Next Article in Journal
Molecular Diversity of Three Forensically Relevant Dipterans from Cadavers in Lahore, Pakistan
Previous Article in Journal
Impact of Irradiated Drosophila melanogaster Pupae on the Quality and Population Parameters of Trichopria drosophilae
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 16
Issue 4
10.3390/insects16040380
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative Transcriptome Analysis of the Effects of a Non-Insect Artificial Diet on the Nutritional Development of Harmonia axyridis

by
Tingting Zhang
1,2,
Yinchen Yu
1,
Jianyu Li
3,
Li Zheng
4,
Shiwei Chen
1 and
Jianjun Mao
5,*
1
School of Advanced Manufacturing, Fuzhou University, Jinjiang 362251, China
2
Jinjiang City Fuzhou University Science and Education Park Development Center, Fuzhou University, Jinjiang 362251, China
3
Stockbridge School of Agriculture, University of Massachusetts Amherst, Amherst, MA 01003, USA
4
Key Laboratory of Marine Eco-Environmental Science and Technology, First Institute of Oceanography, Ministry of Natural Resources, Qingdao 266061, China
5
State Key Laboratory for Biology of Plant Diseases and Insect Pests, Key Laboratory of Natural Enemy Insects, Ministry of Agriculture and Rural Affairs, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, China
*
Author to whom correspondence should be addressed.
Insects 2025, 16(4), 380; https://doi.org/10.3390/insects16040380
Submission received: 3 December 2024 / Revised: 27 March 2025 / Accepted: 27 March 2025 / Published: 3 April 2025
(This article belongs to the Section Insect Physiology, Reproduction and Development)
Browse Figures
Versions Notes

Simple Summary

The Harmonia axyridis is an important natural enemy insect that has received widespread attention in research and the application of biological pest control. Currently, suitable artificial feed for the mass-rearing of the H. axyridis has not been found, which affects the application of this natural enemy in biological control. This study found that the egg production of artificial feed without added egg yolk is similar to that of artificial feed without added egg yolk supplemented with juvenile hormone III. Compared to the control artificial feed, the egg production significantly increased, which is of great significance for further exploring the effects of non-insect source artificial feed on the growth and development of the H. axyridis.

Abstract

Artificial diets applied in the mass-rearing propagation of H. axyridis can improve reproductive ability by optimizing the feeding formula. This study used transcriptome data to investigate the effects of various artificial diets on the growth and development of H. axyridis. Results indicate that spawning increased with the low-fat and JH III-supplemented artificial diet (Diet 3). Furthermore, the highest glycogen content found in Diet 3 was significantly different from the other two groups. Triglyceride content decreased as adult feeding time increased in the three artificial diet groups, with the fastest decrease observed in the low-fat diet (Diet 2). Protein content increased gradually in the high-fat diet (Diet 1) group compared to the other treatment groups. The adults reared on low-fat artificial diets, when compared to those on artificial diets supplemented with juvenile hormones at the transcriptome level, were found to have upregulated genes enriched in ubiquitin-mediated proteolysis, ribosome biogenesis, and the hedgehog signaling pathway. In contrast, the genes upregulated in the latter group were enriched in oxidative phosphorylation, amino acid biosynthesis, and the metabolism of other amino acids. The results suggest that nutritional status significantly affects the growth and development of H. axyridis and has practical implications for the artificial feeding of natural pest enemies.

1. Introduction

Harmonia axyridis, as an important natural enemy, plays a crucial role in biological control. It exhibits strong stress resistance, high prey consumption, and a broad prey spectrum, primarily preying on agricultural pests such as aphids, coccids, lepidopteran eggs, and other insects [1,2]. With the development of global biological control, H. axyridis has been introduced into various countries in North America, South America, Europe, and Africa [3]. Currently, mass-rearing practices for H. axyridis rely on natural prey, making the process costly and labor-intensive [2]. Since the nutritional composition of insect-based sources shares the same insect origin as ladybirds’ natural food, their nutritional categories and contents are closer to natural diets. Consequently, insect-based diets have been more widely applied in ladybird artificial feeding systems. However, they present challenges including complex prey-rearing processes, higher costs, and difficulty in material acquisition. In contrast, non-insect-based artificial diets offer advantages such as easier material availability, lower costs, and more convenient management [4]. The mass-rearing propagation of H. axyridis remains an important issue that needs to be addressed. In Japan, artificial diets and drone pupal feeds were used to show that potassium ions and water-soluble substances from drone pupae promote the capacity of H. axyridis [5,6]. Zhang et al. compared the amino acid content of artificial diets and pea aphids for H. axyridis by measuring and adding three limiting amino acids to the diet using relative content calculations but found no significant effect [7]. This suggests that simply supplementing amino acids does not improve the feeding effect of artificial diets. We can only add amino acids that are lacking in the diet and cannot remove excess amino acids compared to natural prey, leading to an amino acid nutritional imbalance or nutritional overdose toxicity. Ricupero found that a mixture of moth eggs and brine shrimp cysts supported the rearing of H. axyridis [8]. Seko et al. revealed that the combination of A. salina cysts with sucrose positively influences the reproduction and biocontrol activity of flightless H. axyridis populations in greenhouse [9]. A liver-based artificial diet was tested, but H. axyridis reared on this diet did not develop successfully [10]. Specty et al. found that E. kuehniella eggs were nutritionally superior to A. pisum in terms of amino acid and fatty acid content and composition [11]. The expansion of natural enemy insects is affected by seasons, climate, and geography, resulting in limitations in stability and sustainability during the feeding process [12]. Non-insect-derived artificial diets have a wide range of inexpensive sources that can reduce the feeding costs of H. axyridis. However, non-insect-derived artificial diets can also directly affect the reproductive capacity of H. axyridis. For example, adult ladybirds fed egg yolk, beef liver, etc., do not lay eggs, but when the diet is changed to aphids, the female egg-laying ability was significantly improved [13].
In recent years, research on non-insect-derived artificial diets for H. axyridis has been limited, with persistent challenges in addressing developmental delays and reproductive degeneration. These unresolved issues significantly hinder the advancement of artificial diet formulations and impede the mass production of this species for biocontrol applications. The main components of non-insect-derived artificial feed for ladybugs are pork liver and yeast. Li et al. explored the effects of different diets on survival and reproduction [14]. They found that adding glucose and trehalose to non-insect-derived artificial feed significantly increased the egg-laying capacity of H. axyridis. Huang et al. demonstrated that different diets affect the abundance of gut microbiota and biological parameters such as the hatching time, developmental period, lifespan, pupal stage, and survival rate [15]. Zhang et al. added vitellogenin (Vg) to artificial feed and found that adding Vg improved the reproductive capacity of H. axyridis [16]. Some artificial feeds using eggs are rich in nutrients, such as fat and protein; egg yolks contain high cholesterol (12–15 mg/g) [17]. According to previous reports, the sterol components in insect feed are not crucial, and only a small amount of cholesterol in the feed supports the growth and development of insects. Regardless of their structure, cholesterol and other sterols are used for non-metabolic purposes [18]. Female fruit flies fed diets containing high protein levels had smaller ovaries and showed less active oogenesis. These studies show that female fruit flies fed diets containing high protein levels exhibit decreased fertilization rates and delayed offspring development [19].
The nutrient intake and hormones of insects are critical factors that determine their growth, development, and reproductive status. Among them, lipids are the main way to store energy [20]. Larval tissue formation in embryogenesis depends on maternally derived yolk proteins, while adult tissue growth during metamorphosis utilizes amino acids from hexamerins stored in the body fat before pupariation [21]. Glycogen, the primary carbohydrate reserve in Drosophila, serves as a critical metabolic safeguard [22]. Triacylglycerols (TAG) play an important role in the maintenance of energy homeostasis [23]. To date, eight different types of JHs have been identified in insects: JH 0, JH I, JH II, JH III, 4-methyl JH I, bis-epoxide JH III (JHB III), skipped bis-epoxide (JHSB III), and methyl farnesoate (MF). Methyl farnesoate, 10,11-epoxide (JH III) is the most common JH in insects [24]. JH III can promote oogenesis, but the removal of the allatectomy will eliminate this effect [25]. It regulates insect growth, development, and reproductive capacity [26]. Additionally, adding juvenile hormone analogs to the feed significantly shortened the pre-oviposition period of Coccinella septempunctata, although it reduced the survival rate and increased reproductive capacity [27].
We removed egg yolk from the artificial feed to reduce cholesterol, added juvenile hormone analogs [28], and examined the effects of different artificial feeds on the laying capacity of H. axyridis. We found that Diet 2 and Diet 3 improved the reproductive capacity compared to Diet 1. We also discovered genes related to reproductive regulation. The results of this study lay a foundation for enhancing ladybug reproduction and provide theoretical support for mass-rearing and biological control.

