands, J.; Guberski, D. Autoimmune diabetes in the LEW1. WR1 rat after infection with Kilham rat virus (KRV) or rat cytomegalovirus (RCMV). Diabetes 2003, 52, A528. [Google Scholar]
- Redondo, M.; Yu, L.; Hawa, M.; Mackenzie, T.; Pyke, D.; Eisenbarth, G.; Leslie, R. Heterogeneity of type I diabetes: Analysis of monozygotic twins in Great Britain and the United States. Diabetologia 2001, 44, 354–362. [Google Scholar] [CrossRef]
- Khater, S.I.; Mohamed, A.A.-R.; Arisha, A.H.; Ebraheim, L.L.; El-Mandrawy, S.A.; Nassan, M.A.; Mohammed, A.T.; Abdo, S.A. Stabilized-chitosan selenium nanoparticles efficiently reduce renal tissue injury and regulate the expression pattern of aldose reductase in the diabetic-nephropathy rat model. Life Sci. 2021, 279, 119674. [Google Scholar] [CrossRef]
- Mohamed, A.A.-R.; Khater, S.I.; Arisha, A.H.; Metwally, M.M.; Mostafa-Hedeab, G.; El-Shetry, E.S. Chitosan-stabilized selenium nanoparticles alleviate cardio-hepatic damage in type 2 diabetes mellitus model via regulation of caspase, Bax/Bcl-2, and Fas/FasL-pathway. Gene 2021, 768, 145288. [Google Scholar] [CrossRef]
- Alizadeh, M.; Kheirouri, S. Curcumin reduces malondialdehyde and improves antioxidants in humans with diseased conditions: A comprehensive meta-analysis of randomized controlled trials. BioMedicine 2019, 9, 23. [Google Scholar] [CrossRef]
- Naijil, G.; Anju, T.R.; Jayanarayanan, S.; Paulose, C.S. Curcumin pretreatment mediates antidiabetogenesis via functional regulation of adrenergic receptor subtypes in the pancreas of multiple low-dose streptozotocin-induced diabetic rats. Nutr. Res. 2015, 35, 823–833. [Google Scholar] [CrossRef] [PubMed]
- Quispe, C.; Herrera-Bravo, J.; Javed, Z.; Khan, K.; Raza, S.; Gulsunoglu-Konuskan, Z.; Daştan, S.D.; Sytar, O.; Martorell, M.; Sharifi-Rad, J.; et al. Therapeutic Applications of Curcumin in Diabetes: A Review and Perspective. BioMed Res. Int. 2022, 2022, 1375892. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, R.; Iezhitsa, I.; Agarwal, P.; Abdul Nasir, N.A.; Razali, N.; Alyautdin, R.; Ismail, N.M. Liposomes in topical ophthalmic drug delivery: An update. Drug Deliv. 2016, 23, 1075–1091. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Han, Z.; Wu, Y.; Lu, X.; Tang, X.; Xiao, J.; Li, N. Enhancing stability and anti-inflammatory properties of curcumin in ulcerative colitis therapy using liposomes mediated colon-specific drug delivery system. Food Chem. Toxicol. 2021, 151, 112123. [Google Scholar] [CrossRef] [PubMed]
- Alaaeldin, E.; Mostafa, M.; Mansour, H.F.; Soliman, G.M. Spanlastics as an efficient delivery system for the enhancement of thymoquinone anticancer efficacy: Fabrication and cytotoxic studies against breast cancer cell lines. J. Drug Deliv. Sci. Technol. 2021, 65, 102725. [Google Scholar] [CrossRef]
- Alaaeldin, E.; Abou-Taleb, H.A.; Mohamad, S.A.; Elrehany, M.; Gaber, S.S.; Mansour, H.F. Topical Nano-Vesicular Spanlastics of Celecoxib: Enhanced Anti-Inflammatory Effect and Down-Regulation of TNF-α, NF-кB and COX-2 in Complete Freund’s Adjuvant-Induced Arthritis Model in Rats. Int. J. Nanomed. 2021, 16, 133–145. [Google Scholar] [CrossRef]
- Tesch, G.H.; Allen, T.J. Rodent models of streptozotocin-induced diabetic nephropathy. Nephrology 2007, 12, 261–266. [Google Scholar] [CrossRef]
- Ebrahim, N.; Ahmed, I.A.; Hussien, N.I.; Dessouky, A.A.; Farid, A.S.; Elshazly, A.M.; Mostafa, O.; Gazzar, W.B.E.; Sorour, S.M.; Seleem, Y.; et al. Mesenchymal Stem Cell-Derived Exosomes Ameliorated Diabetic Nephropathy by Autophagy Induction through the mTOR Signaling Pathway. Cells 2018, 7, 226. [Google Scholar] [CrossRef]
