Crosstalk between Peroxisomal Activities and Nrf2 Signaling in Porcine Embryos
Abstract
:1. Introduction
2. Materials and Methods
2.1. Research Ethics and Chemicals
2.2. In Vitro Maturation
2.3. Parthenogenetic Activation
2.4. Microinjection
2.5. Chemical Administration during IVC and Embryo Evaluation
2.6. Immunofluorescence Staining
2.7. Fluorescent FA Analog Assays
2.8. JC-1 MMP Assays
2.9. ATP Content Assay
2.10. Analysis of Gene Expression by Quantitative Real-Time PCR
2.11. Statistical Analysis
3. Results
3.1. Optimization of PA and Co-Treatment with Melatonin
3.2. Pex19 siRNA Selection and Application
3.3. Gene Expression Analysis in Two-Cell Embryos and Blastocysts
3.4. Immunocytochemistry, BODIPY, and JC-1 MMP Staining in Porcine Embryos
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Aigner, B.; Renner, S.; Kessler, B.; Klymiuk, N.; Kurome, M.; Wünsch, A.; Wolf, E. Transgenic pigs as models for translational biomedical research. J. Mol. Med. 2010, 88, 653–664. [Google Scholar] [CrossRef] [PubMed]
- Prather, R.S.; Hawley, R.J.; Carter, D.B.; Lai, L.; Greenstein, J.L. Transgenic swine for biomedicine and agriculture. Theriogenology 2003, 59, 115–123. [Google Scholar] [CrossRef]
- Wu, J.; Vilarino, M.; Suzuki, K.; Okamura, D.; Bogliotti, Y.S.; Park, I.; Rowe, J.; McNabb, B.; Ross, P.J.; Belmonte, J.C. CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs. Sci. Rep. 2017, 7, 10487. [Google Scholar] [CrossRef] [Green Version]
- Brussow, K.P.; Torner, H.; Kanitz, W.; Ratky, J. In vitro technologies related to pig embryo transfer. Reprod. Nutr. Dev. 2000, 40, 469–480. [Google Scholar] [CrossRef] [Green Version]
- Dang-Nguyen, T.Q.; Wells, D.; Haraguchi, S.; Men, N.T.; Nguyen, H.T.; Noguchi, J.; Kaneko, H.; Kikuchi, K. Combined refinements to somatic cell nuclear transfer methods improve porcine embryo development. J. Reprod. Dev. 2020, 66, 281–286. [Google Scholar] [CrossRef] [Green Version]
- Chuang, C.K.; Chen, C.H.; Huang, C.L.; Su, Y.H.; Peng, S.H.; Lin, T.Y.; Tai, H.C.; Yang, T.S.; Tu, C.F. Generation of GGTA1 Mutant Pigs by Direct Pronuclear Microinjection of CRISPR/Cas9 Plasmid Vectors. Anim. Biotechnol. 2017, 28, 174–181. [Google Scholar] [CrossRef]
- Kim, E.H.; Kim, G.A.; Taweechaipaisankul, A.; Lee, S.H.; Qasim, M.; Ahn, C.; Lee, B.C. Melatonin enhances porcine embryo development via the Nrf2/ARE signaling pathway. J. Mol. Endocrinol. 2019, 63, 175–185. [Google Scholar] [CrossRef]
- Lee, J.; Lee, Y.; Lee, G.S.; Lee, S.T.; Lee, E. Comparative study of the developmental competence of cloned pig embryos derived from spermatogonial stem cells and fetal fibroblasts. Reprod. Domest. Anim. 2019, 54, 1258–1264. [Google Scholar] [CrossRef]
- Taweechaipaisankul, A.; Kim, G.A.; Jin, J.X.; Lee, S.; Qasim, M.; Kim, E.H.; Lee, B.C. Enhancement of epigenetic reprogramming status of porcine cloned embryos with zebularine, a DNA methyltransferase inhibitor. Mol. Reprod. Dev. 2019, 86, 1013–1022. [Google Scholar] [CrossRef]
- Ekthuwapranee, K.; Sotthibundhu, A.; Tocharus, C.; Govitrapong, P. Melatonin ameliorates dexamethasone-induced inhibitory effects on the proliferation of cultured progenitor cells obtained from adult rat hippocampus. J. Steroid Biochem. Mol. Biol. 2015, 145, 38–48. [Google Scholar] [CrossRef] [PubMed]