2. Materials and Methods

2.1. Insect Rearing

The Harmonia axyridis were raised in the laboratory of Jinjiang Campus of Fuzhou University. They were continuously fed on pea aphids for more than three generations in the laboratory. The pupae of the tested ladybugs were fed with three different artificial feeds after they emerged. The experimental adults were reared in artificial climate chambers at a temperature of 25 °C with a 16 h of light and 8 h of dark (16 L: 8 D) photoperiod in the laboratory at 65% ± 5% relative humidity. Three types of diets were tested in this study: (1) Diet 1: artificial diet to feed H. axyridis; (2) Diet 2: Diet 1 without egg yolks; (3) Diet 3: juvenile hormone III was added to Diet 2 (Aladdin, Shanghai, China). Artificial Diet 1 was formulated based on the protocol established by Lu et al. with slight modifications [29]. The artificial diet used to feed H. axyridis includes the main components of pork liver, eggs, sugar, and yeast. All diet preparations were conducted under laboratory conditions, where the formulated diets were portioned into aliquots and cryopreserved at −20 °C until further experimental application (Table 1).

2.2. Fecundity

The reproductive capacity of the H. axyridis adults was assessed under three different artificial diets. On the first day after emergence, female and male adults were paired and placed in individual boxes for rearing. They were provided with sufficient artificial diet daily, and observations were conducted every 24 h. Each treatment included 15 replicate pairs. The following reproductive indicators were recorded: pre-oviposition period, egg weight, hatching rate, and total egg production over 30 days. This study focuses on the direct impact of artificial feed on reproductive efficiency. Since the adult lifespan of H. axyridis is relatively long and oviposition occurs over an extended period, only the cumulative number of eggs laid within 30 days from the first oviposition was counted.

2.3. Dietary Effects on Ovarian Development

Females were randomly selected on day seven post-emergence. The ovaries were dissected in saline solution (125 mM NaCl, 5 mM KCl, and 1.85 mM CaCl2, pH 6.5) (Millipore Sigma, Burlington, MA, USA), disrupted with a needle, and observed at 20-fold magnification (SZX16-ILLT; Olympus, Tokyo, Japan). Three replicates were performed for each group.

2.4. Measurement of Energy Substances in Different Artificial Diets for H. axyridis

Adult female insects on days 0th, 10th, 20th, and 30th day of emergence were ground with liquid nitrogen. Samples (0.1 g) were ground, treated with PBS, centrifuged, and the supernatants were collected. The protein content in the supernatant was determined using the BCA method [30]. Finally, the absorbance of the solution was measured at 562 nm after the reaction ended to calculate protein content. Glycogen content was determined using the anthrone method [31]. The sample was digested in boiling sodium hydroxide, alkaline lysate deproteinization via perchloric acid, ethanol-mediated precipitation, ethanol washing, and anthrone reagent-based colorimetric quantification. Absorbance of the test solution was measured at 620 nm. The triglyceride (TAG) content was measured using Mukherjee and Mishra’s spectrophotometric assay [32]. The triglyceride (TAG) content was determined by adding 0.1 g of sample to a mixture of 1 mL of n-heptane and isopropanol (volume ratio 1:1), homogenizing it in an ice bath, centrifuging at 8000× g and 4 °C for ten minutes, taking the supernatant, and measuring the absorbance at 420 nm using a Multiscan SkyHigh spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Each reaction was performed in triplicate with three biological replicates.

2.5. Illumina Sequencing for Transcriptome Analysis

Total RNA was extracted from 7-day-old post-emergence female adults (3 adults per sample for every biological replicate) using EasyPure® Simple Viral DNA/RNA Kit (Trans, Beijing, China) according to the manufacturer’s protocols, and then reverse transcribed and amplified using an Ovation Trio RNA Seq Library Preparation Kit (Trans, Beijing, China). The subsequent libraries were sequenced with an Illumina Novaseq platform at Novagene (Beijing, China). Raw sequencing data quality was evaluated using FastQC [33]. To obtain high-quality clean reads, technical artifacts in FASTQ files including adapter sequences, PCR primers, residual fragments, and bases with Phred scores ≤ 20 were trimmed using Cutadapt [34]. De novo transcriptome assembly was performed using Trinity software (http://TrinityRNASeq.sourceforge.net, accessed on 1 June 2024) with the filtered RNA-seq data [35]. Redundant contigs were clustered and removed via CD-HIT, generating a non-redundant unigene dataset. Differentially expressed genes (DEGs) were identified using the DESeq2 Bioconductor package, with thresholds set at |log2 Fold Change| ≥ 0 and a false discovery rate (FDR) < 0.05 [36]. Read data were submitted to NCBI SRA under accession PRJNA1053861.
The unigenes were searched by BLASTX against the non-redundant (Nr) protein database (http://www.ncbi.nlm.nih.gov/, accessed on 2 June 2024), Gene ontology (GO) (http://www.geneontology.org, accessed on 3 June 2024), Clusters of Orthologous Groups (COG) (http://www.ncbi.nlm.nih.gov/COG/, accessed on 6 June 2024), SwissProt (http://www.expasy.ch/sprot/, accessed on 7 June 2024), and the Kyoto Encyclopedia of Genes and Genomes (KEGG) (http://www.genome.jp/kegg/, accessed on 10 June 2024) database with a significant p-value less than 0.05. GO, COG, and KEGG enrichment analyses were performed on the significant DEGs by perl scripts in house.

2.6. Identification of Differentially Expressed Transcripts

Differential expression analyses of control and treatment groups were performed using the DESeq2 R package (version 1.20.0). DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on a negative binomial distribution. The resulting p-values were adjusted using Benjamini and Hochberg’s approach to control for the false discovery rate. Genes with an adjusted p-value ≤ 0.05 found by DESeq2 were assigned as differentially expressed.