- Bulboacă, A.E.; Porfire, A.S.; Tefas, L.R.; Boarescu, P.M.; Bolboacă, S.D.; Stănescu, I.C.; Bulboacă, A.C.; Dogaru, G. Liposomal Curcumin is Better than Curcumin to Alleviate Complications in Experimental Diabetic Mellitus. Molecules 2019, 24, 846. [Google Scholar] [CrossRef]
- Mohamed, A.A.-R.; Bohy, K.M.E.; Moustafa, G.G.; Mohammed, H.H.; Metwally, M.M.; Mohammed, H.E.D.; Nassan, M.A.; Saber, T.M. Sustained Functioning Impairments and Oxidative Stress with Neurobehavioral Dysfunction Associated with Oral Nicotine Exposure in the Brain of a Murine Model of Ehrlich Ascites Carcinoma: Modifying the Antioxidant Role of Chlorella vulgaris. Biology 2022, 11, 279. [Google Scholar] [CrossRef]
- El-Shetry, E.S.; Mohamed, A.A.-R.; Khater, S.I.; Metwally, M.M.; Nassan, M.A.; Shalaby, S.; El-Mandrawy, S.A.; Emran, T.B.; Abdel-Ghany, H.M. Synergistically enhanced apoptotic and oxidative DNA damaging pathways in the rat brain with lead and/or aluminum metals toxicity: Expression pattern of genes OGG1 and P53. J. Trace Elem. Med. Biol. 2021, 68, 126860. [Google Scholar] [CrossRef]
- Czimmerer, Z.; Hulvely, J.; Simandi, Z.; Varallyay, E.; Havelda, Z.; Szabo, E.; Varga, A.; Dezso, B.; Balogh, M.; Horvath, A. A versatile method to design stem-loop primer-based quantitative PCR assays for detecting small regulatory RNA molecules. PLoS ONE 2013, 8, e55168. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- King, J.M.; Roth-Johnson, L.; Dodd, D.C.; Newsom, M.E. The Necropsy Book: A Guide for Veterinary Students, Residents, Clinicians, Pathologists, and Biological Researchers; The Internet-First University Press: Ithaca, NY, USA, 2014. [Google Scholar]
- Ruehl-Fehlert, C.; Kittel, B.; Morawietz, G.; Deslex, P.; Keenan, C.; Mahrt, C.R.; Nolte, T.; Robinson, M.; Stuart, B.P.; Deschl, U. Revised guides for organ sampling and trimming in rats and mice–part 1: A joint publication of the RITA and NACAD groups. Exp. Toxicol. Pathol. 2003, 55, 91–106. [Google Scholar] [CrossRef]
- Suvarna, K.S.; Layton, C.; Bancroft, J.D. Bancroft’s Theory and Practice of Histological Techniques E-Book; Elsevier Health Sciences: Amsterdam, The Netherlands, 2018. [Google Scholar]
- Hsu, S.-M.; Raine, L.; Fanger, H. Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: A comparison between ABC and unlabeled antibody (PAP) procedures. J. Histochem. Cytochem. 1981, 29, 577–580. [Google Scholar] [CrossRef]
- Calcutt, N.A.; Cooper, M.E.; Kern, T.S.; Schmidt, A.M. Therapies for hyperglycaemia-induced diabetic complications: From animal models to clinical trials. Nat. Rev. Drug Discov. 2009, 8, 417–430. [Google Scholar] [CrossRef]
- Zhao, W.C.; Zhang, B.; Liao, M.J.; Zhang, W.X.; He, W.Y.; Wang, H.B.; Yang, C.X. Curcumin ameliorated diabetic neuropathy partially by inhibition of NADPH oxidase mediating oxidative stress in the spinal cord. Neurosci. Lett. 2014, 560, 81–85. [Google Scholar] [CrossRef]
- Kanitkar, M.; Gokhale, K.; Galande, S.; Bhonde, R. Novel role of curcumin in the prevention of cytokine-induced islet death in vitro and diabetogenesis in vivo. Br. J. Pharmacol. 2008, 155, 702–713. [Google Scholar] [CrossRef]
- Li, W.; Zhang, X.; Zhuang, H.; Chen, H.-g.; Chen, Y.; Tian, W.; Wu, W.; Li, Y.; Wang, S.; Zhang, L. MicroRNA-137 is a novel hypoxia-responsive microRNA that inhibits mitophagy via regulation of two mitophagy receptors FUNDC1 and NIX. J. Biol. Chem. 2014, 289, 10691–10701. [Google Scholar] [CrossRef]