- Schluter, A.; Yubero, P.; Iglesias, R.; Giralt, M.; Villarroya, F. The chlorophyll-derived metabolite phytanic acid induces white adipocyte differentiation. Int. J. Obes. 2002, 26, 1277–1280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, E.H.; Kim, G.A.; Taweechaipaisankul, A.; Ridlo, M.R.; Lee, S.H.; Ra, K.; Ahn, C.; Lee, B.C. Phytanic acid-derived peroxisomal lipid metabolism in porcine oocytes. Theriogenology 2020, 157, 276–285. [Google Scholar] [CrossRef] [PubMed]
- Lan, M.; Zhang, Y.; Wan, X.; Pan, M.H.; Xu, Y.; Sun, S.C. Melatonin ameliorates ochratoxin A-induced oxidative stress and apoptosis in porcine oocytes. Environ. Pollut. 2020, 256, 113374. [Google Scholar] [CrossRef]
- Lee, S.; Jin, J.X.; Taweechaipaisankul, A.; Kim, G.A.; Ahn, C.; Lee, B.C. Melatonin influences the sonic hedgehog signaling pathway in porcine cumulus oocyte complexes. J. Pineal Res. 2017, 63, e12424. [Google Scholar] [CrossRef]
- Niu, Y.J.; Zhou, W.; Nie, Z.W.; Shin, K.T.; Cui, X.S. Melatonin enhances mitochondrial biogenesis and protects against rotenone-induced mitochondrial deficiency in early porcine embryos. J. Pineal Res. 2020, 68, e12627. [Google Scholar] [CrossRef] [PubMed]
- Qu, J.; Sun, M.; Wang, X.; Song, X.; He, H.; Huan, Y. Melatonin Enhances the Development of Porcine Cloned Embryos by Improving DNA Methylation Reprogramming. Cell Reprogram. 2020, 22, 156–166. [Google Scholar] [CrossRef]
- Chaudhary, S.; Parvez, S. Phytanic acid induced neurological alterations in rat brain synaptosomes and its attenuation by melatonin. Biomed. Pharmacother. 2017, 95, 37–46. [Google Scholar] [CrossRef]
- Li, R.; Jia, Z.; Zhu, H. Regulation of Nrf2 Signaling. React. Oxyg. Species 2019, 8, 312–322. [Google Scholar] [CrossRef]
- Tonelli, C.; Chio, C., II; Tuveson, D.A. Transcriptional Regulation by Nrf2. Antioxid. Redox Signal. 2018, 29, 1727–1745. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, X.; Xing, X.; Zhang, Y.; Zhang, C.; Wu, Y.; Chen, Y.; Meng, R.; Jia, H.; Cheng, Y.; Zhang, Y.; et al. Lead exposure activates the Nrf2/Keap1 pathway, aggravates oxidative stress, and induces reproductive damage in female mice. Ecotoxicol. Environ. Saf. 2020, 207, 111231. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.; Sui, L.C.; Wu, R.H.; Fu, H.Y.; Xu, J.J.; Qiu, X.H.; Chen, L. Nrf2 inhibition affects cell cycle progression during early mouse embryo development. J. Reprod. Dev. 2018, 64, 49–55. [Google Scholar] [CrossRef] [Green Version]
- Ma, R.; Liang, W.; Sun, Q.; Qiu, X.; Lin, Y.; Ge, X.; Jueraitetibaike, K.; Xie, M.; Zhou, J.; Huang, X.; et al. Sirt1/Nrf2 pathway is involved in oocyte aging by regulating Cyclin B1. Aging 2018, 10, 2991–3004. [Google Scholar] [CrossRef] [PubMed]
- Amin, A.; Gad, A.; Salilew-Wondim, D.; Prastowo, S.; Held, E.; Hoelker, M.; Rings, F.; Tholen, E.; Neuhoff, C.; Looft, C.; et al. Bovine embryo survival under oxidative-stress conditions is associated with activity of the NRF2-mediated oxidative-stress-response pathway. Mol. Reprod. Dev. 2014, 81, 497–513. [Google Scholar] [CrossRef] [PubMed]
- Van den Brink, D.M.; Wanders, R.J. Phytanic acid: Production from phytol, its breakdown and role in human disease. Cell Mol. Life Sci. 2006, 63, 1752–1765. [Google Scholar] [CrossRef]
- Mannaerts, G.P.; van Veldhoven, P.P. Functions and organization of peroxisomal beta-oxidation. Ann. N. Y. Acad. Sci. 1996, 804, 99–115. [Google Scholar] [CrossRef]