2.7. Real-Time Quantitative PCR (qRT-PCR) Analysis

The primers for the target and reference genes were designed using the online Primer 3 program and are listed in Table 2. Actin was used as the internal reference gene. The qRT-PCR reaction volume of 20 µL contained 2 µL of cDNA template, 0.4 µL of forward and reversed primers, 10 µL 2× TransStart® Green qPCR SuperMix, 0.4 µL of Passive Reference Dye (50×), and 6.8 µL of nuclease-free water (TransGen Biotech Co., Ltd., Beijing, China). The PCR reaction program was as follows: 94 °C for 30 s, followed by 45 cycles of denaturation at 94 °C for 5 s, 55 °C for 15 s, and an extension of 72 °C for 10 s. Real-time PCR was performed using an ABI Prims7500 system.

2.8. Statistical Analysis

The nonparametric Kruskal–Wallis’s test determined differences in net total eggs and pre-oviposition. The egg weights, hatching rates, protein glycogen, and triglyceride content results were determined using a one-way analysis of variance (ANOVA Least Significant Difference test). The mean values of replicates were expressed as mean ± standard error (SE, n = 3), and p-value ≤ 0.05 was considered statistically significant. Data were analyzed using SPSS software (version 16.0; SPSS, Chicago, IL, USA).

3. Results

3.1. Effects of Different Artificial Diets on H. axyridis Reproduction

The effects of the different artificial diets on the development and reproduction of H. axyridis were evaluated. Feeding different diets for 30 days resulted in different egg weights of 1.73, 1.83, and 1.77 mg, respectively, (F = 3; df = 2; p = 0.125) and different hatching rates at 83.33%, 85.00%, and 86.67%, respectively (F = 0.176; df = 2; p = 0.842). There were no significant effects on egg weight or hatchability of H. axyridis. During the 30-day oviposition period, our results indicate that the Diet 1, Diet 2, and Diet 3 females laid a total of 4.25, 29.05, and 24.65 eggs (average number of total eggs per female during the first 30 days), respectively. Total fecundity significantly differed between the Diet 2 and Diet 3 or Diet 1 group (χ2 = 7.486; df = 2; p = 0.024). Similarly, the pre-oviposition time of 12.78 and 10.90 days for Diet 2 and Diet 3 groups was significantly lower than that of Diet 1. There were significant effects on pre-oviposition time (the period from emergence to the first egg-laying) (χ2 = 5.588; df = 2; p = 0.061) (Table 2).
Table 2. Developmental and reproduction characteristics of H. axyridis fed on different diets.
Table 2. Developmental and reproduction characteristics of H. axyridis fed on different diets.
GroupTotal EggEgg Weight/mgHatchability/%Pre-Oviposition/Days
Diet 14.25 ± 2.24 b1.73 ± 0.03 a83.33 ± 0.36 a19.75 ± 3.68 a
Diet 223.58 ± 8.73 a1.83 ± 0.03 a85.00 ± 0.24 a13 ± 1.17 b
Diet 324.65 ± 6.8 a1.77 ± 0.03 a86.67 ± 0.36 a11 ± 0.69 b
Means ± SE of net total egg and pre-oviposition followed by different letters within a column indicate significant differences determined by the Kruskal–Wallis test (p < 0.05). The table’s egg weight and hatching rates are expressed as mean ± SE; the same letters within a column indicate no significant differences (One-way ANOVA test, p < 0.05).

3.2. Arrest of Ovarian Development After Feeding Different Artificial Diets

Mature ovaries did not significantly differ between Diet 2 and Diet 3 insects. Adult females that emerged from different artificial diets were dissected five days post-eclosion. Diet 2 and Diet 3 groups showed more mature ovaries, egg chambers, and larger ovary scales than Diet 1 (Figure 1).

3.3. Effects of the Artificial Diets on Protein, Glycogen, and Triglyceride Content

The effects of artificial diets on protein, glycogen, and triglyceride contents were determined. We found no significant difference in the protein content of adult females on the 1st day of emergence. As the feeding time increased, the protein content in the Diet 3 group was significantly higher than that in the Diet 1 and Diet 2 groups on the 10th (F = 9218.847; df = 2; p < 0.001), 20th (F = 369.016; df = 2; p < 0.001), and 30th days (χ2 = 7.261; df = 2; p = 0.027) after emergence. The glycogen content on the 10th day (F = 831.353; df = 2; p < 0.001), 20th day (F = 942.361; df = 2; p < 0.001), and 30th day (F = 1165.412; df = 2; p < 0.001) were significantly affected by the different artificial diets. There were significant differences in triglyceride content on the 10th day (F = 60,867.206; df = 2; p < 0.001), 20th day (F = 16,504.961; df = 2; p < 0.001) and 30th day (χ2 = 7.322; df = 2; p = 0.026) (Figure 2).

3.4. Transcriptome Assembly and Differentially Expressed Genes

Libraries of control samples (Diet1-1, Diet1-2, and Diet1-3), libraries treated with sample 1 (Diet2-1, Diet2-2, Diet2-3), and sample 2 (Diet3-1, Diet3-2, and Diet3-3) were collected (only nine samples were analyzed by differential expression genes, DEGs). Three biological replicates were used for each sample. We obtained nine libraries containing clean reads (Diet1-1:42099192; Diet1-2:41807246; Diet1-3:42138400; Diet2-1:41918970; Diet2-2:44428656; Diet2-3:42094054; Diet3-1:44049024; Diet3-2:43360852; Diet3-3:44010148), generated for analysis after cleaning and checking. The percentage of GC content was analyzed in all nine libraries (Diet1-1: 39.36; Diet1-2: 38.19; Diet1-3: 39.28; Diet2-1: 39.26; Diet2-2: 39.02; Diet2-3: 38.06; Diet3-1: 39.21; Diet3-2: 38.69; Diet3-3: 38.52). The nine libraries of percentage ≥ Q30 were 94.17, 93.28, 93.95, 94.45, 93.75, 94.17, 93.95, 94.29, and 93.74%, respectively (Table 3).
To explore the effects of different artificial feeds on the molecular mechanisms of H. axyridis, we used |log2 Fold Change| ≥ 0 and false discovery rate (FDR)-adjusted p value ≤ 0.05 to detect the differentially expressed genes (DEGs) in each group. Comparing Diet 2 with Diet 1, there were 2050 differentially expressed genes in the transcriptome, of which 1437 were upregulated and 613 were downregulated in Diet 2. Comparing Diet 3 with Diet 1, there were 1240 differentially expressed genes in the transcriptome, of which 550 were upregulated and 690 were downregulated in Diet 3. Comparing Diet 3 to Diet 2, there were 2336 differentially expressed genes in the transcriptome, of which 852 were upregulated, and 1484 were downregulated in Diet 3 (Figure 3).