- Zeng, Y.; Huo, G.; Mo, Y.; Wang, W.; Chen, H. MIR137 regulates starvation-induced autophagy by targeting ATG7. J. Mol. Neurosci. 2015, 56, 815–821. [Google Scholar] [CrossRef]
- Cai, J.; Zhang, H.; Zhang, Y.-f.; Zhou, Z.; Wu, S. MicroRNA-29 enhances autophagy and cleanses exogenous mutant αB-crystallin in retinal pigment epithelial cells. Exp. Cell Res. 2019, 374, 231–248. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward primer (5′–3′) | Reverse Primer (5′–3′) | Accession No. | Product Size |
---|---|---|---|---|
Bclin-1 | GAATGGAGGGGTCTAAGGCG | CTTCCTCCTGGCTCTCTCT | NM_001034117.1 | 180 |
LC-3 | GAAATGGTCACCCCACGAGT | ACACAGTTTTCCCATGCCCA | NM_012823.2 | 147 |
Mtor | GCAATGGGCACGAGTTTGTT | AGTGTGTTCACCAGGCCAAA | NM_019906.2 | 94 |
P62 | GGAAGCTGAAACATGGGCAC | CCAAGGGTCCACCTGAACAA | NM_181550.2 | 183 |
EIF-2 | CTTTCCGGGACAAGATGGCG | CTCTGTGAAGTGTGGGGGTC | NM_001399818.1 | 95 |
ATF6 | AAGTGAAGAACCATTACTTTATATC | TTTCTGCTGGCTATTTGT | NM_001107196.1 | 157 |
BIP | AACCAAGGATGCTGGCACTA | ATGACCCGCTGATCAAAGTC | NM_013083.2 | 240 |
CHOP | CACAAGCACCTCCCAAAG | CCTGCTCCTTCTCCTTCAT | NM_001109986.1 | 158 |
JNK | AGTGTAGAGTGGATGCATGA | ATGTGCTTCCTGTGGTTTAC | NM_053829.2 | 182 |
XBP1 | TTACGAGAGAAAACTCATGGGC | GGGTCCAACTTGTCCAGAATGC | NM_001004210.2 | 289 |
Groups | Acinar Atrophy | Size of the Islets of Langerhans in Micrometers | Beclin-1 DAB Area Fraction | LC3 DAB Area Fraction |
---|---|---|---|---|
Control | 0.0 b ± 0 | 130.0 a ± 8.44 | 33.52 c ± 1.86 | 33.62 c ± 2.17 |
Diabetic | 12.0 b ± 2.49 | 75.8 b ± 6.47 | 51.82 b ± 2.92 | 47.36 b ± 1.61 |
Diabetic + 3MA | 31.0 a ± 6.4 | 72.2 b ± 5.95 | 10.61 e ± 1.42 | 12.0 e ± 1.59 |
Diabetic + LPs-CUR | 1.0 b ± 1 | 85.1 b ± 4.23 | 77.13 a ± 0.82 | 72.9 a ± 1.16 |
Diabetic + LPs.CUR-3MA | 6.0 b ± 2.67 | 80.8 b ± 3.42 | 22.08 d ± 2.21 | 21.18 d ± 2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khater, S.I.; Dowidar, M.F.; Abdel-Aziz, A.E.; Khamis, T.; Dahran, N.; Alqahtani, L.S.; Metwally, M.M.M.; Al-Hady Abd-Elrahamn, A.-S.; Alsieni, M.; Alosaimi, M.E.; et al. β-Cell Autophagy Pathway and Endoplasmic Reticulum Stress Regulating-Role of Liposomal Curcumin in Experimental Diabetes Mellitus: A Molecular and Morphometric Study. Antioxidants 2022, 11, 2400. https://doi.org/10.3390/antiox11122400
Khater SI, Dowidar MF, Abdel-Aziz AE, Khamis T, Dahran N, Alqahtani LS, Metwally MMM, Al-Hady Abd-Elrahamn A-S, Alsieni M, Alosaimi ME, et al. β-Cell Autophagy Pathway and Endoplasmic Reticulum Stress Regulating-Role of Liposomal Curcumin in Experimental Diabetes Mellitus: A Molecular and Morphometric Study. Antioxidants. 2022; 11(12):2400. https://doi.org/10.3390/antiox11122400
Chicago/Turabian StyleKhater, Safaa I., Mohamed F. Dowidar, Aya E. Abdel-Aziz, Tarek Khamis, Naief Dahran, Leena S. Alqahtani, Mohamed M. M. Metwally, Al-Sayed Al-Hady Abd-Elrahamn, Mohammed Alsieni, Manal E. Alosaimi, and et al. 2022. "β-Cell Autophagy Pathway and Endoplasmic Reticulum Stress Regulating-Role of Liposomal Curcumin in Experimental Diabetes Mellitus: A Molecular and Morphometric Study" Antioxidants 11, no. 12: 2400. https://doi.org/10.3390/antiox11122400
APA StyleKhater, S. I., Dowidar, M. F., Abdel-Aziz, A. E., Khamis, T., Dahran, N., Alqahtani, L. S., Metwally, M. M. M., Al-Hady Abd-Elrahamn, A.-S., Alsieni, M., Alosaimi, M. E., Abduljabbar, M. H., & Mohamed, A. A.-R. (2022). β-Cell Autophagy Pathway and Endoplasmic Reticulum Stress Regulating-Role of Liposomal Curcumin in Experimental Diabetes Mellitus: A Molecular and Morphometric Study. Antioxidants, 11(12), 2400. https://doi.org/10.3390/antiox11122400