- Wanders, R.J.; Waterham, H.R.; Ferdinandusse, S. Metabolic Interplay between Peroxisomes and Other Subcellular Organelles Including Mitochondria and the Endoplasmic Reticulum. Front. Cell Dev. Biol. 2015, 3, 83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dunning, K.R.; Cashman, K.; Russell, D.L.; Thompson, J.G.; Norman, R.J.; Robker, R.L. Beta-oxidation is essential for mouse oocyte developmental competence and early embryo development. Biol. Reprod. 2010, 83, 909–918. [Google Scholar] [CrossRef] [Green Version]
- Dunning, K.R.; Russell, D.L.; Robker, R.L. Lipids and oocyte developmental competence: The role of fatty acids and beta-oxidation. Reproduction 2014, 148, R15–R27. [Google Scholar] [CrossRef] [Green Version]
- Sanchez-Lazo, L.; Brisard, D.; Elis, S.; Maillard, V.; Uzbekov, R.; Labas, V.; Desmarchais, A.; Papillier, P.; Monget, P.; Uzbekova, S. Fatty acid synthesis and oxidation in cumulus cells support oocyte maturation in bovine. Mol. Endocrinol. 2014, 28, 1502–1521. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jansen, R.L.M.; van der Klei, I.J. The peroxisome biogenesis factors Pex3 and Pex19: Multitasking proteins with disputed functions. FEBS Lett. 2019, 593, 457–474. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sunyer-Figueres, M.; Vazquez, J.; Mas, A.; Torija, M.J.; Beltran, G. Transcriptomic Insights into the Effect of Melatonin in Saccharomyces cerevisiae in the Presence and Absence of Oxidative Stress. Antioxidants 2020, 9, 947. [Google Scholar] [CrossRef] [PubMed]
- Dinkova-Kostova, A.T.; Abramov, A.Y. The emerging role of Nrf2 in mitochondrial function. Free Radic. Biol. Med. 2015, 88 Pt B, 179–188. [Google Scholar] [CrossRef] [Green Version]
- Holmstrom, K.M.; Kostov, R.V.; Dinkova-Kostova, A.T. The multifaceted role of Nrf2 in mitochondrial function. Curr. Opin. Toxicol. 2016, 1, 80–91. [Google Scholar] [CrossRef] [Green Version]
- Kim, E.H.; Ridlo, M.R.; Lee, B.C.; Kim, G.A. Melatonin-Nrf2 Signaling Activates Peroxisomal Activities in Porcine Cumulus Cell-Oocyte Complexes. Antioxidants 2020, 9, 1080. [Google Scholar] [CrossRef] [PubMed]
- Bou, G.; Liu, S.; Sun, M.; Zhu, J.; Xue, B.; Guo, J.; Zhao, Y.; Qu, B.; Weng, X.; Wei, Y.; et al. CDX2 is essential for cell proliferation and polarity in porcine blastocysts. Development 2017, 144, 1296–1306. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lolicato, F.; Brouwers, J.F.; de Lest, C.H.; Wubbolts, R.; Aardema, H.; Priore, P.; Roelen, B.A.; Helms, J.B.; Gadella, B.M. The cumulus cell layer protects the bovine maturing oocyte against fatty acid-induced lipotoxicity. Biol. Reprod. 2015, 92, 16. [Google Scholar] [CrossRef] [PubMed]
- Jin, J.X.; Lee, S.; Setyawan, E.M.; Taweechaipaisankul, A.; Kim, G.A.; Han, H.J.; Ahn, C.; Lee, B.C. A potential role of knockout serum replacement as a porcine follicular fluid substitute for in vitro maturation: Lipid metabolism approach. J. Cell Physiol. 2018, 233, 6984–6995. [Google Scholar] [CrossRef]
- Hamdoun, A.; Epel, D. Embryo stability and vulnerability in an always changing world. Proc. Natl. Acad. Sci. USA 2007, 104, 1745–1750. [Google Scholar] [CrossRef] [Green Version]
- Ridlo, M.R.; Kim, G.A.; Taweechaipaisankul, A.; Kim, E.H.; Lee, B.C. Zinc supplementation alleviates endoplasmic reticulum stress during porcine oocyte in vitro maturation by upregulating zinc transporters. J. Cell Physiol. 2020. [Google Scholar] [CrossRef]
- Jin, J.X.; Lee, S.; Taweechaipaisankul, A.; Kim, G.A.; Lee, B.C. Melatonin regulates lipid metabolism in porcine oocytes. J. Pineal Res. 2017, 62, e12388. [Google Scholar] [CrossRef]