3.5. GO Functional Annotation and KEGG Enrichment Analysis of DEGs

GO enrichment analysis was performed on DEGs, and the GO terms were screened with p value ≤ 0.05. Comparing Diet 2 with Diet 1, 901 GO terms were successfully annotated, including 243 biological processes, 331 cellular components, and 327 molecular functions. In the molecular function category, the DEGs were mainly enriched in the structural constituents of the cuticle, ion channel activity, and substrate-specific channel activity. Comparing Diet 3 to Diet 1, 648 GOs were annotated, including 183 biological processes, 146 cellular components, and 319 molecular functions. These genes were mainly enriched in the oxidation-reduction process, cofactor binding, and oxidoreductase activity. Comparing Diet 3 to Diet 2, 642 GOs were annotated, including 154 biological processes, 149 cellular components, and 339 molecular functions. DEGs were mainly enriched in transmembrane transporter activity, responses to stimuli, and transmembrane transport (Figure 4).
The results showed the function of DEGs in different artificial diets using KEGG pathway analysis. In addition, comparing Diet 2 to Diet 1 in the KEGG pathway also included “DNA replication”, “ribosome biogenesis in eukaryotes”, “ubiquitin-mediated proteolysis”, and the “Toll and Imd signaling pathway”. Comparing Diet 3 to Diet 1, the enrichment KEGG pathway showed “biosynthesis of cofactors”, “oxidative phosphorylation”, “drug metabolism-other enzymes”, and “glycerolipid metabolism”. Comparing Diet 3 to Diet 2, the enrichment KEGG pathway involved “insect hormone biosynthesis”, “fatty acid metabolism”, and the “phosphatidylinositol signaling system” (Figure 5).

3.6. Identification of Development-Related Genes Differentially Expressed Under Different Artificial Diets

To validate the DEGs determined from the transcriptome results, reproduction- and nutrition-related genes were selected from the qRT-PCR analysis results. The genes and primers used for qRT-PCR are listed in Table 3. The expression trends of the 11 genes were consistent with the transcriptome sequencing results (Figure 6), indicating the high reliability of the RNA-seq results. Thus, qRT-PCR analysis confirmed the directional change in gene expression detected in the previous DEG analysis (Table 4).

4. Discussion

Natural prey is considered the optimal food source for the growth and development of lady beetles. However, its application in mass rearing is constrained by high costs, operational complexity, and dependency on host plant availability. Artificial diets, in contrast, circumvent these limitations. Nevertheless, studies have demonstrated suboptimal reproductive outcomes in lady beetles fed artificial diets. Chen reported that the seven-spotted lady beetle (Coccinella septempunctata) fed artificial diets exhibited a reproductive diapause-like state, characterized by delayed development of reproductive cells [37]. Additionally, their consumption rates were only one-fifth of those fed aphids. Similarly, Zhang found that the daily egg production of the striped lady beetle (Propylea japonica) reared on a pork liver-based artificial diet was significantly lower than that of the aphid-fed group [38]. Although artificial diets significantly prolonged adult longevity compared to aphid-fed groups, they resulted in markedly reduced fecundity [7].
The present study compared the effects of different non-insect artificial diets on the growth and development of H. axyridis. The primary nutritional component of egg yolk is fat. Fat and cholesterol mutually influence each other during metabolic processes [39]. For instance, when fat intake is excessive, fat may be transformed into cholesterol through a series of biochemical reactions, thereby causing an increase in cholesterol levels within the body of insects [40]. However, the effects of cholesterol on insect reproduction are not always linear. Excessively high cholesterol concentrations may exert an inhibitory effect on insect reproduction [41]. Previous studies have shown that high concentrations of cholesterol interfere with the normal synthesis and metabolic processes of hormones in insects, leading to abnormal development or functional impairment of the reproductive organs [41]. This study revealed that the total number of eggs in the low-fat diet was significantly higher than in the high-fat diet. Feeding a low-fat diet and juvenile hormone III accelerated ovary maturation and elevated reproductive performance in previtellogenic females, suggesting that vitellogenesis plays a crucial role in the reproductive regulation of H. axyridis. In Blatella germanica, JH regulates reproductive processes, including previtellogenic development, vitellogenesis, and oogenesis [42]. Li et al. demonstrated that the solid reproductive ability of A. craccivora was closely related to JH III [43]. Our results indicate that an artificial diet with egg yolk removal can promote egg laying, and an artificial diet supplemented with juvenile hormones can also increase fecundity in adults; however, there was no significant difference compared with the egg yolk removal group (Table 2).
Comparative transcriptomic analysis revealed that some DEGs affected the reproductive ability of H. axyridis. When annotating the DEGs, we focused on the expression of genes related to development and reproduction. Comparing Diet 2 with Diet 1, we first found upregulation of the insulin gene enhancer protein ISL-1 (Islet-1), cuticle protein, vitellogenin, eclosion hormone (EH), and Lethal (2) essential for life [l(2)efl] and vitellogenin receptors, which participate in development. Islet-1 is important in developing and forming various organs and tissues [44]. The insect exoskeleton (cuticle) is composed of chitin and cuticle proteins. Recently, cuticle proteins have been attractive models for studying time- and tissue-specific cell differentiation mechanisms during animal development [45]. Cuticle protein genes are involved in insect development and cuticle formation during ecdysis [46]. It is essential to take up vitellogenin and dominate ovary maturation in insects. This study observed increased expression of the vitellogenin receptor (VgR) [47]. VgR is essential in Vg uptake, enhancing oocyte maturation and insect fecundity [48]. The total number of eggs spawned increased in Diet 2. Jing et al. found that JH stimulates VgR phosphorylation and that phosphorylated VgR migrates from the oocyte cytoplasm to the cell membrane, where it binds to Vg and undergoes VgR/Vg endocytosis [49]. Its role is crucial in regulating vitellogenin metabolism in oocytes. This process is essential for oocyte development and maturation and contributes to successful reproduction in various species. Elevated Vg and VgR expression levels may have important implications for understanding reproductive physiology and identifying potential targets for further research. EH, a neurohormone critical for modulating insect pre-ecdysis behavior, orchestrates behavioral transitions during the terminal phase of each molting cycle [50]. Research has found that l(2)efl in D. melanogaster are continuously expressed during development. While the mechanism is unclear, this l(2)efl homolog induces phosphorylation of eukaryotic initiation factor 2α (eIF2α), thereby inhibiting protein biosynthesis [51].
Comparing Diet 3 with Diet 1, our transcriptome analysis revealed a significant increase in Vg, juvenile hormone acid O-methyltransferase, glucose dehydrogenase (GLD), folliculin-interacting protein (FNIP), and G protein-coupled receptor G4 (ADGRG4) expression in Diet 3, crucial for egg development and reproduction in many species. Vitellogenin (Vg), a key precursor of the yolk protein vitellin (Vn), functions as a vital energy reserve in oviparous species [16]. Vgs are synthesized predominantly in body fat cells in a tissue-, sex-, and stage-specific manner. These proteins are then secreted into the hemolymph and internalized by developing oocytes through receptor-mediated endocytosis [52]. Vg affects oocyte maturation, egg formation, and insect embryonic development [53]. In addition, juvenile hormone acid O-methyltransferase (JHAMT) has been suggested as a crucial enzyme in the JH-branch, regulating juvenile hormone synthesis [54]. JH is a gonadotropin that induces the synthesis of yolk proteins in body fat and promotes ovarian development [55]. The upregulation of GLD observed in our transcriptome data is consistent with findings in honeybees, where increased GLD activity was shown to be significantly correlated with ovarian development [56]. This conserved mechanism suggests that the artificial diet may enhance reproductive efficiency through similar nutrient-sensing pathways. FNIP1, as a substrate of AMPK, regulates the translocation of TFEB to the nucleus, thereby enhancing lysosomal and mitochondrial biogenesis under metabolic stress conditions [57]. He6 has demonstrated an essential role of this AGPCR in spermatogenesis and fertility [58].

5. Conclusions

The work presented here showed that removing egg yolks from an artificial diet increased egg production in H. axyridis. In addition, adding JH III to Diet 2 also increased egg production compared to Diet 1, but there was no difference in egg production between Diet 2 and Diet 3 groups. Therefore, low-fat artificial feed is suitable for rearing H. axyridis. Feed formulation optimization and efficiency enhancement will be required to fulfill the requirements for the mass-rearing, artificial breeding, and biological control of H. axyridis. Although this paper confirmed that low-fat artificial diets can effectively support the rearing of adult H. axyridis through studying the effects of different artificial diets on the growth and development of H. axyridis, it should be particularly noted that the current study did not involve functional verification experiments of key candidate genes (such as Vg and FNIP) (e.g., RNA interference (RNAi) technology). This limitation stems from the fact that such studies usually focus on the macroscopic effect assessment of artificial diets on insect phenotypes (such as growth and development, reproductive performance), rather than the analysis of their molecular regulatory mechanisms. Based on this, subsequent studies will systematically analyze the regulatory network of nutrition signal pathway-related genes such as Vg and FNIP in the nutrition metabolism of H. axyridis, especially their dynamic response mechanisms to artificial diet components. Such functional verification studies are of crucial significance for transforming transcriptomic discoveries into targeted feed optimization strategies and will also provide theoretical support for establishing a precise feeding system based on molecular mechanisms.

Author Contributions

Conceptualization, J.M.; methodology, T.Z., Y.Y. and S.C.; software, Y.Y.; validation, Y.Y., S.C. and L.Z.; formal analysis, Y.Y.; investigation, Y.Y.; resources, T.Z.; data curation, S.C.; writing—original draft preparation, T.Z. and Y.Y.; writing—review and editing, T.Z. and J.M.; visualization, J.M. and J.L.; supervision, J.L.; project administration, T.Z.; funding acquisition, T.Z. and J.L. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Science and Technology Plan Project of Quanzhou City (No. 2021N040); the MNR Key Laboratory of Eco-Environmental Science and Technology, China (No. MEEST-2023-05); the Natural Science Foundation of Fujian Province (No. 2024J08148); and the Education and Research Foundation of the Ministry of Education of Fujian Province for Young Teachers (No. JAT220031).

Data Availability Statement

The raw reads of the transcriptome sequencing were deposited in NCBI under the project of PRJNA1191902.

Conflicts of Interest

The authors declare that there are no conflicts of interest.