- Wanders, R.J.; Jansen, G.A.; Skjeldal, O.H. Refsum disease, peroxisomes and phytanic acid oxidation: A review. J. Neuropathol. Exp. Neurol. 2001, 60, 1021–1031. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brauns, A.K.; Heine, M.; Todter, K.; Baumgart-Vogt, E.; Luers, G.H.; Schumacher, U. A defect in the peroxisomal biogenesis in germ cells induces a spermatogenic arrest at the round spermatid stage in mice. Sci. Rep. 2019, 9, 9553. [Google Scholar] [CrossRef] [PubMed]
- Figueroa, C.; Kawada, M.E.; Véliz, L.P.; Hidalgo, U.; Barros, C.; González, S.; Santos, M.J. Peroxisomal proteins in rat gametes. Cell Biochem. Biophys. 2000, 32, 259–268. [Google Scholar] [CrossRef]
- Prates, E.G.; Nunes, J.T.; Pereira, R.M. A role of lipid metabolism during cumulus-oocyte complex maturation: Impact of lipid modulators to improve embryo production. Mediat. Inflamm. 2014, 2014, 692067. [Google Scholar] [CrossRef]
- Sturmey, R.G.; Leese, H.J. Energy metabolism in pig oocytes and early embryos. Reproduction 2003, 126, 197–204. [Google Scholar] [CrossRef] [Green Version]
- Ludtmann, M.H.; Angelova, P.R.; Zhang, Y.; Abramov, A.Y.; Dinkova-Kostova, A.T. Nrf2 affects the efficiency of mitochondrial fatty acid oxidation. Biochem. J. 2014, 457, 415–424. [Google Scholar] [CrossRef] [Green Version]
- Schafer, Z.T.; Grassian, A.R.; Song, L.; Jiang, Z.; Gerhart-Hines, Z.; Irie, H.Y.; Gao, S.; Puigserver, P.; Brugge, J.S. Antioxidant and oncogene rescue of metabolic defects caused by loss of matrix attachment. Nature 2009, 461, 109–113. [Google Scholar] [CrossRef] [Green Version]
- Schrul, B.; Kopito, R.R. Peroxin-dependent targeting of a lipid-droplet-destined membrane protein to ER subdomains. Nat. Cell Biol. 2016, 18, 740–751. [Google Scholar] [CrossRef] [PubMed]
- Dimitrov, L.; Lam, S.K.; Schekman, R. The role of the endoplasmic reticulum in peroxisome biogenesis. Cold Spring Harb. Perspect. Biol. 2013, 5, a013243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hua, R.; Kim, P.K. Multiple paths to peroxisomes: Mechanism of peroxisome maintenance in mammals. Biochim. Biophys. Acta 2016, 1863, 881–891. [Google Scholar] [CrossRef] [PubMed]
- Mayerhofer, P.U. Targeting and insertion of peroxisomal membrane proteins: ER trafficking versus direct delivery to peroxisomes. Biochim. Biophys. Acta 2016, 1863, 870–880. [Google Scholar] [CrossRef] [PubMed]
- Dubois, V.; Eeckhoute, J.; Lefebvre, P.; Staels, B. Distinct but complementary contributions of PPAR isotypes to energy homeostasis. J. Clin. Investig. 2017, 127, 1202–1214. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pawlak, M.; Lefebvre, P.; Staels, B. Molecular mechanism of PPARalpha action and its impact on lipid metabolism, inflammation and fibrosis in non-alcoholic fatty liver disease. J. Hepatol. 2015, 62, 720–733. [Google Scholar] [CrossRef] [Green Version]
- Lodhi, I.J.; Semenkovich, C.F. Peroxisomes: A nexus for lipid metabolism and cellular signaling. Cell Metab. 2014, 19, 380–392. [Google Scholar] [CrossRef] [Green Version]
- Lord, E.; Murphy, B.D.; Desmarais, J.A.; Ledoux, S.; Beaudry, D.; Palin, M.F. Modulation of peroxisome proliferator-activated receptor delta and gamma transcripts in swine endometrial tissue during early gestation. Reproduction 2006, 131, 929–942. [Google Scholar] [CrossRef] [PubMed]
- Ganguli, G.; Pattanaik, K.P.; Jagadeb, M.; Sonawane, A. Mycobacterium tuberculosis Rv3034c regulates mTORC1 and PPAR-gamma dependant pexophagy mechanism to control redox levels in macrophages. Cell Microbiol. 2020, 22, e13214. [Google Scholar] [CrossRef]