References

  1. Ferran, A.; Niknam, H.; Kabiri, F.; Picart, J.L.; De Herch, C.; Brun, J.; Iperti, G.; Lapchin, L. The use of Harmonia axyridis larvae (Coleoptera: Coccinellidae) against Macrosiphum rosae (Hemiptera: Sternorrhyncha: Aphididae) on rose bushes. Eur. J. Entomol. 1996, 93, 59–67. [Google Scholar]
  2. Yasuda, H.; Takagi, T.; Kogi, K. Effects of conspecific and heterospecific larval tracks on the oviposition behaviour of the predatory ladybird, Harmonia axyridis (Coleoptera: Coccinellidae). Eur. J. Entomol. 2000, 97, 551–553. [Google Scholar] [CrossRef]
  3. Brown, P.M.J.; Thomas, C.E.; Lombaert, E.; Jeffries, D.L.; Estoup, A.; Lawson Handley, L.J. The global spread of Harmonia axyridis (Coleoptera: Coccinellidae): Distribution, dispersal and routes of invasion. BioControl 2011, 56, 623–641. [Google Scholar] [CrossRef]
  4. Dang, G.R.; Zhang, Y.; Chen, H.Y.; Zhang, L.S.; Wang, M.Q.; Liu, C.X. Effect of Different Artificial Diets on the Development and Fecundity of the Green Lacewing Chrysopa pallens (Rambur). Sci. Agric. Sin. 2012, 45, 4818–4825. [Google Scholar] [CrossRef]
  5. Niijima, K.; Takahashi, H. Nutritional studies of an aphidophagous coccinellid, Harmonia axyridis: II. Significance of Minrals for Larval Growth. Appl. Entomol. Zool. 1980, 12, 325–329. [Google Scholar] [CrossRef]
  6. Niijima, K.; Takahashi, H. Nutritional studies of an aphidophagous coccinellid, Harmonia axyridis. IV. Effects on reproduction of a chemically defined diet and some fractions extracted from drone honeybee brood. Bull. Fac. Agric. Tamagawa Univ. 1980, 20, 47–55. [Google Scholar]
  7. Zhang, S.; Mao, J.; Zeng, F. Effects of an artificial diet with non-insect ingredient on biological characteristics of Harmonia axyridis (Pallas). Chin. J. Biol. Control 2015, 31, 35–40. [Google Scholar]
  8. Morales-Ramos, J.A.; Rojas, M.G.; Coudron, T.A. Artificial diet development for entomophagous arthropods. In Mass Production of Beneficial Organisms: Invertebrates and Entomopathogens; Morales-Ramos, J.A., Rojas, M.G., Shapiro-Ilan, D.I., Eds.; Elsevier: New York, NY, USA, 2014; pp. 203–240. [Google Scholar]
  9. Seko, T.; Abe, J.; Miura, K. Effect of supplementary food containing Artemia salina on the development and survival of flightless Harmonia axyridis in greenhouses. BioControl 2019, 64, 333–341. [Google Scholar] [CrossRef]
  10. Ricupero, M.; Dai, C.; Siscaro, G.; Russo, A.; Biondi, A.; Zappalà, L. Potential diet regimens for laboratory rearing of the harlequin ladybird. BioControl 2020, 65, 583–592. [Google Scholar] [CrossRef]
  11. Specty, O.; Febvay, G.; Grenier, S.; Delobel, B.; Piotte, C.; Pageaux, J.; Ferran, A.; Guillaud, J. Nutritional plasticity of the predatory lady beetle Harmonia axyridis (Coleoptera: Coccinellidae): Comparison between natural and substitution prey. Arch. Insect Biochem. Physiol. 2003, 52, 81–91. [Google Scholar] [CrossRef]
  12. Sighinolfi, L.; Febvay, G.; Dindo, M.L.; Rey, M.; Pageaux, J.; Baronio, P.; Grenier, S. Biological and biochemical characteristics for quality control of Harmonia axyridis (Pallas) (Coleoptera, Coccinellidae) reared on a liver-based diet. Arch. Insect Biochem. Physiol. 2008, 68, 26–39. [Google Scholar] [CrossRef] [PubMed]
  13. Silva, R.B.; Zanuncio, J.C.; Serrão, J.E.; Lima, E.R.; Figueiredo, M.L.C.; Cruz, I. Suitability of different artificial diets for development and survival of stages of the predaceous ladybird beetle Eriopis connexa. Phytoparasitica 2009, 37, 115–123. [Google Scholar] [CrossRef]
  14. Li, Y.; Wang, S.; Liu, Y.; Lu, Y.; Zhou, M.; Wang, S.; Wang, S. The Effect of Different Dietary Sugars on the Development and Fecundity of Harmonia axyridis. Front. Physiol. 2020, 11, 574851. [Google Scholar] [CrossRef]
  15. Huang, Z.; Zhu, L.; Lv, J.; Pu, Z.; Zhang, L.; Chen, G.; Hu, X.; Zhang, Z.; Zhang, H. Dietary Effects on Biological Parameters and Gut microbiota of Harmonia axyridis. Front. Microbiol. 2021, 12, 818787. [Google Scholar] [CrossRef]
  16. Zhang, T.; He, Y.; Zeng, J.; Zhang, L.; Zeng, F.; Mao, J.; Zhang, G. Search for nutritional fitness traits in a biological pest control agent Harmonia axyridis using comparative transcriptomics. Front. Physiol. 2019, 10, 1148. [Google Scholar] [CrossRef]
  17. Chung, S.L.; Ferrier, L.K.; Squires, E.J. Survey of cholesterol level of commercial eggs produced on Canadian farms. Can. J. Anim. Sci. 1991, 71, 205–209. [Google Scholar] [CrossRef]
  18. Jing, X.; Behmer, S.T. Insect sterol nutrition: Physiological mechanisms, ecology, and applications. Annu. Rev. Entomol. 2020, 65, 251–271. [Google Scholar] [CrossRef]
  19. Brookheart, R.T.; Swearingen, A.R.; Collins, C.A.; Cline, L.M.; Duncan, J.G. High-sucrose-induced maternal obesity disrupts ovarian function and decreases fertility in Drosophila melanogaster. Biochim. Biophys. Acta Mol. Basis Dis. 2017, 1863, 1255–1263. [Google Scholar] [CrossRef]
  20. Heier, C.; Kühnlein, R.P. Triacylglycerol Metabolism in Drosophila melanogaster. Genetics 2018, 210, 1163–1184. [Google Scholar]
  21. Wu, Z.; Yang, L.; He, Q.; Zhou, S. Regulatory Mechanisms of Vitellogenesis in Insects. Front. Cell Dev. Biol. 2021, 8, 593613. [Google Scholar] [CrossRef]
  22. Yamada, T.; Habara, O.; Kubo, H.; Nishimura, T. Correction: Fat body glycogen serves as a metabolic safeguard for the maintenance of sugar levels in Drosophila. Development 2018, 145, dev165910. [Google Scholar] [CrossRef] [PubMed]
  23. Birsoy, K.; Festuccia, W.T.; Laplante, M. A comparative perspective on lipid storage in animals. J. Cell Sci. 2013, 126, 1541–1552. [Google Scholar] [PubMed]
  24. Nur Aliah, N.A.; Ab-Rahim, S.; Moore, H.E.; Heo, C.C. Juvenile hormone: Production, regulation, current application in vector control and its future applications. Trop. Biomed. 2021, 38, 254–264. [Google Scholar] [CrossRef]
  25. Yin, C.M.; Zou, B.X.; Jiang, M.; Li, M.F.; Qin, W.; Potter, T.L.; Stoffolano, J.G. Identification of juvenile hormone III bisepoxide (JHB3), juvenile hormone III and methyl farnesoate secreted by the corpus allatum of Phormia regina (Meigen), in vitro and function of JHB3 either applied alone or as a part of a juvenoid blend. J. Insect Physiol. 1995, 41, 473–479. [Google Scholar] [CrossRef]
  26. Behmer, S.T. Overturning dogma: Tolerance of insects to mixed-sterol diets is not universal. Curr. Opin. Insect Sci. 2017, 23, 89–95. [Google Scholar] [CrossRef]
  27. HuangFu, N.; Zhu, X.; Chang, G.; Wang, L.; Li, D.; Zhang, K.; Gao, X.; Ji, J.; Luo, J.; Cui, J. Dynamic transcriptome analysis and Methoprene-tolerant gene knockdown reveal that juvenile hormone regulates oogenesis and vitellogenin synthesis in Propylea japonica. Genomics 2021, 113, 2877–2889. [Google Scholar] [CrossRef]
  28. Cheng, Y.; Zhou, Y.H.; Ran, H.Y.; Li, F. Effects of different hormones as dietary supplements on biological characteristics of Coccinella septempunctata L. J. Appl. Entomol. 2023, 147, 888–894. [Google Scholar] [CrossRef]
  29. Liu, F.; Liu, C.; Zeng, F. Effects of an artificial diet on development, reproduction and digestive physiology of Chrysopa septempunctata. BioControl 2013, 58, 789–795. [Google Scholar] [CrossRef]
  30. Smith, P.K.; Krohn, R.I.; Hermanson, G.T.; Mallia, A.K.; Gartner, F.H.; Provenzano, M.D.; Fujimoto, E.K.; Goeke, N.M.; Olson, B.J.; Klenk, D.C. Measurement of protein using bicinchoninic acid. Anal. Biochem. 1985, 150, 76–85, Erratum in Anal. Biochem. 1987, 163, 279. [Google Scholar] [CrossRef]
  31. Roe, J.H.; Dailey, R.E. Determination of glycogen with the anthrone reagent. Anal. Biochem. 1966, 15, 245–250. [Google Scholar] [CrossRef]
  32. Mukherjee, S.; Mishra, M. Biochemical Estimation to Detect the Metabolic Pathways of Drosophila. In Fundamental Approaches to Screen Abnormalities in Drosophila Springer Protocols Handbooks; Mishra, M., Ed.; Springer: New York, NY, USA, 2020; pp. 135–149. ISBN 978-1-4939-9755-8. [Google Scholar]
  33. Andrews, S. FastQC: A quality control tool for high throughput sequence data. EMBnet J. 2010, 17, 10–12. [Google Scholar]
  34. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
  35. Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef] [PubMed]
  36. Wang, L.; Feng, Z.; Wang, X.; Wang, X.; Zhang, X. DEGseq: An R package for identifying differentially expressed genes from RNA-seq data. Bioinformatics 2010, 26, 136–138. [Google Scholar] [CrossRef]
  37. Chen, Z.H.; Qin, J.D.; Fan, X.M.; Li, X.L. Effects of adding lipids and juvenoid into the artificial diet on feeding and reproduction of Coccinella septempunctata L. Acta Entomol. Sin. 1984, 27, 136–146. [Google Scholar] [CrossRef]
  38. Zhang, T.S.; Li, K.; Zhang, L.L.; Wang, B. Effects of artificial diet on the predatory performance of Propylea japonica. Entomol. Knowl. 2008, 45, 791–794. [Google Scholar] [CrossRef]
  39. Sacks, F.M.; Andraski, A.B. Dietary fat and carbohydrate affect the metabolism of protein-based high-density lipoprotein subspecies. Curr. Opin. Lipidol. 2022, 33, 1–15. [Google Scholar] [CrossRef]
  40. Chen, P.; Liu, J.; Chi, B.; Li, D.; Li, J.; Liu, Y. Effect of different diets on the growth and development of Harmonia axyridis (Pallas). J. Appl. Entomol. 2020, 144, 911–919. [Google Scholar] [CrossRef]
  41. Liao, S.; Amcoff, M.; Nässel, D.R. Impact of high-fat diet on lifespan, metabolism, fecundity and behavioral senescence in Drosophila. Insect Biochem. Mol. Biol. 2021, 133, 103495. [Google Scholar] [CrossRef]
  42. Li, K.; Jia, Q.Q.; Li, S. Juvenile hormone signaling-a mini review. Insect Sci. 2019, 26, 600–606. [Google Scholar] [CrossRef]
  43. Li, H.; Zhang, W.; Zhang, Y.; Guo, X.; Hou, J.; Li, H.; Wei, J.; Li, X. Effects of pyriproxyfen on development and hormone of the aphis, Aphis craccivora (Hemiptera: Aphididae). J. Econ. Entomol. 2024, 117, 1493–1502. [Google Scholar] [CrossRef] [PubMed]
  44. Du, A.; Hunter, C.S.; Murray, J.; Noble, D.; Cai, C.L.; Evans, S.M.; Stein, R.; May, C.L. Islet-1 is required for the maturation, proliferation, and survival of the endocrine pancreas. Diabetes 2009, 58, 2059–2069. [Google Scholar] [CrossRef] [PubMed]
  45. Charles, J.P. The regulation of expression of insect cuticle protein genes. Insect Biochem. Mol. Biol. 2010, 40, 205–213. [Google Scholar] [CrossRef] [PubMed]
  46. Zhao, X.; Gou, X.; Qin, Z.; Li, D.; Wang, Y.; Ma, E.; Li, S.; Zhang, J. Identification and expression of cuticular protein genes based on Locusta migratoria transcriptome. Sci. Rep. 2017, 7, 45462. [Google Scholar] [CrossRef]
  47. Sheng, Y.; Chen, J.; Jiang, H.; Lu, Y.; Dong, Z.; Pang, L.; Zhang, J.; Wang, Y.; Chen, X.; Huang, J. The vitellogenin receptor gene contributes to mating and host-searching behaviors in parasitoid wasps. iScience 2023, 26, 106298. [Google Scholar] [CrossRef]
  48. Tufail, M.; Takeda, M. Insect vitellogenin/lipophorin receptors: Molecular structures, role in oogenesis, and regulatory mechanisms. J. Insect Physiol. 2009, 55, 87–103. [Google Scholar] [CrossRef]
  49. Jing, Y.P.; Wen, X.; Li, L.; Zhang, S.; Zhang, C.; Zhou, S. The vitellogenin receptor functionality of the migratory locust depends on its phosphorylation by juvenile hormone. Proc. Natl. Acad. Sci. USA 2021, 118, e2106908118. [Google Scholar] [CrossRef]
  50. Tang, J.; Yu, R.; Zhang, Y.; Xie, J.; Song, X.; Feng, F.; Gao, H.; Li, B. Molecular and functional analysis of eclosion hormone-like gene involved in post-eclosion behavior in a beetle. J. Insect Physiol. 2022, 142, 104429. [Google Scholar] [CrossRef]
  51. Kwon, K.; Lee, K.O. Lethal (2) Essential for Life [l(2)efl] Gene in the Two-spotted Cricket, Gryllus bimaculatus (Orthoptera: Gryllidae). J. Life Sci. 2021, 31, 671–676. [Google Scholar] [CrossRef]
  52. Zhang, T.; Zhang, G.; Zeng, F.; Mao, J.; Liang, H.; Liu, F. Molecular Cloning of the Vitellogenin Gene and the Effects of Vitellogenin Protein Expression on the Physiology of Harmonia axyridis (Coleoptera: Coccinellidae). Sci. Rep. 2017, 7, 13926. [Google Scholar] [CrossRef]
  53. Roy, S.; Saha, T.T.; Zou, Z.; Raikhel, A.S. Regulatory pathways controlling female insect reproduction. Annu. Rev. Entomol. 2018, 63, 489–511. [Google Scholar] [CrossRef] [PubMed]
  54. Kinjoh, T.; Kaneko, Y.; Itoyama, K.; Mita, K.; Hiruma, K.; Shinoda, T. Control of juvenile hormone biosynthesis in Bombyx mori: Cloning of the enzymes in the mevalonate pathway and assessment of their developmental expression in the corpora allata. Insect Biochem. Mol. Biol. 2007, 37, 808–818. [Google Scholar] [CrossRef] [PubMed]
  55. Raikhel, A.S.; Brown, M.R.; Bellés, X. Hormonal Control of Reproductive Processes. Comprehensive Molecular Insect Science; Gilbert, L.I., Iatrou, K., Gill, S.S., Eds.; Elsevier: Amsterdam, The Netherlands, 2005; Volume 3, pp. 433–491. [Google Scholar]
  56. Ament, S.A.; Chan, Q.W.; Wheeler, M.M.; Nixon, S.E.; Johnson, S.P.; Rodriguez-Zas, S.L.; Foste, L.J.; Robinson, G.E. Mechanisms of stable lipid loss in a social insect. J. Exp. Biol. 2011, 215, 1271–1278. [Google Scholar] [CrossRef]
  57. Malik, N.; Ferreira, B.I.; Hollstein, P.E.; Pablo, E.H.; Stephanie, D.C.; Elijah, T.; Sammy, W.N.; Jingting, Y.; Rebecca, G.; Kristina, H.; et al. Induction of lysosomal and mitochondrial biogenesis by AMPK phosphorylation of FNIP1. Science 2023, 380, eabj5559. [Google Scholar] [CrossRef]
  58. Davies, B.; Baumann, C.; Kirchhoff, C.; Ivell, R.; Nubbemeyer, R.; Habenicht, U.F.; Theuring, F.; Gottwald, U. Targeted deletion of the epididymal receptor HE6 results in fluid dysregulation and male infertility. Mol. Cell. Biol. 2004, 24, 8642–8648. [Google Scholar] [CrossRef]
Insects 16 00380 g001
Figure 1. Effect of ovarian development of different artificial diets in H. axyridis. (a) Dissected ovaries five days after emergence. Diet 1 (standard, artificial), Diet 2 (low fat artificial), and Diet 3 (addition of juvenile hormone III to Diet 2). (b) ovarian length and ovarian width. The scale bar represents 1 mm. Different letters above each bar indicate significant differences among different treatments using One-way ANOVA test (p < 0.05).
Figure 1. Effect of ovarian development of different artificial diets in H. axyridis. (a) Dissected ovaries five days after emergence. Diet 1 (standard, artificial), Diet 2 (low fat artificial), and Diet 3 (addition of juvenile hormone III to Diet 2). (b) ovarian length and ovarian width. The scale bar represents 1 mm. Different letters above each bar indicate significant differences among different treatments using One-way ANOVA test (p < 0.05).
Insects 16 00380 g001
Insects 16 00380 g002