- Ishii, T.; Itoh, K.; Ruiz, E.; Leake, D.S.; Unoki, H.; Yamamoto, M.; Mann, G.E. Role of Nrf2 in the regulation of CD36 and stress protein expression in murine macrophages: Activation by oxidatively modified LDL and 4-hydroxynonenal. Circ. Res. 2004, 94, 609–616. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bartlett, D.W.; Davis, M.E. Insights into the kinetics of siRNA-mediated gene silencing from live-cell and live-animal bioluminescent imaging. Nucleic Acids Res. 2006, 34, 322–333. [Google Scholar] [CrossRef]
- Dorsett, Y.; Tuschl, T. siRNAs: Applications in functional genomics and potential as therapeutics. Nat. Rev. Drug Discov. 2004, 3, 318–329. [Google Scholar] [CrossRef]
- Zeng, G.; Apte, U.; Cieply, B.; Singh, S.; Monga, S.P. siRNA-mediated beta-catenin knockdown in human hepatoma cells results in decreased growth and survival. Neoplasia 2007, 9, 951–959. [Google Scholar] [CrossRef] [Green Version]
- Han, H. RNA Interference to Knock Down Gene Expression. Methods Mol. Biol. 2018, 1706, 293–302. [Google Scholar] [PubMed]
- Dadi, T.D.; Li, M.W.; Lloyd, K.C. Decreased growth factor expression through RNA interference inhibits development of mouse preimplantation embryos. Comp. Med. 2009, 59, 331–338. [Google Scholar] [PubMed]
Candidate (Cnds) | Target Gene | Sequences (5′-3′) RNA: (A, C, G, U]), DNA: (a, c, g, t) | GC Content | Tm | NGIC Score |
---|---|---|---|---|---|
- | Scramble | CGAACAGAUAAAGCCGCUGUAAGUA UACUUACAGCGGCUUUAUCUGUUCG | - | - | - |
Cnd1 | PEX19 | GAGAUCUCCAGGAGACACU=tt AGUGUCUCCUGGAGAUCUC=tt | 0.53 | 59.96 | 98 |
Cnd2 | PEX19 | CGUGACUUUCCCUCAGGUU=tt AACCUGAGGGAAAGUCACG=tt | 0.53 | 59.51 | 98 |
Cnd3 | PEX19 | CACUACACCCUCUUACCUU=tt AAGGUAAGAGGGUGUAGUG=tt | 0.47 | 58.66 | 91.9 |
Genes | Primer Sequences (5′-3′) | Product Size (bp) | Accession No. |
---|---|---|---|
GAPDH | F: GTCGGTTGTGGATCTGACCT R: TTGACGAAGTGGTCGTTGAG | 207 | NM_001206359 |
NRF2 | F: GCCCAGTCTTCATTGCTCCT R: AGCTCCTCCCAAACTTGCTC | 115 | XM_013984303 |
PEX3 | F: AATGCATCTTCCTGGGGACG R: ATACTGTCGTCGTGCTTGGG | 125 | NM_001244185.1 |
PEX19 | F: CTCAATCTATCGGGCCCACC R: TAGACGACACTCCTGCCTCA | 144 | XM_001928869.5 |
PPARγ | F: CCATTCCCGAGAGCTGATCC R: TTTATCCCCACAGACACGGC | 192 | XM_005669783.3 |
ATGL | F: GACGGTGGCATCTCAGACAA R: TGGATGTTGGTGGAGCTGTC | 113 | NM_001098605.1 |
HSL | F: GCCTTTCCTGCAGACCATCT R: CACTGGTGAAGAGGGAGCTG | 104 | NM_214315.3 |
MGLL | F: ACCCCACAGAGTGTCCCATA R: GGGTGTAGCTGAGGGTTTCC | 96 | XM_013982013.2 |
CGI58 | F: TCTTGCTGGGACACAACCTG R: CCAAAGGGTCCTGCAATCCT | 220 | NM_001012407.1 |
BAX | F: CATGAAGACAGGGGCCCTTT R: CATCCTCTGCAGCTCCATGT | 181 | XM_003127290 |
BCL2 | F: AATGTCTCAGAGCAACCGGG R: GGGGCCTCAGTTCTGTTCTC | 193 | NM_214285 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, E.-H.; Ridlo, M.-R.; Lee, B.-C.; Kim, G.A. Crosstalk between Peroxisomal Activities and Nrf2 Signaling in Porcine Embryos. Antioxidants 2021, 10, 771. https://doi.org/10.3390/antiox10050771
Kim E-H, Ridlo M-R, Lee B-C, Kim GA. Crosstalk between Peroxisomal Activities and Nrf2 Signaling in Porcine Embryos. Antioxidants. 2021; 10(5):771. https://doi.org/10.3390/antiox10050771
Chicago/Turabian StyleKim, Eui-Hyun, Muhammad-Rosyid Ridlo, Byeong-Chun Lee, and Geon A. Kim. 2021. "Crosstalk between Peroxisomal Activities and Nrf2 Signaling in Porcine Embryos" Antioxidants 10, no. 5: 771. https://doi.org/10.3390/antiox10050771