Figure 2. Protein, glycogen, and triglyceride content during the female adult stage after different artificial diets. Diet 1, Diet 2, and Diet 3 were fed on the first day of emergence. Protein, glycogen, and triglyceride contents were monitored at 0, 10, 20, 30, and 40 days of age. SPSS analyzed the significance of the differences in the nutrient content. The nutrient contents are shown as the means ± SEs and were found to be significantly different. Different letters above each bar indicate significant differences among different treatments using One-way ANOVA (p < 0.001) and Kruskal-Wallis test (p < 0.05).
Figure 2. Protein, glycogen, and triglyceride content during the female adult stage after different artificial diets. Diet 1, Diet 2, and Diet 3 were fed on the first day of emergence. Protein, glycogen, and triglyceride contents were monitored at 0, 10, 20, 30, and 40 days of age. SPSS analyzed the significance of the differences in the nutrient content. The nutrient contents are shown as the means ± SEs and were found to be significantly different. Different letters above each bar indicate significant differences among different treatments using One-way ANOVA (p < 0.001) and Kruskal-Wallis test (p < 0.05).
Insects 16 00380 g002
Insects 16 00380 g003
Figure 3. Scatter diagrams representing the comparisons of the genome-wide expression profiles of control and treatment. Note: Each green point represents a decrease, each red point represents an increase, and each blue point represents no significant difference in gene expression.
Figure 3. Scatter diagrams representing the comparisons of the genome-wide expression profiles of control and treatment. Note: Each green point represents a decrease, each red point represents an increase, and each blue point represents no significant difference in gene expression.
Insects 16 00380 g003
Insects 16 00380 g004
Figure 4. Summary of the annotations of differentially expressed genes in H. axyridis. The GO classifications are shown according to involvement in biological processes, cellular components, and molecular functions.
Figure 4. Summary of the annotations of differentially expressed genes in H. axyridis. The GO classifications are shown according to involvement in biological processes, cellular components, and molecular functions.
Insects 16 00380 g004
Insects 16 00380 g005
Figure 5. The 20 most significant KEGG pathways were selected from the KEGG enrichment results. In the figure, the abscissa indicates the ratio of differential genes annotated to the KEGG pathways to the total number of such genes; the ordinate stands for the KEGG pathways. The size of the points represents the number of genes annotated to the KEGG pathways, and the color from red to purple represents the significance level of enrichment.
Figure 5. The 20 most significant KEGG pathways were selected from the KEGG enrichment results. In the figure, the abscissa indicates the ratio of differential genes annotated to the KEGG pathways to the total number of such genes; the ordinate stands for the KEGG pathways. The size of the points represents the number of genes annotated to the KEGG pathways, and the color from red to purple represents the significance level of enrichment.
Insects 16 00380 g005
Insects 16 00380 g006
Figure 6. Analysis of differentially expressed genes under different artificial diets in H. axyridis. The expression changes for each candidate gene as measured by RNA-seq and qRT-PCR.
Figure 6. Analysis of differentially expressed genes under different artificial diets in H. axyridis. The expression changes for each candidate gene as measured by RNA-seq and qRT-PCR.
Insects 16 00380 g006
Table 1. The percentage composition of each component per 100 g of artificial diets.
Table 1. The percentage composition of each component per 100 g of artificial diets.
IngridientsDiet 1Diet 2Diet 3
Fresh pig liver35%35%35%
Whole egg30%--
Egg white-30%30%
Brown sugar14.9%14.9%14.9%
Pork9.9%9.9%9.9%
Yeast extract5%5%5%
Vitamin C0.2%0.2%0.2%
Linseed oil5%5%5%
Juvenile hormone III--10%
Table 3. Illumina-sequencing data analysis results.
Table 3. Illumina-sequencing data analysis results.
SampleLibraryRaw ReadsRaw BasesClean ReadsClean BasesError RateQ30GC pct
Diet1-1FRAS230248041-1r430921266.46G420991926.31G0.0294.1739.36
Diet1-2FRAS230248044-1r427279806.41G418072466.27G0.0393.2838.19
Diet1-3FRAS230248050-1r430686206.46G421384006.32G0.0393.9539.28
Diet2-1FRAS230248053-1r430657026.46G419189706.29G0.0294.4539.26
Diet2-2FRAS230248056-1r453254066.8G444286566.66G0.0393.7539.02
Diet2-3FRAS230248059-1r430144866.45G420940546.31G0.0294.1738.06
Diet3-1FRAS230248068-1r447111086.71G440490246.61G0.0393.9539.21
Diet3-2FRAS230248071-1r441410146.62G433608526.5G0.0294.2938.69
Diet3-3FRAS230248074-1r453194186.8G440101486.6G0.0393.7438.52
Table 4. Information of H. axyridis cultivable bacteria by Blast against GenBank database.
Table 4. Information of H. axyridis cultivable bacteria by Blast against GenBank database.
Gene IDHomologous
Function in Nr		Primer
(5′-3′)		Expression LevelFragment Size (bp)Tm (°C)
123686364Vitellogenin-1GATGGATACGAGTACCCACT
CTTTGCTTAGCCAAGACG		up14958
123686370VitellogeninAAGAGTCGCGCACAGAAGAA
TGCAATGGGACTTGCAAACG		up19959
123674747Glucose dehydrogenaseACCCTTCGTGATGGTCTG
CCTGTAGCCTGATAAGTTTC		up13759
123677096Adhesion G-protein coupled receptor G4AAGTGTAAGTTAGTAGGGTGTT
TAGGAATAAGTGCGAAAC		up17259
123689048Vitellogenin receptorAATCACCCAGAACGTCACCC
CCGTCAGGCTGGACAGATTT		up18658
123676458Eclosion hormoneTTGAAGCCTATAAGACTGG
CAAGAATGGTGCAACTGA		up18557
123678499Folliculin-interacting proteinGGCTACCTGTTTGCCTCG
GGATGTCCTACCGCACCA		up11158
123678119Lethal (2) essential for lifeATTTCCAGGCAGTTTGTT
GGGATGGTTTTATGATCAATACTCT		up15459
123672779Cuticle proteinCGCGTTCTCCTACAAAGTGG
CGCTCCGACATTACTCCTCT		up22658
123688747Insulin gene enhancer protein ISL-1ATGGGGCGATGCAAGGTATA
GCCGTGCATCTGGTTAACAA		up19159
123684308Juvenile hormone acid O-methyltransferaseTCAGGAGATGGACACACTCTG
ACTCTGCTTGACAACCCAGT		up24058
123674045β-actinACCCATCTACGAAGGTTATGC
CGGTGGTGGTGAAAGAGTAA		up12257
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, T.; Yu, Y.; Li, J.; Zheng, L.; Chen, S.; Mao, J. Comparative Transcriptome Analysis of the Effects of a Non-Insect Artificial Diet on the Nutritional Development of Harmonia axyridis. Insects 2025, 16, 380. https://doi.org/10.3390/insects16040380

AMA Style

Zhang T, Yu Y, Li J, Zheng L, Chen S, Mao J. Comparative Transcriptome Analysis of the Effects of a Non-Insect Artificial Diet on the Nutritional Development of Harmonia axyridis. Insects. 2025; 16(4):380. https://doi.org/10.3390/insects16040380

Chicago/Turabian Style

Zhang, Tingting, Yinchen Yu, Jianyu Li, Li Zheng, Shiwei Chen, and Jianjun Mao. 2025. "Comparative Transcriptome Analysis of the Effects of a Non-Insect Artificial Diet on the Nutritional Development of Harmonia axyridis" Insects 16, no. 4: 380. https://doi.org/10.3390/insects16040380

APA Style

Zhang, T., Yu, Y., Li, J., Zheng, L., Chen, S., & Mao, J. (2025). Comparative Transcriptome Analysis of the Effects of a Non-Insect Artificial Diet on the Nutritional Development of Harmonia axyridis. Insects, 16(4), 380. https://doi.org/10.3390/insects16040380

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop